Search Results

Search found 12745 results on 510 pages for 'import from excel'.

Page 262/510 | < Previous Page | 258 259 260 261 262 263 264 265 266 267 268 269  | Next Page >

  • Python Ctypes Read/WriteProcessMemory() - Error 5/998 Help!

    - by user299805
    Please don't get scared but the following code, if you are familiar with ctypes or C it should be easy to read. I have been trying to get my ReadProcessMemory() and WriteProcessMemory() functions to be working for so long and have tried almost every possibility but the right one. It launches the target program, returns its PID and handle just fine. But I always get a error code of 5 - ERROR_ACCESS_DENIED. When I run the read function(forget the write for now). I am launching this program as what I believe to be a CHILD process with PROCESS_ALL_ACCESS or CREATE_PRESERVE_CODE_AUTHZ_LEVEL. I have also tried PROCESS_ALL_ACCESS and PROCESS_VM_READ when I open the handle. I can also say that it is a valid memory location because I can find it on the running program with CheatEngine. As for VirtualQuery() I get an error code of 998 - ERROR_NOACCESS which further confirms my suspicion of it being some security/privilege problem. Any help or ideas would be very appreciated, again, it's my whole program so far, don't let it scare you =P. from ctypes import * from ctypes.wintypes import BOOL import binascii BYTE = c_ubyte WORD = c_ushort DWORD = c_ulong LPBYTE = POINTER(c_ubyte) LPTSTR = POINTER(c_char) HANDLE = c_void_p PVOID = c_void_p LPVOID = c_void_p UNIT_PTR = c_ulong SIZE_T = c_ulong class STARTUPINFO(Structure): _fields_ = [("cb", DWORD), ("lpReserved", LPTSTR), ("lpDesktop", LPTSTR), ("lpTitle", LPTSTR), ("dwX", DWORD), ("dwY", DWORD), ("dwXSize", DWORD), ("dwYSize", DWORD), ("dwXCountChars", DWORD), ("dwYCountChars", DWORD), ("dwFillAttribute",DWORD), ("dwFlags", DWORD), ("wShowWindow", WORD), ("cbReserved2", WORD), ("lpReserved2", LPBYTE), ("hStdInput", HANDLE), ("hStdOutput", HANDLE), ("hStdError", HANDLE),] class PROCESS_INFORMATION(Structure): _fields_ = [("hProcess", HANDLE), ("hThread", HANDLE), ("dwProcessId", DWORD), ("dwThreadId", DWORD),] class MEMORY_BASIC_INFORMATION(Structure): _fields_ = [("BaseAddress", PVOID), ("AllocationBase", PVOID), ("AllocationProtect", DWORD), ("RegionSize", SIZE_T), ("State", DWORD), ("Protect", DWORD), ("Type", DWORD),] class SECURITY_ATTRIBUTES(Structure): _fields_ = [("Length", DWORD), ("SecDescriptor", LPVOID), ("InheritHandle", BOOL)] class Main(): def __init__(self): self.h_process = None self.pid = None def launch(self, path_to_exe): CREATE_NEW_CONSOLE = 0x00000010 CREATE_PRESERVE_CODE_AUTHZ_LEVEL = 0x02000000 startupinfo = STARTUPINFO() process_information = PROCESS_INFORMATION() security_attributes = SECURITY_ATTRIBUTES() startupinfo.dwFlags = 0x1 startupinfo.wShowWindow = 0x0 startupinfo.cb = sizeof(startupinfo) security_attributes.Length = sizeof(security_attributes) security_attributes.SecDescriptior = None security_attributes.InheritHandle = True if windll.kernel32.CreateProcessA(path_to_exe, None, byref(security_attributes), byref(security_attributes), True, CREATE_PRESERVE_CODE_AUTHZ_LEVEL, None, None, byref(startupinfo), byref(process_information)): self.pid = process_information.dwProcessId print "Success: CreateProcess - ", path_to_exe else: print "Failed: Create Process - Error code: ", windll.kernel32.GetLastError() def get_handle(self, pid): PROCESS_ALL_ACCESS = 0x001F0FFF PROCESS_VM_READ = 0x0010 self.h_process = windll.kernel32.OpenProcess(PROCESS_VM_READ, False, pid) if self.h_process: print "Success: Got Handle - PID:", self.pid else: print "Failed: Get Handle - Error code: ", windll.kernel32.GetLastError() windll.kernel32.SetLastError(10000) def read_memory(self, address): buffer = c_char_p("The data goes here") bufferSize = len(buffer.value) bytesRead = c_ulong(0) if windll.kernel32.ReadProcessMemory(self.h_process, address, buffer, bufferSize, byref(bytesRead)): print "Success: Read Memory - ", buffer.value else: print "Failed: Read Memory - Error Code: ", windll.kernel32.GetLastError() windll.kernel32.CloseHandle(self.h_process) windll.kernel32.SetLastError(10000) def write_memory(self, address, data): count = c_ulong(0) length = len(data) c_data = c_char_p(data[count.value:]) null = c_int(0) if not windll.kernel32.WriteProcessMemory(self.h_process, address, c_data, length, byref(count)): print "Failed: Write Memory - Error Code: ", windll.kernel32.GetLastError() windll.kernel32.SetLastError(10000) else: return False def virtual_query(self, address): basic_memory_info = MEMORY_BASIC_INFORMATION() windll.kernel32.SetLastError(10000) result = windll.kernel32.VirtualQuery(address, byref(basic_memory_info), byref(basic_memory_info)) if result: return True else: print "Failed: Virtual Query - Error Code: ", windll.kernel32.GetLastError() main = Main() address = None main.launch("C:\Program Files\ProgramFolder\Program.exe") main.get_handle(main.pid) #main.write_memory(address, "\x61") while 1: print '1 to enter an address' print '2 to virtual query address' print '3 to read address' choice = raw_input('Choice: ') if choice == '1': address = raw_input('Enter and address: ') if choice == '2': main.virtual_query(address) if choice == '3': main.read_memory(address) Thanks!

