Search Results

Search found 42468 results on 1699 pages for 'default program'.

Page 1599/1699 | < Previous Page | 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606  | Next Page >

  • Execute a jar file using Ant

    - by geetha
    I am trying to create a runnable jar file from java classes using ant. The java classes use external jars. When I execute the build.xml its showing class not found exception while running the java program. Its compiling fine. Part of My source code: <path id="project-libpath"> <fileset dir="${lib.dir}"> <include name="*.jar"/> </fileset> </path> <path id="project-classpath"> <fileset dir="C:/xmldecode/lib"> <include name="*.jar"/> </fileset> </path> <target name="compile" depends="prepare"> <javac srcdir="${src.dir}" destdir="${classes.dir}"> <classpath refid="project-classpath"/> </javac> </target> <target name="jar" depends="compile"> <copy todir="${classes.dir}"> <fileset dir="C:/xmldecode/lib"/> </copy> <pathconvert property="mf.classpath" pathsep=";"> <path refid="project-classpath" /> <flattenmapper /> </pathconvert> <jar destfile="${jar.dir}/${ant.project.name}.jar" basedir="${classes.dir}"> <manifest> <attribute name="Main-Class" value="${main-class}"/> <attribute name="Class-Path" value="${mf.classpath}"/> </manifest> </jar> </target> <target name="run" depends="jar"> <java jar="${jar.dir}/${ant.project.name}.jar" fork="true"> </java>

    Read the article

  • Catching error caused by InitialContext.lookup

    - by Martin Schröder
    I'm developing a command line client (Java SE6) that now needs to talk to a Glassfish 2.1 server. The code for setting up this connection is try { final InitialContext context = new InitialContext(); final String ejbName = GeneratorCancelledRemote.class.getName(); generatorCancelled = (GeneratorCancelledRemote) context.lookup(ejbName); } catch (Throwable t) { System.err.println("--> Could not call server:"); t.printStackTrace(System.err); runWithOutEJB = true; } I'm now testing it without a running server and the client (when run from Eclipse 4.2) just bombs with 31.10.2012 10:40:09 com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl WARNUNG: "IOP00410201: (COMM_FAILURE) Connection failure: socketType: IIOP_CLEAR_TEXT; hostname: localhost; port: 3700" org.omg.CORBA.COMM_FAILURE: vmcid: SUN minor code: 201 completed: No at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2783) at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2804) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:261) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:274) at com.sun.corba.ee.impl.transport.SocketOrChannelContactInfoImpl.createConnection(SocketOrChannelContactInfoImpl.java:130) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.beginRequest(CorbaClientRequestDispatcherImpl.java:192) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.request(CorbaClientDelegateImpl.java:184) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.is_a(CorbaClientDelegateImpl.java:328) at org.omg.CORBA.portable.ObjectImpl._is_a(ObjectImpl.java:112) at org.omg.CosNaming.NamingContextHelper.narrow(NamingContextHelper.java:69) at com.sun.enterprise.naming.SerialContext.narrowProvider(SerialContext.java:134) at com.sun.enterprise.naming.SerialContext.getCachedProvider(SerialContext.java:259) at com.sun.enterprise.naming.SerialContext.getRemoteProvider(SerialContext.java:204) at com.sun.enterprise.naming.SerialContext.getProvider(SerialContext.java:159) at com.sun.enterprise.naming.SerialContext.lookup(SerialContext.java:409) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.werkii.latex.generator.Generator.main(Generator.java:344) Caused by: java.lang.RuntimeException: java.net.ConnectException: Connection refused: connect at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:347) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:244) ... 14 more Caused by: java.net.ConnectException: Connection refused: connect at sun.nio.ch.Net.connect(Native Method) at sun.nio.ch.SocketChannelImpl.connect(SocketChannelImpl.java:532) at com.sun.corba.ee.impl.orbutil.ORBUtility.openSocketChannel(ORBUtility.java:105) at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:332) ... 15 more It's o.k. for now (while I'm still in development) that it bombs, but it does this repeatedly and the catch clause is never reached (even though I'm catching Throwable) - the message is not printed. So how can I handle connection errors during lookup in my program?

