Search Results

Search found 22272 results on 891 pages for 'post commit'.

Page 305/891 | < Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• NHibernate transactions randomly not rolled back

  - by cbp

  I have a suite of integration tests that run inside transactions. Sometimes it seems that NHibernate transactions are not being correctly rolled back. I can't work out what causes this. Here is a slightly simplified overview of the base class that these integration test fixtures run with: public class IntegrationTestFixture { private TransactionScope _transactionScope; private ConnectionScope _connectionScope; [TestFixtureSetUp] public virtual void TestFixtureSetUp() { var session = NHibernateSessionManager.SessionFactory.OpenSession(); CallSessionContext.Bind(session); _connectionScope = new ConnectionScope(); _transactionScope = new TransactionScope(); } [TestFixtureTearDown] public virtual void TestFixtureTearDown() { _transactionScope.Dispose(); _connectionScope.Dispose(); var session = CurrentSessionContext.Unbind(SessionFactory); session.Close(); session.Dispose(); } } A call to the TransactionScope's commit method is never made, therefore how is it possible that data still ends up in the database?

  Read the article

• Use localeURL middleware with apache prefix

  - by Olivier R.

  Good morning everyone, I Got a question about localeURL usage. Everything works great for me with url like this : www.mysite.com/ If I type www.mysite.com/ in adress bar, it turns correctly in www.mysite.com/en/ for example. If I use the view change_locale, it's also all right (ie change www.mysite.com/en/ in www.mysite.com/fr/). But my application use apache as server, and use a prefix for the site, that gives url like this : www.mysite.com/prefix/ If I type www.mysite.com/prefix/ in the adress bar, the adress turns into www.mysite.com/en/ without prefix (so 404) I change code of view to manage our settings.SERVER_PREFIX value : def change_locale(request) : """ Redirect to a given url while changing the locale in the path The url and the locale code need to be specified in the request parameters. O. Rochaix; Taken from localeURL view, and tuned to manage : - SERVER_PREFIX from settings.py """ next = request.REQUEST.get('next', None) if not next: next = request.META.get('HTTP_REFERER', None) if not next: next = settings.SERVER_PREFIX + '/' next = urlsplit(next).path prefix = False if settings.SERVER_PREFIX!="" and next.startswith(settings.SERVER_PREFIX) : prefix = True next = "/" + next.lstrip(settings.SERVER_PREFIX) _, path = utils.strip_path (next) if request.method == 'POST': locale = request.POST.get('locale', None) if locale and check_for_language(locale): path = utils.locale_path(path, locale) if prefix : path = settings.SERVER_PREFIX + path response = http.HttpResponseRedirect(path) return response with this customized view, i'm able to correctly change language, but i'm not sure that's the right way of doing stuff. Is there any option on localeURL to manage prefix of apache ?

  Read the article

• ASP.net AppendHeader not working in ASP MVC

  - by Chao

  I'm having problems getting AppendHeader to work properly if I am also using an authorize filter. I'm using an actionfilter for my AJAX actions that applies Expires, Last-Modified, Cache-Control and Pragma (though while testing I have tried including it in the action method itself with no change in results). If I don't have an authorize filter the headers work fine. Once I add the filter the headers I tried to add get stripped. The headers I want to add Response.AppendHeader("Expires", "Sun, 19 Nov 1978 05:00:00 GMT"); Response.AppendHeader("Last-Modified", String.Format("{0:r}", DateTime.Now)); Response.AppendHeader("Cache-Control", "no-store, no-cache, must-revalidate"); Response.AppendHeader("Cache-Control", "post-check=0, pre-check=0"); Response.AppendHeader("Pragma", "no-cache"); An example of the headers from a correct page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:22:24 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache Expires Sun, 19 Nov 1978 05:00:00 GMT Last-Modified Mon, 14 Jun 2010 18:22:24 GMT Cache-Control no-store, no-cache, must-revalidate, post-check=0, pre-check=0 Content-Type text/html; charset=utf-8 Content-Length 352 Connection Close And from an incorrect page: Server ASP.NET Development Server/9.0.0.0 Date Mon, 14 Jun 2010 17:27:34 GMT X-AspNet-Version 2.0.50727 X-AspNetMvc-Version 2.0 Pragma no-cache, no-cache Cache-Control private, s-maxage=0 Content-Type text/html; charset=utf-8 Content-Length 4937 Connection Close