    Read the article

  • Powershell script to create scheduled tasks from csv file

    - by Rihan Meij
    I would like to use Powershell to create a couple of scheduled tasks, on a server. I have created the file from existing schedule's I have loaded up the csv file, piped it to a select, and retreived all the info that I require from the csv file. However I am not sure on how to pass these results on to a external non powershell command. Import-Csv .\listoftasks.csv | Select 'Run As User','RP','Scheduled Type','TaskName','Task To Run','Repeat: Every','Repeat: Until: Duration' What I would like to do is something like: Import-Csv .\listoftasks.csv | Select 'Run As User','RP','Scheduled Type','TaskName','Task To Run','Repeat: Every','Repeat: Until: Duration' | schtasks /create /RU ....

    Read the article

  • ** EDITED ** 'NoneType' object has no attribute 'day'

    - by Asinox
    Hi guy, i dont know where is my error, but Django 1.2.1 is give this error: 'NoneType' object has no attribute 'day' when i try to save form from the Administrator Area models.py from django.db import models from django.contrib.auth.models import User class Editorial(models.Model): titulo = models.CharField(max_length=250,help_text='Titulo del editorial') editorial = models.TextField(help_text='Editorial') slug = models.SlugField(unique_for_date='pub_date') autor = models.ForeignKey(User) pub_date = models.DateTimeField(auto_now_add=True) activa = models.BooleanField(verbose_name="Activa") enable_comments = models.BooleanField(verbose_name="Aceptar Comentarios",default=False) editorial_html = models.TextField(editable=False,blank=True) def __unicode__(self): return unicode(self.titulo) def get_absolute_url(self): return "/editorial/%s/%s/" % (self.pub_date.strftime("%Y/%b/%d").lower(), self.slug) class Meta: ordering=['-pub_date'] verbose_name_plural ='Editoriales' def save(self,force_insert=False, force_update=False): from markdown import markdown if self.editorial: self.editorial_html = markdown(self.editorial) super(Editorial,self).save(force_insert,force_update) i dont know why this error, COMPLETED ERROR: Traceback: File "C:\wamp\bin\Python26\lib\site-packages\django\core\handlers\base.py" in get_response 100. response = callback(request, *callback_args, **callback_kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\contrib\admin\options.py" in wrapper 239. return self.admin_site.admin_view(view)(*args, **kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\utils\decorators.py" in _wrapped_view 76. response = view_func(request, *args, **kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\views\decorators\cache.py" in _wrapped_view_func 69. response = view_func(request, *args, **kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\contrib\admin\sites.py" in inner 190. return view(request, *args, **kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\utils\decorators.py" in _wrapper 21. return decorator(bound_func)(*args, **kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\utils\decorators.py" in _wrapped_view 76. response = view_func(request, *args, **kwargs) File "C:\wamp\bin\Python26\lib\site-packages\django\utils\decorators.py" in bound_func 17. return func(self, *args2, **kwargs2) File "C:\wamp\bin\Python26\lib\site-packages\django\db\transaction.py" in _commit_on_success 299. res = func(*args, **kw) File "C:\wamp\bin\Python26\lib\site-packages\django\contrib\admin\options.py" in add_view 777. if form.is_valid(): File "C:\wamp\bin\Python26\lib\site-packages\django\forms\forms.py" in is_valid 121. return self.is_bound and not bool(self.errors) File "C:\wamp\bin\Python26\lib\site-packages\django\forms\forms.py" in _get_errors 112. self.full_clean() File "C:\wamp\bin\Python26\lib\site-packages\django\forms\forms.py" in full_clean 269. self._post_clean() File "C:\wamp\bin\Python26\lib\site-packages\django\forms\models.py" in _post_clean 345. self.validate_unique() File "C:\wamp\bin\Python26\lib\site-packages\django\forms\models.py" in validate_unique 354. self.instance.validate_unique(exclude=exclude) File "C:\wamp\bin\Python26\lib\site-packages\django\db\models\base.py" in validate_unique 695. date_errors = self._perform_date_checks(date_checks) File "C:\wamp\bin\Python26\lib\site-packages\django\db\models\base.py" in _perform_date_checks 802. lookup_kwargs['%s__day' % unique_for] = date.day Exception Type: AttributeError at /admin/editoriales/editorial/add/ Exception Value: 'NoneType' object has no attribute 'day' thanks guys sorry with my English