    Read the article

  • How to cache queries in EJB and return result efficient (performance POV)

    - by Maxym
    I use JBoss EJB 3.0 implementation (JBoss 4.2.3 server) At the beginning I created native query all the time using construction like Query query = entityManager.createNativeQuery("select * from _table_"); Of couse it is not that efficient, I performed some tests and found out that it really takes a lot of time... Then I found a better way to deal with it, to use annotation to define native queries: @NamedNativeQuery( name = "fetchData", value = "select * from _table_", resultClass=Entity.class ) and then just use it Query query = entityManager.createNamedQuery("fetchData"); the performance of code line above is two times better than where I started from, but still not that good as I expected... then I found that I can switch to Hibernate annotation for NamedNativeQuery (anyway, JBoss's implementation of EJB is based on Hibernate), and add one more thing: @NamedNativeQuery( name = "fetchData2", value = "select * from _table_", resultClass=Entity.class, readOnly=true) readOnly - marks whether the results are fetched in read-only mode or not. It sounds good, because at least in this case of mine I don't need to update data, I wanna just fetch it for report. When I started server to measure performance I noticed that query without readOnly=true (by default it is false) returns result with each iteration better and better, and at the same time another one (fetchData2) works like "stable" and with time difference between them is shorter and shorter, and after 5 iterations speed of both was almost the same... The questions are: 1) is there any other way to speed query using up? Seems that named queries should be prepared once, but I can't say it... In fact if to create query once and then just use it it would be better from performance point of view, but it is problematic to cache this object, because after creating query I can set parameters (when I use ":variable" in query), and it changes query object (isn't it?). well, is here any way to cache them? Or named query is the best option I can use? 2) any other approaches how to make results retrieveng faster. I mean, for instance I don't need those Entities to be attached, I won't update them, all I need is just fetch collection of data. Maybe readOnly is the only available way, so I can't speed it up, but who knows :) P.S. I don't ask about DB performance, all I need now is how not to create query all the time, so use it efficient, and to "allow" EJB to do less job with the same result concerning data returning.

    Read the article

  • Javascript - Canvas image never appears on first function run

    - by Matt
    I'm getting a bit of a weird issue, the image never shows the first time you run the game in your browser, after that you see it every time. If you close your browser and re open it and run the game again, the same issue occurs - you don't see the image the first time you run it. Here's the issue in action, just hit a wall and there's no image the first time on the end game screen. Any help would be appreciated. Regards, Matt function showGameOver() { ctx.clearRect(0, 0, canvas.width, canvas.height); ctx.fillStyle = "black"; ctx.font = "16px sans-serif"; ctx.fillText("Game Over!", ((canvas.width / 2) - (ctx.measureText("Game Over!").width / 2)), 50); ctx.font = "12px sans-serif"; ctx.fillText("Your Score Was: " + score, ((canvas.width / 2) - (ctx.measureText("Your Score Was: " + score).width / 2)), 70); myimage = new Image(); myimage.src = "xcLDp.gif"; var size = [119, 26], //set up size coord = [443, 200]; ctx.font = "12px sans-serif"; ctx.fillText("Restart", ((canvas.width / 2) - (ctx.measureText("Restart").width / 2)), 197); ctx.drawImage( //draw it on canvas myimage, coord[0], coord[1], size[0], size[1] ); $("canvas").click(function(e) { //when click.. if ( testIfOver(this, e, size, coord) ) { startGame(); //reload } }); $("canvas").mousemove(function(e) { //when mouse moving if ( testIfOver(this, e, size, coord) ) { $(this).css("cursor", "pointer"); //change the cursor } else { $(this).css("cursor", "default"); //change it back } }); function testIfOver(ele,ev,size,coord){ if ( ev.pageX > coord[0] + ele.offsetLeft && ev.pageX < coord[0] + size[0] + ele.offsetLeft && ev.pageY > coord[1] + ele.offsetTop && ev.pageY < coord[1] + size[1] + ele.offsetTop ) { return true; } return false; } }

    Read the article

  • Can sorting Japanese kanji words be done programatically?

    - by Mason
    I've recently discovered, to my astonishment (having never really thought about it before), machine-sorting Japanese proper nouns is apparently not possible. I work on an application that must allow the user to select a hospital from a 3-menu interface. The first menu is Prefecture, the second is City Name, and the third is Hospital. Each menu should be sorted, as you might expect, so the user can find what they want in the menu. Let me outline what I have found, as preamble to my question: The expected sort order for Japanese words is based on their pronunciation. Kanji do not have an inherent order (there are tens of thousands of Kanji in use), but the Japanese phonetic syllabaries do have an order: ???????????????????... and on for the fifty traditional distinct sounds (a few of which are obsolete in modern Japanese). This sort order is called ???? (gojuu on jun , or '50-sound order'). Therefore, Kanji words should be sorted in the same order as they would be if they were written in hiragana. (You can represent any kanji word in phonetic hiragana in Japanese.) The kicker: there is no canonical way to determine the pronunciation of a given word written in kanji. You never know. Some kanji have ten or more different pronunciations, depending on the word. Many common words are in the dictionary, and I could probably hack together a way to look them up from one of the free dictionary databases, but proper nouns (e.g. hospital names) are not in the dictionary. So, in my application, I have a list of every prefecture, city, and hospital in Japan. In order to sort these lists, which is a requirement, I need a matching list of each of these names in phonetic form (kana). I can't come up with anything other than paying somebody fluent in Japanese (I'm only so-so) to manually transcribe them. Before I do so though: Is it possible that I am totally high on fire, and there actually is some way to do this sorting without creating my own mappings of kanji words to phonetic readings, that I have somehow overlooked? Is there a publicly available mapping of prefecture/city names, from the government or something? That would reduce the manual mapping I'd need to do to only hospital names. Does anybody have any other advice on how to approach this problem? Any programming language is fine--I'm working with Ruby on Rails but I would be delighted if I could just write a program that would take the kanji input (say 40,000 proper nouns) and then output the phonetic representations as data that I could import into my Rails app. ??????????