  Read the article

• Fork or copy a users browser session in IE

  - by jmoeller

  Is it possible to fork a users session (or do something similar) in a Internet Explorer plugin? I want to process the page the user is on when they click a button in the toolbar. To avoid interrupting the users browsing, I'd like to "copy" everything so I can parse and process the page in the background. The processing can involve things such as loading the content of the result links on a Google search, if that's where the button was clicked. So - what I basically want is to imitate "Ctrl+N" but hide the window from the user, so they won't be interrupted. As you can see, if you fill out and submit the form on http://www.snee.com/xml/crud/posttest.html and press "Ctrl+N", everything posted will still appear in the new window, but it won't post the data twice. I was thinking of somehow copying the IWebBrowser2, but: I'm not sure if that's possible (I haven't been able to find any information on MSDN) I don't know if it copies the sessions as well. Creating a new instance of the IWebBrowser2 and simply navigating to the current URL isn't a valid solution as POST-variables of course doesn't get carried over.

  Read the article

• How does overlayViewTouched notification work in the MoviePlayer sample code

  - by Jonathan

  Hi, I have a question regarding the MoviePlayer sample code provided by apple. I don't understand how the overlayViewTouch notification works. The NSlog message I added to it does not get sent when I touch the view (not button). // post the "overlayViewTouch" notification and will send // the overlayViewTouches: message - (void)overlayViewTouches:(NSNotification *)notification { NSLog(@"overlay view touched"); // Handle touches to the overlay view (MyOverlayView) here... } I can, however, get the NSlog notification if I place it in -(void)touchesBegan in "MyOverlayView.m". Which makes me think it is recognizing touches but not sending a notification. // Handle any touches to the overlay view - (void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch* touch = [touches anyObject]; if (touch.phase == UITouchPhaseBegan) { NSLog(@"overlay touched(from touchesBegan") // IMPORTANT: // Touches to the overlay view are being handled using // two different techniques as described here: // // 1. Touches to the overlay view (not in the button) // // On touches to the view we will post a notification // "overlayViewTouch". MyMovieViewController is registered // as an observer for this notification, and the // overlayViewTouches: method in MyMovieViewController // will be called. // // 2. Touches to the button // // Touches to the button in this same view will // trigger the MyMovieViewController overlayViewButtonPress: // action method instead. NSNotificationCenter *nc = [NSNotificationCenter defaultCenter]; [nc postNotificationName:OverlayViewTouchNotification object:nil]; } } Can anyone shed light on what I am missing or doing wrong? Thank you.

  Read the article

• Hook Response.Cache to memcache

  - by dvr

  Has anyone done this before? I have a 32 bit win 2003 server running 2.0 and have read the ms engineers' blog about min(60%, 1800mb) for cache limits and our site (asp.net 2.0 / 3.5) is caching alot. It throws system outofmemory exceptions when wp is around 1.3gb (unfortunately it is the 2.0 apps) and I would like to push alot over to memcache but worried that at the moment the site is efficient using response.cache as is (though memory is an issue). I want to move most items over to memcache and have concerns on a – how to do this (implementation of response.cache to read/write from memcache) and b – what will performance be like? Before I commit to doing this and possibly spending a few days running tests I would like to hear from you if this has been done already and get some feedback. (and please don’t tell me to buy a x64 machine – I have already requested this!), by the way I ran a test requesting a single image 1000 times and response.cache was over 50% quicker than using application cache. Does response.cache bypass the page lifecycle?