    Read the article

  • "TypeError: draw() takes exactly 1 non-keyword argument (3 given)"

    - by Amorack
    I wrote this code to open a window with Pyglet in Python... import pyglet from pyglet import window class Window(pyglet.window.Window): def __init__(self): super(Window, self).__init__() myLabel = pyglet.text.Label("Prototype") windowText = myLabel.draw(Window, "Hello World", font_name = "Times New Roman", font_size = 36, color = (193, 205, 193, 255)) def on_draw(self): self.clear() self.label.draw() if __name__ == '__main__': window = Window() pyglet.app.run() however every time I run it I get this error: TypeError: draw() takes exactly 1 non-keyword argument (3 given) AFAIK the "(3 given)" means the problem is with the font_size or color arguments but I'm not sure. Could someone explain what's wrong and help me make this work?

    Read the article

  • NSObjectController confusion binding to a class property. Help!

    - by scottw
    Hi, I'm teaching myself cocoa and enjoying the experience most of the time. I have been struggling all day with a simple problem that google has let me down on. I have read the Cocoa Bindings Program Topics and think I grok it but still can't solve my issue. I have a very simple class called MTSong that has various properties. I have used @synthesize to create getter/setters and can use KVC to change properties. i.e in my app controller the following works: mySong = [[MTSong alloc]init]; [mySong setValue:@"2" forKey:@"version"]; In case I am doing something noddy in my class code MTSong.h is: #import <Foundation/Foundation.h> @interface MTSong : NSObject { NSNumber *version; NSString *name; } @property(readwrite, assign) NSNumber *version; @property(readwrite, assign) NSString *name; @end and MTSong.m is: #import "MTSong.h" @implementation MTSong - (id)init { [super init]; return self; } - (void)dealloc { [super dealloc]; } @synthesize version; @synthesize name; @end In Interface Builder I have a label (NSTextField) that I want to update whenever I use KVC to change the version of the song. I do the following: Drag NSObjectController object into the doc window and in the Inspector-Attributes I set: Mode: Class Class Name: MTSong Add a key called version and another called name Go to Inspector-Bindings-Controller Content Bind To: File's Owner (Not sure this is right...) Model Key Path: version Select the cell of the label and go to Inspector Bind to: Object Controller Controller Key: mySong Model Key Path: version I have attempted changing the Model Key Path in step 2 to "mySong" which makes more sense but the compiler complains. Any suggestions would be greatly appreciated. Scott Update Post Comments I wasn't exposing mySong property so have changed my AppController.h to be: #import <Cocoa/Cocoa.h> @class MTSong; @interface AppController : NSObject { IBOutlet NSButton *start; IBOutlet NSTextField *tf; MTSong *mySong; } -(IBAction)convertFile:(id)sender; @end I suspect File's owner was wrong as I am not using a document based application and I need to bind to the AppController, so step 2 is now: Go to Inspector-Bindings-Controller Content Bind To: App Controller Model Key Path: mySong I needed to change 3. to Select the cell of the label and go to Inspector Bind to: Object Controller Controller Key: selection Model Key Path: version All compiles and is playing nice!

    Read the article

  • run .net consolapp out of a cgi script

    - by Nico
    Hello there, i have written a simple cgi python script which looks like this #!c:/Python25/python.exe -u import cgi import os def main(): print "Content-type: text/html\n" form = cgi.FieldStorage() print form["firstname"].value os.execvp("D:\\path\\to\\my\\consolapp.exe", [""]) main() As you can se i'd like to start a consoleapp which i have written in .net. But my consoleapp crashs when i call the cgi script. So i did a little debuging and write a text file after some actions i do in my .net program. The result was that my programm crash everytime i'd like to open a access mdb file. It told me that i need the Microsoft Data Access Components (MDAC). But i cant belive this message because my .net consoleapp runs without errors if i start it from my own. So can anybody give me some advise how i can call my .net consol ab through a webscript. I'm happy for every advise So it don't have to be a solution using a cgi script. Regards, Nico