    Read the article

  • How to change source order of <div> in less steps/automatically?

    - by metal-gear-solid
    How can i do this task automate. i need to change source order of div, which has same id in above 100 pages. i created example This is default condition <div class="identification"> <div class="number">Number 1</div> </div> <div class="identification"> <div class="number">Number 2</div> </div> <div class="identification"> <div class="number">Number 3</div> </div> <div class="identification"> <div class="number">Number 4</div> </div> <div class="identification"> <div class="number">Number 5</div> </div> <div class="identification"> <div class="number">Number 6</div> </div> I need lik this <div class="identification"> <div class="number">Number 1</div> </div> <div class="identification"> <div class="number">Number 3</div> </div> <div class="identification"> <div class="number">Number 2</div> </div> <div class="identification"> <div class="number">Number 6</div> </div> <div class="identification"> <div class="number">Number 4</div> </div> <div class="identification"> <div class="number">Number 5</div> </div> Is the manual editing only option? I use dreamweaver.

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • WPF multibound textblock not updating

    - by Superstringcheese
    I want to create a program which calculates how long it will take to repeat a process a certain number of times. I've scaled this down a lot for this example. So, I have some textboxes which are bound to properties in a class: Count: <TextBox x:Name="txtCount" Text="{Binding Count, Mode=TwoWay}" Width="50"/> Days: <TextBox x:Name="txtDays" Text="{Binding Days, Mode=TwoWay}" Width="50"/> and a textblock which is multibound like so: <TextBlock x:Name="tbkTotal"> <TextBlock.Text> <MultiBinding StringFormat="Days: {0}, Count: {1}"> <Binding Path="Days" /> /* This isn't updating */ <Binding Path="Count" /> </MultiBinding> </TextBlock.Text> </TextBlock> My DataContext is set in the Window1.xaml.cs file. public Window1() { InitializeComponent(); Sample sample = new Sample(); this.DataContext = sample; } I can update the multibound textblock with the Count property just fine, but the Days property always shows 0, even though the Days input accurately reflects changes. I believe that this is because my accessors are different for Days - namely, the Set method. This class is in a different file. public class Sample : INotifyPropertyChanged { private int _count; private TimeSpan _span; public int Count { get { return _count; } set { _count = value; NotifyPropertyChanged("Count"); /* Doesn't seem to be needed, actually */ } } public TimeSpan Span { get { return _span; } } /* The idea is to provide a property for Days, Hours, Minutes, etc. as conveniences to the inputter */ public double Days { get { return _span.Days; } set { TimeSpan ts = new TimeSpan(); double val = value > 0 ? value : 0; ts = TimeSpan.FromDays(val); _span.Add(ts); NotifyPropertyChanged("Span"); /* Here I can only get it to work if I notify that Span has changed - doesn't seem to be aware that the value behind Days has changed. */ } } private void NotifyPropertyChanged(string property) { if (null != this.PropertyChanged) { PropertyChanged(this, new PropertyChangedEventArgs(property)); } } public Sample() { _count = 0; _span = new TimeSpan(); } public event PropertyChangedEventHandler PropertyChanged; }