  Read the article

• NHibernate's automatic (dirty checking) update behaviour - turning it off

  - by Andrew Bullock

  I've just discovered that if I get an object from an NHibernate session and change a property on object, NHibernate will automatically update the object on commit without me calling Session.Update(myObj)! I can see how this could be helpful, but as default behaviour it seems crazy! How can I stop this happening? Is this default NHib behaviour or something coming from Fluent NHibs AutoPersistenceModel? If there's no way to stop this, what do I do? Unless I'm missing the point this behaviour seems to create a right mess, violating my UoW. Im using NHibernate 2.0.1.4 and a Fluent NHib build from 18/3/2009 Edit, is this guy right with his answer? Edit: I've also read that overriding an Event Listener could be a solution to this. However, IDirtyCheckEventListener.OnDirtyCheck isn't called in this situation. Does anyone know which listener I need to override? Thanks Andrew

  Read the article

• Cucumber Error: Socket Error for Test Environment Host in REST API

  - by tmo256

  I posted this to the Cucumber group with no replies, which makes me wonder if this is actually a cucumber issue or not. I'm pretty new to cucumber, and there are a number of things I really don't quite understand about how the cucumber environment is set up and executed within the test environment. I have a REST API rails app I'm testing with cucumber, using the RestClient gem to generate a post to controller create action. When I run the feature with a hard-coded URL pointing to a running localhost server (my local dev server environment; replacing tickets_url with "http:// localhost/tickets" in the snippet below), my cucumber steps execute as expected. However, when the resource URL resolves to the cucumber host I'm declaring, I get a socket error exception. getaddrinfo: nodename nor servname provided, or not known (SocketError) From the steps file: When /^POS Adapter sends JSON data to the Tickets resource$/ do ticket = { :ticket = { ... } } host! "test.host" puts tickets_url RestClient.post tickets_url, ticket.to_json, :content_type = :json, :accepts = :json end (the "puts" statement prints "http://test.host/tickets") Using the following gems: cucumber-0.6.1 webrat-0.6.0 rest-client-1.2.0 I should also say I have a similar set up in another rails app, using test.host as my host, and it seems to work fine. I'd appreciate any insight on what I might be missing in my configuration or what this could be related to.