    Read the article

  • AttributeError while adding colorbar in matplotlib

    - by bgbg
    The following code fails to run on Python 2.5.4: from matplotlib import pylab as pl import numpy as np data = np.random.rand(6,6) fig = pl.figure(1) fig.clf() ax = fig.add_subplot(1,1,1) ax.imshow(data, interpolation='nearest', vmin=0.5, vmax=0.99) pl.colorbar() pl.show() The error message is C:\temp>python z.py Traceback (most recent call last): File "z.py", line 10, in <module> pl.colorbar() File "C:\Python25\lib\site-packages\matplotlib\pyplot.py", line 1369, in colorbar ret = gcf().colorbar(mappable, cax = cax, ax=ax, **kw) File "C:\Python25\lib\site-packages\matplotlib\figure.py", line 1046, in colorbar cb = cbar.Colorbar(cax, mappable, **kw) File "C:\Python25\lib\site-packages\matplotlib\colorbar.py", line 622, in __init__ mappable.autoscale_None() # Ensure mappable.norm.vmin, vmax AttributeError: 'NoneType' object has no attribute 'autoscale_None' How can I add colorbar to this code? Following is the interpreter information: Python 2.5.4 (r254:67916, Dec 23 2008, 15:10:54) [MSC v.1310 32 bit (Intel)] on win32 Type "help", "copyright", "credits" or "license" for more information. >>>

    Read the article

  • BAD_UID error while exporting key in CryptoAPI

    - by mindthief
    Hi all, I am writing a test application for Microsoft CryptoAPI. I want to export the secret key of one party using the public key of the second party, and then import that secret key as the second party's secret key (this sets up a shared secret key for communication). Here is my code: if(!CryptExportKey(encryptT->hSymKey, decryptT->hPubKey, SIMPLEBLOB, 0, keyExBuf, &bufLen)) { FormattedDebugPrint(NULL, GetLastError(), "could not export secret key", TRUE); return -1; } if(!CryptImportKey(decryptT->hCryptProv, keyExBuf, bufLen, decryptT->hPubKey, 0, &(decryptT->hSymKey))) { FormattedDebugPrint(NULL, GetLastError(), "could not import secret key", TRUE); return -1; } And this gives the error: 80090001: Bad UID. The public keypair is being generated for both encryptT and decryptT (sender, receiver) by calling: CryptGenKey(encryptT->hCryptProv, CALG_RSA_KEYX, CRYPT_EXPORTABLE, &(encryptT->hPubKey)) Any idea what could be causing the error? Thanks,

    Read the article

  • Ho to stop scrolling in a Gallery Widget?

    - by Alexi
    I loaded some images into a gallery. Now I'm able to scroll but once started scrolling the scrolling won't stop. I would like the gallery to just scroll to the next image and then stop until the user does the scroll gesture again. this is my code import android.widget.ImageView; import android.widget.Toast; import android.widget.AdapterView.OnItemClickListener; public class GalleryExample extends Activity { private Gallery gallery; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); gallery = (Gallery) findViewById(R.id.examplegallery); gallery.setAdapter(new AddImgAdp(this)); gallery.setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView parent, View v, int position, long id) { Toast.makeText(GalleryExample.this, "Position=" + position, Toast.LENGTH_SHORT).show(); } }); } public class AddImgAdp extends BaseAdapter { int GalItemBg; private Context cont; private Integer[] Imgid = { R.drawable.a_1, R.drawable.a_2, R.drawable.a_3, R.drawable.a_4, R.drawable.a_5, R.drawable.a_6, R.drawable.a_7 }; public AddImgAdp(Context c) { cont = c; TypedArray typArray = obtainStyledAttributes(R.styleable.GalleryTheme); GalItemBg = typArray.getResourceId(R.styleable.GalleryTheme_android_galleryItemBackground, 0); typArray.recycle(); } public int getCount() { return Imgid.length; } public Object getItem(int position) { return position; } public long getItemId(int position) { return position; } public View getView(int position, View convertView, ViewGroup parent) { ImageView imgView = new ImageView(cont); imgView.setImageResource(Imgid[position]); i.setScaleType(ImageView.ScaleType.FIT_CENTER); imgView.setBackgroundResource(GalItemBg); return imgView; } } } and the xmlLayout file <?xml version="1.0" encoding="utf-8"?> <LinearLayout android:id="@+id/LinearLayout01" android:layout_width="fill_parent" android:layout_height="fill_parent" xmlns:android="http://schemas.android.com/apk/res/android" > <Gallery xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/examplegallery" android:layout_width="fill_parent" android:layout_height="fill_parent" /> </LinearLayout>

    Read the article

  • Why is django giving me an attribute error when I call _set.all() for its children models?