    Read the article

  • vb6 ADODB TSQL procedure call quit working after database migration

    - by phill
    This code was once working on sql server 2005. Now isolated in a visual basic 6 sub routine using ADODB to connect to a sql server 2008 database it throws an error saying: "Login failed for user 'admin' " I have since verified the connection string does work if i replace the body of this sub with the alternative code below this sub. When I run the small program with the button, it stops where it is marked below the asterisk line. Any ideas? thanks in advance. Private Sub Command1_Click() Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset Dim dStartDateIn As Date dStartDateIn = "2010/05/01" cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" 'On Error GoTo GetUnconvertedInvoices_Err With cmdGetInvoices .CommandType = adCmdStoredProc .CommandText = "_sp_cwm5_GetUnCvtdInv" .Name = "_sp_cwm5_GetUnCvtdInv" Set oParm1 = .CreateParameter("@StartDate", adDate, adParamInput) .Parameters.Append oParm1 oParm1.Value = dStartDateIn .ActiveConnection = cSQLConn End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic .CursorType = adOpenKeyset '.CursorType = adOpenStatic .CacheSize = 5000 '***************************Debug stops here .Open cmdGetInvoices End With If myRs.State = adStateOpen Then Set GetUnconvertedInvoices = myRs Else Set GetUnconvertedInvoices = Nothing End If End Sub Here is the code which validates the connection string is working. Dim cSQLConn As New ADODB.Connection Dim cmdGetInvoices As New ADODB.Command Dim myRs As New ADODB.Recordset cSQLConn.ConnectionString = "Provider=sqloledb;" _ & "SERVER=NET-BRAIN;" _ & "Database=DB_app;" _ & "User Id=admin;" _ & "Password=mudslinger;" cSQLConn.Open cmdGetInvoices.CommandTimeout = 0 sProc = "GetUnconvertedInvoices" With cmdGetInvoices .ActiveConnection = cSQLConn .CommandText = "SELECT top 5 * FROM tarInvoice;" .CommandType = adCmdText End With With myRs .CursorLocation = adUseClient .LockType = adLockBatchOptimistic '.CursorType = adOpenKeyset .CursorType = adOpenStatic '.CacheSize = 5000 .Open cmdGetInvoices End With If myRs.EOF = False Then myRs.MoveFirst Do MsgBox "Record " & myRs.AbsolutePosition & " " & _ myRs.Fields(0).Name & "=" & myRs.Fields(0) & " " & _ myRs.Fields(1).Name & "=" & myRs.Fields(1) myRs.MoveNext Loop Until myRs.EOF = True End If

    Read the article

  • initializing a vector of custom class in c++

    - by Flamewires
    Hey basically Im trying to store a "solution" and create a vector of these. The problem I'm having is with initialization. Heres my class for reference class Solution { private: // boost::thread m_Thread; int itt_found; int dim; pfn_fitness f; double value; std::vector<double> x; public: Solution(size_t size, int funcNo) : itt_found(0), x(size, 0.0), value(0.0), dim(30), f(Eval_Functions[funcNo]) { for (int i = 1; i < (int) size; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[funcNo]; } } Solution() : itt_found(0), x(31, 0.0), value(0.0), dim(30), f(Eval_Functions[1]) { for (int i = 1; i < 31; i++) { x[i] = ((double)rand()/((double)RAND_MAX))*maxs[1]; } } Solution operator= (Solution S) { x = S.GetX(); itt_found = S.GetIttFound(); dim = S.GetDim(); f = S.GetFunc(); value = S.GetValue(); return *this; } void start() { value = f (dim, x); } /* plus additional getter/setter methods*/ } Solution S(30, 1) or Solution(2, 5) work and initalizes everything, but I need X of these solution objects. std::vector<Solution> Parents(X) will create X solutions with the default constructor and i want to construct using the (int, int) constructor. Is there any easy(one liner?) way to do this? Or would i have to do something like: size_t numparents = 10; vector<Solution> Parents; Parents.reserve(numparents); for (int i = 0; i<(int)numparents; i++) { Solution S(31, 0); Parents.push_back(S); }

    Read the article

  • Equivalent of System.Windows.Forms.Cursor in Web Application

    - by Vishwa
    Hi I have a code in windows application now i am trying to implement in web Application but it is showimg that it ths no cursor class (System.Windows.Forms.Cursor )so..wat is the equivalent in web application. Here is my code private void btnGo_Click(System.Object sender, System.EventArgs e) { this.Cursor = Cursors.WaitCursor; Application.DoEvents(); // Load the images. Bitmap bm1 = (Bitmap) (Image.FromFile(txtFile1.Text)); Bitmap bm2 = (Bitmap) (Image.FromFile(txtFile2.Text)); // Make a difference image. int wid = Math.Min(bm1.Width, bm2.Width); int hgt = Math.Min(bm1.Height, bm2.Height); Bitmap bm3 = new Bitmap(wid, hgt); // Create the difference image. bool are_identical = true; int r1; int g1; int b1; int r2; int g2; int b2; int r3; int g3; int b3; Color eq_color = Color.White; Color ne_color = Color.Transparent; for (int x = 0; x <= wid - 1; x++) { for (int y = 0; y <= hgt - 1; y++) { if (bm1.GetPixel(x, y).Equals(bm2.GetPixel(x, y))) { bm3.SetPixel(x, y, eq_color); } else { bm1.SetPixel(x, y, ne_color); are_identical = false; } } } // Display the result. picResult.Image = bm1; Bitmap Logo = new Bitmap(picResult.Image); Logo.MakeTransparent(Logo.GetPixel(1, 1)); picResult.Image = (Image)Logo; this.Cursor = Cursors.Default; if ((bm1.Width != bm2.Width) || (bm1.Height != bm2.Height)) { are_identical = false; } if (are_identical) { MessageBox.Show("The images are identical"); } else { MessageBox.Show("The images are different"); } //bm1.Dispose() // bm2.Dispose() }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • TimeOuts with HttpWebRequest when running Selenium concurrently in .NET

