Search Results

Search found 47200 results on 1888 pages for 'null object pattern'.

Page 180/1888 | < Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Why / When / How is this Android serviceBinder resetting to null?

    - by GaZ
    I've written a ListActivity for Android 2.1 which is used to display a list of event categories. As the user selects a category, the program calls a web service to retrieve a list of sub-events. For example, a top level event might be "soccer" and when the user selects this the web service would return various soccer associations (e.g. "english", "french", "german", etc.) and display them in a new list. The following code seems to work occasionally, however sometimes the call to the service (in EventsListTask) fails because the serviceBinder is null. How/Why does this happen? public class EventListsActivity extends ListActivity { private static final String EVENT_ID = "EventId"; private List<ListItem> eventList; private ArrayAdapter<ListItem> listItemArrayAdapter; private static final int LOADING_DIALOG = 1; private EventsListTask eventsListTask = null; private BFService serviceBinder; private ServiceConnection mConnection = new ServiceConnection() { public void onServiceConnected(ComponentName componentName, IBinder iBinder) { Log.i("EventListsActivity", "service connected"); serviceBinder = ((BFService.BFBinder)iBinder).getService(); } public void onServiceDisconnected(ComponentName componentName) { Log.i("EventListsActivity", "service disconnected"); serviceBinder = null; } }; @Override public void onCreate(Bundle savedInstanceState) { Log.i("EventListsActivity", "onCreate"); super.onCreate(savedInstanceState); setContentView(R.layout.list); eventList = new ArrayList<ListItem>(); listItemArrayAdapter = new ArrayAdapter<ListItem>(this, R.layout.row, eventList); setListAdapter(listItemArrayAdapter); Intent bindIntent = new Intent(this, BFService.class); bindService(bindIntent, mConnection, Context.BIND_AUTO_CREATE); int eventId = getIntent().getIntExtra(EVENT_ID, -1); if (eventsListTask == null || eventsListTask.getStatus() == AsyncTask.Status.FINISHED) { eventsListTask = new EventsListTask(); eventsListTask.execute(eventId); } } @Override protected void onDestroy() { Log.i("EventListsActivity", "destroyed"); super.onDestroy(); unbindService(mConnection); } @Override protected void onListItemClick(ListView listView, View view, int position, long id) { super.onListItemClick(listView, view, position, id); ListItem selectedItem = (ListItem) listView.getAdapter().getItem(position); Intent intent; if (selectedItem.getMarketType() != null) { intent = new Intent(this, MarketActivity.class); intent.putExtra(EVENT_ID, selectedItem.getId()); startActivityIfNeeded(intent, -1); } else if (selectedItem.getId() != -1) { intent = new Intent(this, EventListsActivity.class); intent.putExtra(EVENT_ID, selectedItem.getId()); startActivityIfNeeded(intent, -1); } else { Log.e("EventListsActivity", "unexpected item selected!"); } } @Override protected Dialog onCreateDialog(int id) { switch (id) { case (LOADING_DIALOG) : AlertDialog.Builder loadingDialog = new AlertDialog.Builder(this); loadingDialog.setTitle("Please Wait..."); loadingDialog.setMessage("Communicating with remote service."); return loadingDialog.create(); } return null; } private class EventsListTask extends AsyncTask<Integer, Void, LoginStatusEnum> { @Override protected void onPreExecute() { showDialog(LOADING_DIALOG); } @Override protected void onPostExecute(LoginStatusEnum loginStatusEnum) { dismissDialog(LOADING_DIALOG); if (loginStatusEnum != null) { switch (loginStatusEnum) { case OK: for (ListItem item : eventList) { listItemArrayAdapter.add(item); } listItemArrayAdapter.notifyDataSetChanged(); break; } } } @Override protected LoginStatusEnum doInBackground(Integer... params) { LoginStatusEnum result = LoginStatusEnum.OK; Integer eventId = params[0]; if (serviceBinder != null) { try { if (eventId == null || eventId == -1) { eventList = serviceBinder.getActiveEventTypes(); } else { eventList = serviceBinder.getEvents(eventId); } } catch (WebServiceException wse) { result = LoginStatusEnum.valueOf(wse.getMessage()); } } else { Log.e("EventListsActivity", "serviceBinder is null!"); } return result; } } } EDIT: The serviceBinder appears to be set to null when I reach the bottom of a list, when I change the target intent to go to a different activity: intent = new Intent(this, MarketActivity.class); intent.putExtra(EVENT_ID, selectedItem.getId()); startActivity(intent); This new activity also uses the same background service (binds in the same way, etc.). Is there anything I need to watch out for when doing this? Am I calling the target intent incorrectly? EDIT2: Here's the output from LogCat when I start the activity which calls the service (this time the service failed straight away!): 04-02 07:02:49.147: INFO/ActivityManager(61): Starting activity: Intent { cmp=net.foobar.activity/.EventListsActivity } 04-02 07:02:49.257: INFO/EventListsActivity(353): onCreate 04-02 07:02:49.426: INFO/EventListsActivity(353): service connected 04-02 07:02:49.437: ERROR/EventListsActivity(353): serviceBinder is null!