  Read the article

• Handling android player errors

  - by stack hoss

  I am anew android developer and i made ashoutcast radio player and work good but when i open app it work for afew time but suddenly stop and need to press stop and play again but i need Handling android player errors to automatic restart on errors package com.test.test; import java.io.IOException; import android.app.Notification; import android.app.NotificationManager; import android.app.PendingIntent; import android.app.Service; import android.content.Context; import android.content.Intent; import android.content.SharedPreferences; import android.media.AudioManager; import android.media.AudioManager.OnAudioFocusChangeListener; import android.media.MediaPlayer; import android.os.IBinder; import android.preference.PreferenceManager; import android.util.Log; public class StreamService extends Service { private static final String TAG = "StreamService"; MediaPlayer mp; boolean isPlaying; Intent MainActivity; SharedPreferences prefs; SharedPreferences.Editor editor; Notification n; NotificationManager notificationManager; // Change this int to some number specifically for this app int notifId = 85; private OnAudioFocusChangeListener focusChangeListener = new OnAudioFocusChangeListener() { public void onAudioFocusChange(int focusChange) { switch (focusChange) { case (AudioManager.AUDIOFOCUS_LOSS_TRANSIENT_CAN_DUCK) : // Lower the volume while ducking. mp.setVolume(0.2f, 0.2f); break; case (AudioManager.AUDIOFOCUS_LOSS_TRANSIENT) : mp.pause(); break; case (AudioManager.AUDIOFOCUS_LOSS) : mp.stop(); break; case (AudioManager.AUDIOFOCUS_GAIN) : // Return the volume to normal and resume if paused. mp.setVolume(1f, 1f); mp.start(); break; default: break; } } }; @Override public IBinder onBind(Intent arg0) { // TODO Auto-generated method stub return null; } @SuppressWarnings("deprecation") @Override public void onCreate() { super.onCreate(); Log.d(TAG, "onCreate"); // Init the SharedPreferences and Editor prefs = PreferenceManager.getDefaultSharedPreferences(getApplicationContext()); editor = prefs.edit(); // Set up the buffering notification notificationManager = (NotificationManager) getApplicationContext() .getSystemService(NOTIFICATION_SERVICE); Context context = getApplicationContext(); String notifTitle = context.getResources().getString(R.string.app_name); String notifMessage = context.getResources().getString(R.string.buffering); n = new Notification(); n.icon = R.drawable.ic_launcher; n.tickerText = "Buffering"; n.when = System.currentTimeMillis(); Intent nIntent = new Intent(context, MainActivity.class); nIntent.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK | Intent.FLAG_ACTIVITY_SINGLE_TOP); PendingIntent pIntent = PendingIntent.getActivity(context, 0, nIntent, 0); n.setLatestEventInfo(context, notifTitle, notifMessage, pIntent); notificationManager.notify(notifId, n); // It's very important that you put the IP/URL of your ShoutCast stream here // Otherwise you'll get Webcom Radio String url = "http://47.182.19.93:9888/"; mp = new MediaPlayer(); mp.setAudioStreamType(AudioManager.STREAM_MUSIC); try { mp.reset(); mp.setDataSource(url); mp.prepare(); mp.start(); } catch (IllegalArgumentException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (SecurityException e) { // TODO Auto-generated catch block Log.e(TAG, "SecurityException"); } catch (IllegalStateException e) { // TODO Auto-generated catch block Log.e(TAG, "IllegalStateException"); } catch (IOException e) { // TODO Auto-generated catch block Log.e(TAG, "IOException"); } } @SuppressWarnings("deprecation") @Override public void onStart(Intent intent, int startId) { Log.d(TAG, "onStart"); mp.start(); // Set the isPlaying preference to true editor.putBoolean("isPlaying", true); editor.commit(); Context context = getApplicationContext(); String notifTitle = context.getResources().getString(R.string.app_name); String notifMessage = context.getResources().getString(R.string.now_playing); n.icon = R.drawable.ic_launcher; n.tickerText = notifMessage; n.flags = Notification.FLAG_NO_CLEAR; n.when = System.currentTimeMillis(); Intent nIntent = new Intent(context, MainActivity.class); PendingIntent pIntent = PendingIntent.getActivity(context, 0, nIntent, 0); n.setLatestEventInfo(context, notifTitle, notifMessage, pIntent); // Change 5315 to some nother number notificationManager.notify(notifId, n); AudioManager am = (AudioManager)getSystemService(Context.AUDIO_SERVICE); // Request audio focus for playback int result = am.requestAudioFocus(focusChangeListener, // Use the music stream. AudioManager.STREAM_MUSIC, // Request permanent focus. AudioManager.AUDIOFOCUS_GAIN); if (result == AudioManager.AUDIOFOCUS_REQUEST_GRANTED) { // other app had stopped playing song now , so u can do u stuff now . } } @Override public void onDestroy() { Log.d(TAG, "onDestroy"); mp.stop(); mp.release(); mp = null; editor.putBoolean("isPlaying", false); editor.commit(); notificationManager.cancel(notifId); AudioManager am = (AudioManager)getSystemService(Context.AUDIO_SERVICE); am.abandonAudioFocus(focusChangeListener); } }

  Read the article

• regular expression to remove original message from reply mail using in java ?

  - by ravi ravi

  In my forum, users can reply through email. I am handling mails from their reply. When they are replying the original message getting appended. I want to get only the reply message not the original message. I have to write regular expression for gmail & hotmail. I written regex for gmail as follows : \n.wrote:(?s).--End of Post-- It is removing the original message except date. I want to remove the date also. before removing the original message : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr wrote: The following update has been posted to this discussion: test as user 222 [$MESSAGE_SIGNATURE_HEADER$] --End of Post-- " When I use the above regex it is filtering as follows : " hi 33 On Tue, May 11, 2010 at 4:18 PM, Mmmmm, Rrrrr " Here i want only the actual message 'hi 33' not that date. How can I filter the date using above regex? Also I need regex for Hotmail also. I appreciate for any reply. Thanks in advance.