    - by user1876508
    I have two models defined from django.db import models class Blog(models.Model): title = models.CharField(max_length=144) @property def posts(self): self.Post_set.all() class Post(models.Model): title = models.CharField(max_length=144) text = models.TextField() blog = models.ForeignKey('Blog') but the problem is, when I run shell, and enter >>> blog = Blog(title="My blog") >>> post = Post(title="My first post", text="Here is the main text for my blog post", blog=blog) >>> blog.posts I get the error Traceback (most recent call last): File "<console>", line 1, in <module> File "/home/lucas/Programming/Python/Django/djangorestfun/blog/models.py", line 9, in posts self.Post_set.all() AttributeError: 'Blog' object has no attribute 'Post_set' >>> Now I am having the following problem >>> from blog.models import * >>> blog = Blog(title="gewrhter") >>> blog.save() >>> blog.__dict__ {'_state': <django.db.models.base.ModelState object at 0x259be10>, 'id': 1, 'title': 'gewrhter'} >>> blog._state.__dict__ {'adding': False, 'db': 'default'} >>> post = Post(title="sdhxcvb", text="hdbfdgb", blog=blog) >>> post.save() >>> post.__dict__ {'blog_id': 1, 'title': 'sdhxcvb', 'text': 'hdbfdgb', '_blog_cache': <Blog: Blog object>, '_state': <django.db.models.base.ModelState object at 0x259bed0>, 'id': 1} >>> blog.posts >>> print blog.posts None Second update So I followed your guide, but I am still getting nothing. In addition, blog.posts gives me an error. >>> from blog.models import * >>> blog = Blog(title="asdf") >>> blog.save() >>> post = Post(title="asdf", text="sdxcvb", blog=blog) >>> post.save() >>> blog.posts Traceback (most recent call last): File "<console>", line 1, in <module> AttributeError: 'Blog' object has no attribute 'posts' >>> print blog.all_posts None

    Read the article

  • Java: exception-throwing class?

    - by HH
    I have classes DirReader and Search. The search uses DirReader. I want the search to know when DirReader throws exception. So how can I have class throwing exception? Currently, I use initCorrect -dummy var. Exception-style method may be more appropriate. Simplified Example Error $ javac ExceptionStatic.java ExceptionStatic.java:4: '{' expected public class ExceptionStatic throws Exception{ ^ 1 error Code import java.util.*; import java.io.*; // THIS PART NEEDS TO BE FIXED: public class ExceptionStatic throws Exception{ private static boolean initCorrect = false; public static String hello; static{ try{ hello = "hallo"; //some other conditionals in real code if( true) throw new Exception(); initCorrect=true; }catch(Exception e){ e.printStackTrace(); } } public static void main(String[] args){ if(initCorrect) System.out.println(hello); } }

    Read the article

  • Python class design - Splitting up big classes into multiple ones to group functionality

    - by Ivo Wetzel
    OK I've got 2 really big classes 1k lines each that I currently have split up into multiple ones. They then get recombined using multiple inheritance. Now I'm wondering, if there is any cleaner/better more pythonic way of doing this. Completely factoring them out would result in endless amounts of self.otherself.do_something calls, which I don't think is the way it should be done. To make things clear here's what it currently looks like: from gui_events import GUIEvents # event handlers from gui_helpers import GUIHelpers # helper methods that don't directly modify the GUI # GUI.py class GUI(gtk.Window, GUIEvents, GUIHelpers): # general stuff here stuff here One problem that is result of this is Pylint complaining giving me trillions of "init not called" / "undefined attribute" / "attribute accessed before definition" warnings.

    Read the article

  • Is this a good way to do a game loop for an iPhone game?