    Read the article

  • SoundChannel object plays small portion after being stopped and played again

    - by gok
    SoundChannel object is stopped and played again. When played again it plays small portion from the previous position and suddenly jumps back to the beginning. It doesn't play the whole sound before looping. This happens only once, then it loops normally. It happens again if I stop and play. public function play():void { channel = clip.play(trimIn); volume(currentVolume); isPlaying = true; timer.start(); channel.addEventListener(Event.SOUND_COMPLETE, loopMusic); } public function loopMusic(e:Event=null):void { if (channel != null) { timer.stop(); channel.removeEventListener(Event.SOUND_COMPLETE, loopMusic); play(); } } Do I need to somehow reset the soundChannel?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • C# Inheritence: Choosing what repository based on type of inherited class

    - by Oskar Kjellin
    I have been making a program that downloads information about movies from the internet. I have a base class Title, which represents all titles. Movie, Serie and Episode are inherited from that class. To save them to the database I have 2 services, MovieService and SerieService. They in turn call repositories, but that is not important here. I have a method Save(Title title) which I am not very happy with. I check for what type the title is and then call the correct service. I would like to perhaps write like this: ITitleService service = title.GetService(); title.GetSavedBy(service); So I have an abstract method on Title that returns an ITitleSaver, which will return the correct service for the instance. My question is how should I implement ITitleSaver? If I make it accept Title I will have to cast it to the correct type before calling the correct overload. Which will lead to having to deal with casting once again. What is the best approach to dealing with this? I would like to have the saving logic in the corresponding class.

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • Apache URL rewrite query

    - by ant-1980
    Can anyone tell me how to do this? i'm stumped! I need a modified URL in this format this55-is-a-test-id-23.html But I need the 23 as a GET. I can't rely on searching for 'id' as this may occur elsewhere in the URL. Is there any way of searching for the last occurrence of id and passing that as a get using an Apache RewriteRule in .htaccess?? Many thanks Ant

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • WPF tree data binding

    - by Am
    Hi, I have a well defined tree repository. Where I can rename items, move them up, down, etc. Add new and delete. The data is stored in a table as follows: Index Parent Label Left Right 1 0 root 1 14 2 1 food 2 7 3 2 cake 3 4 4 2 pie 5 6 5 1 flowers 8 13 6 5 roses 9 10 7 5 violets 11 12 Representing the following tree: (1) root (14) (2) food (7) (8) flowers (13) (3) cake (4) (5) pie (6) (9) roeses (10) (11) violets (12) or root food cake pie flowers roses violets Now, my problem is how to represent this in a bindable way, so that a TreeView can handle all the possible data changes? Renaming is easy, all I need is to make the label an updatble field. But what if a user moves flowers above food? I can make the relevant data changes, but they cause a complete data change to all other items in the tree. And all the examples I found of bindable hierarchies are good for non static trees.. So my current (and bad) solution is to reload the displayed tree after relocation change. Any direction will be good. Thanks

    Read the article

  • Dependency injection and factory

    - by legenden
    Trying to figure out how to best handle the following scenario: Assume a RequestContext class which has a dependency to an external service, such as: public class RequestContext : IRequestContext { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContext(ServiceFactory<IWeatherService> weatherService, UserLocation location, string query) { _weatherService = weatherService; ... What sort of dependency should I require in the class that will ultimately instantiate RequestContext? It could be ServiceFactory<IWeatherService>, but that doesn't seem right, or I could create an IRequestContextFactory for it along the lines of: public class RequestContextFactory : IRequestContextFactory { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContextFactory(ServiceFactory<IWeatherService> weatherService) { _weatherService = weatherService; } public RequestContext Create(UserLocation location, string query) { return new RequestContext(_weatherService, location, query); } } And then pass the IRequestContextFactory through constructor injection. This seems like a good way to do it, but the problem with this approach is that I think it hinders discoverability (devs must know about the factory and implement it, which is not really apparent). Is there a better/more discoverable way that I'm missing?

    Read the article

  • Can anyone explain UriMatcher (Android SDK)?

    - by mobibob
    I have been tasked with designing my web services client code to use the utility class UriMatcher in the Android SDK. Unfortunately, the example in the Dev Guide does not relate to anything in my mind. I know I am missing some fundamental points to the functionality and possibly about Uri itself. If you can tie it to some web APIs that are accessible with HTTP POST request, that would be ideal.