    - by domsom
    I have a download worker that uses ThreadPool-threads to download files. After enhancing these to apply some Selenium tests to the downloaded files, I am constantly experiencing TimeOut-exceptions with the file downloaders and delays running the Selenium tests. More precisely: When the program starts, the download threads start downloading and a couple of pages are seamlessly processed via Selenium Shortly after, the first download threads start throwing TimeOut exceptions from HttpWebRequest. At the same time, commands stop flowing to Selenium (as observed in the SeleniumRC log), but the thread running Selenium is not getting any exception This situation holds as long as there are entries in the download list: new download threads are being started and terminate after receiving TimeOuts (without trying to lock Selenium) As soon as no more download threads are being started, Selenium starts receiving commands again and the threads waiting for the lock are processed sequentially as designed Now here's the download code: HttpWebRequest request = null; WebResponse response = null; Stream stream = null; StreamReader sr = null; try { request = (HttpWebRequest) WebRequest.Create(uri); request.ServicePoint.ConnectionLimit = MAX_CONNECTIONS_PER_HOST; response = request.GetResponse(); stream = response.GetResponseStream(); // Read the stream... } finally { if (request != null) request.Abort(); if (response != null) response.Close(); if (stream != null) { stream.Close(); stream.Dispose(); } if (sr != null) { sr.Close(); sr.Dispose(); } } And this is how Selenium is used afterwards in the same thread: lock(SeleniumLock) { selenium.Open(url); // Run some Selenium commands, but no selenium.stop() } Where selenium is a static variable that is initialized in the static constructor of the class (via selenium.start()). I assume I am running into the CLR connection limit, so I added these lines during initalization: ThreadPool.GetMaxThreads (out maxWorkerThreads, out maxCompletionPortThreads); HttpUtility.MAX_CONNECTIONS_PER_HOST = maxWorkerThreads; System.Net.ServicePointManager.DefaultConnectionLimit = maxWorkerThreads + 1; The + 1 is for the connection to the SeleniumRC, due to my guess that the Selenium client code also uses HttpWebRequest. It seems like I'm still running into some kind of deadlock - although the threads waiting for the Selenium lock do not hold any resources. Any ideas on how to get this working?

    Read the article

  • ZF-Autoloader not working in UnitTests on Ubuntu

    - by Sam
    i got a problem regarding Unit-testing a Zend-Framework application under Ubuntu 12.04. The project-structure is a default zend application whereas the models are defined as the following ./application ./models ./DbTable ./ProjectStatus.php (Application_Model_DbTable_ProjectStatus) ./Mappers ./ProjectStatus.php (Application_Model_Mapper_ProjectStatus) ./ProjectStatus.php (Application_Model_ProjectStatus) The Problem here is with the Zend-specific autoloading. The naming convention here appears that the folder Mappers loads all classes with _Mapper but not _Mappers. This is some internal Zend behavior which is fine so far. On my windows machine the phpunit runs without any Problems, trying to initiate all those classes. On my Ubuntu machine however with jenkins running on it, phpunit fails to find the appropriate classes giving me the following error Fatal error: Class 'Application_Model_Mapper_ProjectStatus' not found in /var/lib/jenkins/jobs/PAM/workspace/tests/application/models/Mapper/ProjectStatusTest.php on line 39 The error appears to really be that the Zend-Autoloader doesn't load from the ubuntu machine, but i can't figure out how or why this works. The question remains of why this is. I think i've double checked every point of contact with the zend autoloading stuff, but i just can't figure this out. I'll paste the - from my point of view relevant snippets - and hope someone of you has any insight to this. Jenkins Snippet for PHPUnit <target name="phpunit" description="Run unit tests with PHPUnit"> <exec executable="phpunit" failonerror="true"> <arg line="--configuration '${basedir}/tests/phpunit.xml' --coverage-clover '${basedir}/build/logs/clover.xml' --coverage-html '${basedir}/build/coverage/.' --log-junit '${basedir}/build/logs/junit.xml'" /> </exec> </target> ./tests/phpunit.xml <phpunit bootstrap="./bootstrap.php"> ... this shouldn't be of relevance ... </phpunit> ./tests/bootstrap.php <?php // Define path to application directory defined('APPLICATION_PATH') || define('APPLICATION_PATH', realpath(dirname(__FILE__) . '/../application')); // Define application environment defined('APPLICATION_ENV') || define('APPLICATION_ENV', (getenv('APPLICATION_ENV') ? getenv('APPLICATION_ENV') : 'testing')); // Ensure library/ is on include_path set_include_path(implode(PATH_SEPARATOR, array( realpath(APPLICATION_PATH . '/../library'), get_include_path(), ))); require_once 'Zend/Loader/Autoloader.php'; Zend_Loader_Autoloader::getInstance(); Any help will be appreciated.