    - by Danny Tuppeny
    Hi all, I'm new to iPhone dev, but trying to build a 2D game. I was following a book, but the game loop it created basically said: function gameLoop update() render() sleep(1/30th second) gameLoop The reasoning was that this would run at 30fps. However, this seemed a little mental, because if my frame took 1/30th second, then it would run at 15fps (since it'll spend as much time sleeping as updating). So, I did some digging and found the CADisplayLink class which would sync calls to my gameLoop function to the refresh rate (or a fraction of it). I can't find many samples of it, so I'm posting here for a code review :-) It seems to work as expected, and it includes passing the elapsed (frame) time into the Update method so my logic can be framerate-independant (however I can't actually find in the docs what CADisplayLink would do if my frame took more than its allowed time to run - I'm hoping it just does its best to catch up, and doesn't crash!). // // GameAppDelegate.m // // Created by Danny Tuppeny on 10/03/2010. // Copyright Danny Tuppeny 2010. All rights reserved. // #import "GameAppDelegate.h" #import "GameViewController.h" #import "GameStates/gsSplash.h" @implementation GameAppDelegate @synthesize window; @synthesize viewController; - (void) applicationDidFinishLaunching:(UIApplication *)application { // Create an instance of the first GameState (Splash Screen) [self doStateChange:[gsSplash class]]; // Set up the game loop displayLink = [CADisplayLink displayLinkWithTarget:self selector:@selector(gameLoop)]; [displayLink setFrameInterval:2]; [displayLink addToRunLoop:[NSRunLoop currentRunLoop] forMode:NSDefaultRunLoopMode]; } - (void) gameLoop { // Calculate how long has passed since the previous frame CFTimeInterval currentFrameTime = [displayLink timestamp]; CFTimeInterval elapsed = 0; // For the first frame, we want to pass 0 (since we haven't elapsed any time), so only // calculate this in the case where we're not the first frame if (lastFrameTime != 0) { elapsed = currentFrameTime - lastFrameTime; } // Keep track of this frames time (so we can calculate this next time) lastFrameTime = currentFrameTime; NSLog([NSString stringWithFormat:@"%f", elapsed]); // Call update, passing the elapsed time in [((GameState*)viewController.view) Update:elapsed]; } - (void) doStateChange:(Class)state { // Remove the previous GameState if (viewController.view != nil) { [viewController.view removeFromSuperview]; [viewController.view release]; } // Create the new GameState viewController.view = [[state alloc] initWithFrame:CGRectMake(0, 0, IPHONE_WIDTH, IPHONE_HEIGHT) andManager:self]; // Now set as visible [window addSubview:viewController.view]; [window makeKeyAndVisible]; } - (void) dealloc { [viewController release]; [window release]; [super dealloc]; } @end Any feedback would be appreciated :-) PS. Bonus points if you can tell me why all the books use "viewController.view" but for everything else seem to use "[object name]" format. Why not [viewController view]?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Parsing Json Feeds with google Gson

    - by mnml
    I would like to know how to parse a json feed by items, eg. url / title / description for each item. I have had a look to the doc / api but, it didn't help me. This is what I got so far import com.google.gson.Gson; import com.google.gson.JsonObject; public class ImportSources extends Job { public void doJob() throws IOException { String json = stringOfUrl("http://feed.test/all.json"); JsonObject jobj = new Gson().fromJson(json, JsonObject.class); Logger.info(jobj.get("responseData").toString()); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } }

    Read the article

  • Django Managers

    - by owca
    I have the following models code : from django.db import models from categories.models import Category class MusicManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Music') def count_music(self): return self.all().count() class SportManager(models.Manager): def get_query_set(self): return super(MusicManager, self).get_query_set().filter(category='Sport') class Event(models.Model): title = models.CharField(max_length=120) category = models.ForeignKey(Category) objects = models.Manager() music = MusicManager() sport = SportManager() Now by registering MusicManager() and SportManager() I am able to call Event.music.all() and Event.sport.all() queries. But how can I create Event.music.count() ? Should I call self.all() in count_music() function of MusicManager to query only on elements with 'Music' category or do I still need to filter through them in search for category first ?

    Read the article

  • How to stop a QDialog from executing while still in the __init__ statement(or immediatly after)?

    - by Jonathan
    I am wondering how I can go about stopping a dialog from opening if certain conditions are met in its __init__ statement. The following code tries to call the 'self.close()' function and it does, but (I'm assuming) since the dialog has not yet started its event loop, that it doesn't trigger the close event? So is there another way to close and/or stop the dialog from opening without triggering an event? Example code: from PyQt4 import QtCore, QtGui class dlg_closeInit(QtGui.QDialog): ''' Close the dialog if a certain condition is met in the __init__ statement ''' def __init__(self): QtGui.QDialog.__init__(self) self.txt_mytext = QtGui.QLineEdit('some text') self.btn_accept = QtGui.QPushButton('Accept') self.myLayout = QtGui.QVBoxLayout(self) self.myLayout.addWidget(self.txt_mytext) self.myLayout.addWidget(self.btn_accept) self.setLayout(self.myLayout) # Connect the button self.connect(self.btn_accept,QtCore.SIGNAL('clicked()'), self.on_accept) self.close() def on_accept(self): # Get the data... self.mydata = self.txt_mytext.text() self.accept() def get_data(self): return self.mydata def closeEvent(self, event): print 'Closing...' if __name__ == '__main__': import sys app = QtGui.QApplication(sys.argv) dialog = dlg_closeInit() if dialog.exec_(): print dialog.get_data() else: print "Failed"

    Read the article

  • JavaScript/Dojo Module Pattern - how to debug?