    Read the article

  • XSLT fails to load huge XML doc after matching certain elements

    - by krisvandenbergh
    I'm trying to match certain elements using XSLT. My input document is very large and the source XML fails to load after processing the following code (consider especially the first line). <xsl:template match="XMI/XMI.content/Model_Management.Model/Foundation.Core.Namespace.ownedElement/Model_Management.Package/Foundation.Core.Namespace.ownedElement"> <rdf:RDF> <rdf:Description rdf:about=""> <xsl:for-each select="Foundation.Core.Class"> <xsl:for-each select="Foundation.Core.ModelElement.name"> <owl:Class rdf:ID="@Foundation.Core.ModelElement.name" /> </xsl:for-each> </xsl:for-each> </rdf:Description> </rdf:RDF> </xsl:template> Apparently the XSLT fails to load after "Model_Management.Model". The PHP code is as follows: if ($xml->loadXML($source_xml) == false) { die('Failed to load source XML: ' . $http_file); } It then fails to perform loadXML and immediately dies. I think there are two options now. 1) I should set a maximum executing time. Frankly, I don't know how that I do this for the built-in PHP 5 XSLT processor. 2) Think about another way to match. What would be the best way to deal with this? The input document can be found at http://krisvandenbergh.be/uml_pricing.xml Any help would be appreciated! Thanks.

    Read the article

  • Regular expression to match one of two video ID's in a Google Video URL

    - by Baldur
    I need to grab the video ID from a Google Video URL. There are two different types of URLs that I need to be able to match: http://video.google.com/videoplay?docid=-3498228245415745977# where I need to be able to match -3498228245415745977 (note the dash; -), and video.google.com/videoplay?docid=-3498228245415745977#docid=2728972720932273543 where I need to match 2728972720932273543. Is there any good regular expression that can match this? This is what I've got so far: @"docid=(-?\d{19}+)" since the video ID seems to be 19 characters except when it's prefixed with the dash. I'm using C# (of which I have very little experience) if that changes anything. P.s. I would also appreciate you review my regular expressions for YouTube (@"[\?&]v=([^&#])";), RedTube (@"/(\d{1,6})") and Vimeo (@"/(\d*)"). I do not expect users to enter the full URL and thus do not match the ^http://\\.?sitename+\\.\\w{2,3}.

    Read the article

  • get particular string using regex java

    - by hussain
    i want to know how to get the string from group of string String j = "<a href=\"/watch?v=4Qx-lBqOqiQ&feature=popular\" onclick=\"\" onmousedown=\"yt.analytics.urchinTracker(\'/Events/Home/PersonalizedHome/POP/Logged_Out');\" ><span class=\"video-thumb video-thumb-220 \" id=\"video-thumb-4Qx-lBqOqiQ-8821469\"><img src=\"http://i1.ytimg.com/vi/4Qx-lBqOqiQ/hqdefault.jpg\" class=\"vimg220\" alt=\"Dog Squirrel Chasing A Squirrel\" title=\"Dog Squirrel Chasing A Squirrel\" onclick=\";yt.www.watch.watch5.IEshenanigans(event, this)\"><span class=\"video-time\"><span>1:08</span></span><span class=\"video-actions\"><button class=\"yt-uix-button-short yt-uix-button yt-uix-button-arrowbutton\" onclick=\"; return false;\" type=\"button\"> <img class=\"yt-uix-button-arrow\" src=\"http://s.ytimg.com/yt/img/pixel-vfl73.gif\" alt=\"\"> hai</a>"; i want to get the string href=\"/watch?v=4Qx-lBqOqiQ&feature=popular\" and src=\"http://i1.ytimg.com/vi/4Qx-lBqOqiQ/hqdefault.jpg\" thanks and advance

    Read the article

  • Architecting ASP.net MVC App to use repositories and services

    - by zaladane
    Hello, I recently started reading about ASP.net MVC and after getting excited about the concept, i started to migrate all my webform project to MVC but i am having a hard time keeping my controller skinny even after following all the good advices out there (or maybe i just don't get it ... ). The website i deal with has Articles, Videos, Quotes ... and each of these entities have categories, comments, images that can be associated with it. I am using Linq to sql for database operations and for each of these Entities, i have a Repository, and for each repository, i create a service to be used in the controller. so i have - ArticleRepository ArticleCategoryRepository ArticleCommentRepository and the corresponding service ArticleService ArticleCategoryService ... you see the picture. The problem i have is that i have one controller for article,category and comment because i thought that having ArticleController handle all of that might make sense, but now i have to pass all of the services needed to the Controller constructor. So i would like to know what it is that i am doing wrong. Are my services not designed properly? should i create Bigger service to encapsulate smaller services and use them in my controller? or should i have an articleCategory Controller and an articleComment Controller? A page viewed by the user is made of all of that, thee article to be viewed,the comments associated with it, a listing of the categories to witch it applies ... how can i efficiently break down the controller to keep it "skinny" and solve my headache? Thank you! I hope my question is not too long to be read ...

    Read the article

  • Factory Method and Cyclic Dependancy

    - by metdos
    If I'm not wrong, because of its nature in factory method there is cyclic dependency: Base class needs to know subclasses because it creates them, and subclasses need to know base class. Having cyclic dependency is bad programming practice, is not it? Practically I implemented a factory, I have problem above, even I added #ifndef MYCLASS_H #define MYCLASS_H #endif I'm still getting Compiler Error C2504 'class' : base class undefined And this error disappers when I remove subclass include from base class header.

    Read the article

< Previous Page | 176 177 178 179 180 181 182 183 184 185 186 187  | Next Page >