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • Help with bugs in a C code

    - by Yanki Twizzy
    This C code is giving me some unpredictable results. The program is meant to collect 6 nos and print out the max, position of the max no and the average. It's supposed to have only 3 functions - input, max_avr_pos and output for doing what the code is supposed to do but I am getting unpredictable results. Please what could be the problem #include <stdio.h> #include <stdlib.h> #include <conio.h> void input_vals(int arrnum[]); void max_ave_val(int arrnum1[],double *average,int *maxval,int *position); void print_output(double *average1,int *maxval1,int *position1); int main(void) { int arrnum[6],maxval2,position2; double average2; input_vals(arrnum); max_ave_val(arrnum,&average2,&maxval2,&position2); print_output(&average2,&maxval2,&position2); _getche(); return 0; } void input_vals(int arrnum[]) { int count; printf("\n Please enter six numbers\n"); for(count=0;count<6;count++) { scanf("%d",&arrnum[count]); } } void max_ave_val(int arrnum1[],double *average,int *maxval,int *position) { int total=0; int cnt,cnt1,cnt2,limit,maxval2,post; limit=6; /* finding the max value*/ for(cnt=0;cnt<limit-1;cnt++) for(cnt1=limit-1;cnt1>cnt;--cnt1) { if(arrnum1[cnt1-1]>arrnum1[cnt1]) { maxval2=arrnum1[cnt-1]; post=(cnt-1)+1; } else { maxval2=arrnum1[cnt1]; post=cnt1+1; } } *maxval=maxval2; *position=post; /* solving for total */ for(cnt2=0;cnt2<limit;cnt2++); { total=total+arrnum1[cnt2]; } *average=total/limit; } void print_output(double *average1,int *maxval1,int *position1) { printf("\n value of the highest of the numbers is %d\n",*maxval1); printf("\n the average of all the numbers is %g\n",*average1); printf("\n the postion of the highest number in the list is %d\n",*position1); }

    Read the article

  • Pointers to class fields

    - by newbie_cpp
    My task is as follows : Using pointers to class fields, create menu allowing selection of ice, that Person can buy in Ice shop. Buyer will be charged with waffel and ice costs. Selection of ice and charging buyers account must be shown in program. Here's my Person class : #include <iostream> using namespace std; class Iceshop { const double waffel_price = 1; public: } class Person { static int NUMBER; char* name; int age; const int number; double plus, minus; public: class Account { int number; double resources; public: Account(int number, double resources) : number(number), resources(resources) {} } Person(const char* n, int age) : name(strcpy(new char[strlen(n)+1],n)), number(++NUMBER), plus(0), minus(0), age(age) {} Person::~Person(){ cout << "Destroying resources" << endl; delete [] name; } friend void show(Person &p); int* take_age(){ return &age; } char* take_name(){ return name; } void init(char* n, int a) { name = n; age = a; } Person& remittance(double d) { plus += d; return *this; } Person& paycheck(double d) { minus += d; return *this; } Account* getAccount(); }; int Person:: Person::Account* Person::getAccount() { return new Account(number, plus - minus); } void Person::Account::remittance(double d){ resources = resources + d; } void Person::Account::paycheck(double d){ resources = resources - d; } void show(Person *p){ cout << "Name: " << p->take_name() << "," << "age: " << p->take_age() << endl; } int main(void) { Person *p = new Person; p->init("Mary", 25); show(p); p->remittance(100); system("PAUSE"); return 0; } How to start this task ? Where and in what form should I store menu options ?