    - by djna
    I'm working with Dojo and using the "Module Pattern" as described in Mastering Dojo. So far as I can see this pattern is a general, and widely used, JavaScript pattern. My question is: How do we debug our modules? So far I've not been able to persuade Firebug to show me the source of my module. Firebug seems to show only the dojo eval statement used to execute the factory method. Hence I'm not able to step through my module source. I've tried putting "debugger" statements in my module code, and Firebug seems to halt correctly, but does not show the source. Contrived example code below. This is just an example of sufficient complexity to make the need for debugging plausible, it's not intended to be useful code. The page <!-- Experiments with Debugging --> <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> <html> <head> <title>console me</title> <style type="text/css"> @import "../dojoroot/dojo/resources/dojo.css"; @import "../dojoroot/dijit/themes/tundra/tundra.css"; @import "edf.css"; </style> <script type="text/javascript" src="../dojoroot/dojo/dojo.js"> </script> <script type="text/javascript" > dojo.registerModulePath("mytest", "../../mytest"); dojo.require("mytest.example"); dojo.addOnLoad(function(){ mytest.example.greet(); }); </script> </head> <body class="tundra"> <div id="bulletin"> <p>Just Testing</p> </div> </body> </html> <!-- END: snip1 --> The java script I'd like to debug dojo.provide("mytest.example"); dojo.require("dijit.layout.ContentPane"); /** * define module */ (function(){ //define the main program functions... var example= mytest.example; example.greet= function(args) { var bulletin = dojo.byId("bulletin"); console.log("bulletin:" + bulletin); if ( bulletin) { var content = new dijit.layout.ContentPane({ id: "dummy", region: "center" }); content.setContent('Greetings!'); dojo._destroyElement(bulletin); dojo.place(content.domNode, dojo.body(), "first"); console.log("greeting done"); } else { console.error("no bulletin board"); } } })();

    Read the article

  • undefined symbol: PyUnicodeUCS2_Decode whilst trying to install psycopg2

    - by Marco Fucci
    I'm getting an error whilst trying to install psycopg2 on ubuntu 9.10 64 bit. The error is: >>> import psycopg2 Traceback (most recent call last): File "<stdin>", line 1, in <module> File "psycopg2/__init__.py", line 69, in <module> from _psycopg import BINARY, NUMBER, STRING, DATETIME, ROWID ImportError: psycopg2/_psycopg.so: undefined symbol: PyUnicodeUCS2_Decode I've tried downloading the package from http://initd.org/pub/software/psycopg/ and installing it. I've tried by using easy_install too. No error during the installation. It's quite weird as my python (2.6.2) has been compiled with UCS4 and so the installation should just work without problems. Any help would be appreciated. Cheers

    Read the article

  • Convert Wordpress.com Hosted Blog to BlogEngine.NET

    - by Chris Marisic
    I'm looking at what is needed to move from wordpress.com to a BlogEngine.NET or similar blog. I've seen a tool for replacing export.php so that it will export your wordpress site in BlogML format so it can easily be imported into BlogEngine.NET, however I'd really not want to have to setup php/wordpress just so I can import a back up from wordpress.com and then use the export from my local wordpress to have a BlogML file. Are there any tools that will convert the wordpress file? Is there a different blog that will natively import the wordpress file? Edit: For the question about other blog providers, I am open to them as long as they are .NET based, preferably C#.

    Read the article

  • python urllib post question

    - by paul
    hello ALL im making some simple python post script but it not working well. there is 2 part to have to login. first login is using 'http://mybuddy.buddybuddy.co.kr/userinfo/UserInfo.asp' this one. and second login is using 'http://user.buddybuddy.co.kr/usercheck/UserCheckPWExec.asp' i can login first login page, but i couldn't login second page website. and return some error 'illegal access' such like . i heard this is related with some cooke but i don't know how to implement to resolve this problem. if anyone can help me much appreciated!! Thanks! import re,sys,os,mechanize,urllib,time import datetime,socket params = urllib.urlencode({'ID':'ph896011', 'PWD':'pk1089' }) rq = mechanize.Request("http://mybuddy.buddybuddy.co.kr/userinfo/UserInfo.asp", params) rs = mechanize.urlopen(rq) data = rs.read() logged_fail = r';history.back();</script>' in data if not logged_fail: print 'login success' try: params = urllib.urlencode({'PASSWORD':'pk1089'}) rq = mechanize.Request("http://user.buddybuddy.co.kr/usercheck/UserCheckPWExec.asp", params ) rs = mechanize.urlopen(rq) data = rs.read() print data except: print 'error'