    Read the article

  • How to get a physics engine like Nape working?

    - by Glacius
    Introduction: I think Nape is a relatively new engine so some of you may not know it. It's supposedly faster than box2d and I like that there is decent documentation. Here's the site: http://code.google.com/p/nape/ I'm relatively new to programming. I am decent at AS3's basic functionality, but every time I try to implement some kind of engine or framework I can't even seem to get it to work. With Nape I feel I got a little further than before but I still got stuck. My problem: I'm using Adobe CS5, I managed to import the SWC file like described here. Next I tried to copy the source of one of the demo's like this one and get it to work but I keep getting errors. I made a new class file, copied the demo source to it, and tried to add it to the stage. My stage code basically looks like this: import flash.Boot; // these 2 lines are as described in the tutorial new Boot(); var demo = new Main(); // these 2 are me guessing what I'm supposed to do addChild(demo); Well, it seems the source code is not even being recognized by flash as a valid class file. I tried editing it, but even if I get it recognized (give a package name and add curly brackets) but I still get a bunch of errors. Is it psuedo code or something? What is going on? My goal: I can imagine I'm going about this the wrong way. So let me explain what I'm trying to achieve. I basically want to learn how to use the engine by starting from a simple basic example that I can edit and mess around with. If I can't even get a working example then I'm unable to learn anything. Preferably I don't want to start using something like FlashDevelop (as I'd have to learn how to use the program) but if it can't be helped then I can give it a try. Thank you.

    Read the article

  • Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

    - by Nailuj
    I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

    Read the article

  • Where can I find sample XHTML5 source codes?

    - by Bytecode Ninja
    Where can I find sample *X*HTML 5 pages? I mainly want to know if it is possible to mix and match XHTML 5 with other XML languages just like XHTML 1 or not. For example is something like this valid in XHTML 5? <!DOCTYPE html PUBLIC "WHAT SHOULD BE HERE?" "WHAT SHOULD BE HERE?"> <html xmlns="WHAT SHOULD BE HERE?" xmlns:ui="http://java.sun.com/jsf/facelets"> <head> <title><ui:insert name="title">Default title</ui:insert></title> <link rel="stylesheet" type="text/css" href="./css/main.css"/> </head> <body> <div id="header"> <ui:insert name="header"> <ui:include src="header.xhtml"/> </ui:insert> </div> <div id="left"> <ui:insert name="navigation" > <ui:include src="navigation.xhtml"/> </ui:insert> </div> <div id="center"> <br /> <span class="titleText"> <ui:insert name="title" /> </span> <hr /> <ui:insert name="content"> <div> <ui:include src="content.xhtml"/> </div> </ui:insert> </div> <div id="right"> <ui:insert name="news"> <ui:include src="news.xhtml"/> </ui:insert> </div> <div id="footer"> <ui:insert name="footer"> <ui:include src="footer.xhtml"/> </ui:insert> </div> </body> </html> Thanks in advance.

    Read the article

  • Having trouble wrapping functions in the linux kernel

    - by Corey Henderson
    I've written a LKM that implements Trusted Path Execution (TPE) into your kernel: https://github.com/cormander/tpe-lkm I run into an occasional kernel OOPS (describe at the end of this question) when I define WRAP_SYSCALLS to 1, and am at my wit's end trying to track it down. A little background: Since the LSM framework doesn't export its symbols, I had to get creative with how I insert the TPE checking into the running kernel. I wrote a find_symbol_address() function that gives me the address of any function I need, and it works very well. I can call functions like this: int (*my_printk)(const char *fmt, ...); my_printk = find_symbol_address("printk"); (*my_printk)("Hello, world!\n"); And it works fine. I use this method to locate the security_file_mmap, security_file_mprotect, and security_bprm_check functions. I then overwrite those functions with an asm jump to my function to do the TPE check. The problem is, the currently loaded LSM will no longer execute the code for it's hook to that function, because it's been totally hijacked. Here is an example of what I do: int tpe_security_bprm_check(struct linux_binprm *bprm) { int ret = 0; if (bprm->file) { ret = tpe_allow_file(bprm->file); if (IS_ERR(ret)) goto out; } #if WRAP_SYSCALLS stop_my_code(&cs_security_bprm_check); ret = cs_security_bprm_check.ptr(bprm); start_my_code(&cs_security_bprm_check); #endif out: return ret; } Notice the section between the #if WRAP_SYSCALLS section (it's defined as 0 by default). If set to 1, the LSM's hook is called because I write the original code back over the asm jump and call that function, but I run into an occasional kernel OOPS with an "invalid opcode": invalid opcode: 0000 [#1] SMP RIP: 0010:[<ffffffff8117b006>] [<ffffffff8117b006>] security_bprm_check+0x6/0x310 I don't know what the issue is. I've tried several different types of locking methods (see the inside of start/stop_my_code for details) to no avail. To trigger the kernel OOPS, write a simple bash while loop that endlessly starts a backgrounded "ls" command. After a minute or so, it'll happen. I'm testing this on a RHEL6 kernel, also works on Ubuntu 10.04 LTS (2.6.32 x86_64). While this method has been the most successful so far, I have tried another method of simply copying the kernel function to a pointer I created with kmalloc but when I try to execute it, I get: kernel tried to execute NX-protected page - exploit attempt? (uid: 0). If anyone can tell me how to kmalloc space and have it marked as executable, that would also help me solve the above problem. Any help is appreciated!