    Read the article

  • Python Ephem calculation

    - by dassouki
    the output should process the first date as "day" and second as "night". I've been playing with this for a few hours now and can't figure out what I'm doing wrong. Any ideas? Output: $ python time_of_day.py * should be day: event date: 2010/4/6 16:00:59 prev rising: 2010/4/6 09:24:24 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/7 09:22:27 next set: 2010/4/6 23:34:27 day * should be night: event date: 2010/4/6 00:01:00 prev rising: 2010/4/5 09:26:22 prev setting: 2010/4/5 23:33:03 next rise: 2010/4/6 09:24:24 next set: 2010/4/6 23:34:27 day time_of_day.py import datetime import ephem # install from http://pypi.python.org/pypi/pyephem/ #event_time is just a date time corresponding to an sql timestamp def type_of_light(latitude, longitude, event_time, utc_time, horizon): o = ephem.Observer() o.lat, o.long, o.date, o.horizon = latitude, longitude, event_time, horizon print "event date ", o.date print "prev rising: ", o.previous_rising(ephem.Sun()) print "prev setting: ", o.previous_setting(ephem.Sun()) print "next rise: ", o.next_rising(ephem.Sun()) print "next set: ", o.next_setting(ephem.Sun()) if o.previous_rising(ephem.Sun()) <= o.date <= o.next_setting(ephem.Sun()): return "day" elif o.previous_setting(ephem.Sun()) <= o.date <= o.next_rising(ephem.Sun()): return "night" else: return "error" print "should be day: ", type_of_light('45.959','-66.6405','2010/4/6 16:01','-4', '-6') print "should be night: ", type_of_light('45.959','-66.6405','2010/4/6 00:01','-4', '-6')

    Read the article

  • IronPython and Nodebox in C#

    - by proxylittle
    My plan: I'm trying to setup my C# project to communicate with Nodebox to call a certain function which populates a graph and draws it in a new window. Current situation: [fixed... see Update2] I have already included all python-modules needed, but im still getting a Library 'GL' not found it seems that the pyglet module needs a reference to GL/gl.h, but can't find it due to IronPython behaviour. Requirement: The project needs to stay as small as possible without installing new packages. Thats why i have copied all my modules into the project-folder and would like to keep it that or a similar way. My question: Is there a certain workaround for my problem or a fix for the library-folder missmatch. Have read some articles about Tao-Opengl and OpenTK but can't find a good solution. Update1: Updated my sourcecode with a small pyglet window-rendering example. Problem is in pyglet and referenced c-Objects. How do i include them in my c# project to be called? No idea so far... experimenting alittle now. Keeping you updated. SampleCode C#: ScriptRuntimeSetup setup = Python.CreateRuntimeSetup(null); ScriptRuntime runtime = new ScriptRuntime(setup); ScriptEngine engine = Python.GetEngine(runtime); ScriptSource source = engine.CreateScriptSourceFromFile("test.py"); ScriptScope scope = engine.CreateScope(); source.Execute(scope); SampleCode Python (test.py): from nodebox.graphics import * from nodebox.graphics.physics import Vector, Boid, Flock, Obstacle flock = Flock(50, x=-50, y=-50, width=700, height=400) flock.sight(80) def draw(canvas): canvas.clear() flock.update(separation=0.4, cohesion=0.6, alignment=0.1, teleport=True) for boid in flock: push() translate(boid.x, boid.y) scale(0.5 + boid.depth) rotate(boid.heading) arrow(0, 0, 15) pop() canvas.size = 600, 300 def main(canvas): canvas.run(draw) Update2: Line 139 [pyglet/lib.py] sys.platform is not win32... there was the error. Fixed it by just using the line: from pyglet.gl.lib_wgl import link_GL, link_GLU, link_WGL Now the following Error: 'module' object has no attribute '_getframe' Kind of a pain to fix it. Updating with results... Update3: Fixed by adding following line right after first line in C#-Code: setup.Options["Frames"] = true; Current Problem: No module named unicodedata, but in Python26/DLLs is only a *.pyd file`. So.. how do i implement it now?!

    Read the article

  • Apps not showing in Django admin site

    - by jack
    I have a Django project with about 10 apps in it. But the admin interface only shows Auth and Site models which are part of Django distribution. Yes, the admin interface is up and working but none of my self-written apps shows there. INSTALLED_APPS INSTALLED_APPS = ( 'django.contrib.auth', 'django.contrib.sites', 'django.contrib.contenttypes', 'django.contrib.humanize', 'django.contrib.sessions', 'django.contrib.admin', 'django.contrib.admindocs', 'project.app1', ... app1/admin.py from django.contrib import admin from project.app1.models import * admin.site.register(model1) admin.site.register(model2) admin.site.register(model3) What could be wrong in this case? Looks like everything is configured as what document says. Thank you in advance.

    Read the article

< Previous Page | 258 259 260 261 262 263 264 265 266 267 268 269  | Next Page >