    Read the article

  • Generating Unordered List with PHP + CodeIgniter from a MySQL Database

    - by Tim
    Hello Everyone, I am trying to build a dynamically generated unordered list in the following format using PHP. I am using CodeIgniter but it can just be normal php. This is the end output I need to achieve. <ul id="categories" class="menu"> <li rel="1"> Arts &amp; Humanities <ul> <li rel="2"> Photography <ul> <li rel="3"> 3D </li> <li rel="4"> Digital </li> </ul> </li> <li rel="5"> History </li> <li rel="6"> Literature </li> </ul> </li> <li rel="7"> Business &amp; Economy </li> <li rel="8"> Computers &amp; Internet </li> <li rel="9"> Education </li> <li rel="11"> Entertainment <ul> <li rel="12"> Movies </li> <li rel="13"> TV Shows </li> <li rel="14"> Music </li> <li rel="15"> Humor </li> </ul> </li> <li rel="10"> Health </li> And here is my SQL that I have to work with. -- -- Table structure for table `categories` -- CREATE TABLE IF NOT EXISTS `categories` ( `id` mediumint(8) NOT NULL auto_increment, `dd_id` mediumint(8) NOT NULL, `parent_id` mediumint(8) NOT NULL, `cat_name` varchar(256) NOT NULL, `cat_order` smallint(4) NOT NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1 AUTO_INCREMENT=1 ; So I know that I am going to need at least 1 foreach loop to generate the first level of categories. What I don't know is how to iterate inside each loop and check for parents and do that in a dynamic way so that there could be an endless tree of children. Thanks for any help you can offer. Tim

    Read the article

  • Correct usage of socket_select().

    - by Mark Tomlin
    What is the correct way to use socket_select within PHP to send and receive data? I have a connection to the server that allows for both TCP & UDP packet connections, I am utilizing both. Within these connections I'm both sending and receiving packets on the same port, but the TCP packet will be sent on one port (29999) and UDP will be sent on another port (30000). The transmission type will be that of AF_INET. The IP address will be loopback 127.0.0.1. I have many questions on how to create a socket connection within this scenario. For example, is it better to use socket_create_pair to make the connection, or use just socket_create followed by socket_connect, and then implement socket_select? There is a chance that no data will be sent from the server to the client, and it is up to the client to maintain the connection. This will be done by utilizing the time out function within the socket_select call. Should no data be sent within the time limit, the socket_select function will break and a keep alive packet can then be sent. The following script is of the client. // Create $TCP = socket_create(AF_INET, SOCK_STREAM, SOL_TCP); $UDP = socket_create(AF_INET, SOCK_DGRAM, SOL_UDP); // Misc $isAlive = TRUE; $UDPPort = 30000; define('ISP_ISI', 1); // Connect socket_connect($TCP, '127.0.0.1', 29999); socket_connect($UDP, '127.0.0.1', $UDPPort); // Construct Parameters $recv = array($TCP, $UDP); $null = NULL; // Make The Packet to Send. $packet = pack('CCCxSSxCSa16a16', 44, ISP_ISI, 1, $UDPPort, 0, '!', 0, 'AdminPass', 'SocketSelect'); // Send ISI (InSim Init) Packet socket_write($TCP, $packet); /* Main Program Loop */ while ($isAlive == TRUE) { // Socket Select $sock = socket_select($recv, $null, $null, 5); // Check Status if ($sock === FALSE) $isAlive = FALSE; # Error else if ($sock > 0) # How does one check to find what socket changed? else # Something else happed, don't know what as it's not in the documentation, Could this be our timeout getting tripped? }

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • Solving a cyclical dependency in Ninject (Compact Framework)

    - by Alex
    I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

    Read the article

< Previous Page | 1595 1596 1597 1598 1599 1600 1601 1602 1603 1604 1605 1606  | Next Page >