  Read the article

• error handler isn't called when file is uploaded via ajax using jQuery form plugin

  - by scompt.com

  Here's my test case. If the form is posted, a 500 error response is sent. If not, the form is sent. If the file input tag is commented out, the error handler is called. If the file input tag is present, the error handler isn't called. I think this might have something to do with the fact that jQuery needs to use an iframe to handle the upload and iframes don't seem to respond to the error handler. Edit: If I add iframe: true to the options passed to ajaxSubmit to force the use of an iframe, the non-file-upload case stops working also, so it definitely has to do with the iframe. Edit2: I'm using the jQuery Form Plugin. <?php if($_SERVER['REQUEST_METHOD'] == 'POST') { header('HTTP/1.1 500 Internal Server Error'); die; } else {?> <html><head> <script type='text/javascript' src='http://ajax.googleapis.com/ajax/libs/jquery/1.4.2/jquery.min.js?ver=2.9.2'></script> <script type='text/javascript' src='http://github.com/malsup/form/raw/master/jquery.form.js?v2.43'></script> <script type="text/javascript"> jQuery(document).ready(function() { jQuery('a').click(function() {jQuery('form').ajaxSubmit({error: function(){alert('error handler called');}})}); }); </script> </head><body> <form method="POST"> <input type="text" name="mytext" /> <input type="file" name="myfile" /><!-- comment this element out --> <input type="hidden" name="blah" value="blah" /> <a>submit</a> </form> </body></html> <?php } Is there any way to get the error handler to be called in both situations?

  Read the article

• DROP TABLE fails for temp table

  - by StarBright

  I have a client application that creates a temp table, the performs a bulk insert into the temp table, then executes some SQL using the table before deleting it. Pseudo-code: open connection begin transaction CREATE TABLE #Temp ([Id] AS int) bulk insert 500 rows into #Temp UPDATE [OtherTable] SET [Status]=0 WHERE [Id] IN (SELECT [Id] FROM #Temp) AND [Group]=1 DELETE FROM #Temp WHERE [Id] IN (SELECT [Id] FROM [OtherTable] WHERE [Group]=1) INSERT INTO [OtherTable] ([Group], [Id]) SELECT 1 as [Group], [DocIden] FROM #Temp DROP TABLE #Temp COMMIT TRANSACTION CLOSE CONNECTION This is failing with an error on the DROP statement: Cannot drop the table '#Temp', because it does not exist or you do not have permission. I can't imagine how this failure could occur without something else going on first, but I don't see any other failures occurring before this. Is there anything that I'm missing that could be causing this to happen?

  Read the article

• getting last insert id .sqlalchemy orm

  - by gummmibear

  Hi i use sqlalchemy, i need some help. import hashlib import sqlalchemy as sa from sqlalchemy import orm from allsun.model import meta t_user = sa.Table("users",meta.metadata,autoload=True) class Duplicat(Exception): pass class LoginExistsException(Exception): pass class EmailExistsException(Exception): pass class User(object): """ def __setattr__(self, key, value): if key=='password' : value=unicode(hashlib.sha512(value).hexdigset()) object.__setattr__(self,key,value) """ def loginExists(self): try: meta.Session.query(User).filter(User.login==self.login).one() except orm.exc.NoResultFound: pass else: raise LoginExistsException() def emailExists(self): try: meta.Session.query(User).filter(User.email==self.email).one() except orm.exc.NoResultFound: pass else: raise EmailExistsException() def save(self): meta.Session.begin() meta.Session.save(self) try: meta.Session.commit() except sa.exc.IntegrityError: raise Duplicat() How can i get inserted id when i call? user = User() user.login = request.params['login'] user.password = hashlib.sha512(request.params['password']).hexdigest() user.email = request.params['email'] user.save()

  Read the article

• Python SQLite: database is locked

  - by user322683

  I'm trying this code: import sqlite connection = sqlite.connect('cache.db') cur = connection.cursor() cur.execute('''create table item (id integer primary key, itemno text unique, scancode text, descr text, price real)''') connection.commit() cur.close() I'm catching this exception: Traceback (most recent call last): File "cache_storage.py", line 7, in <module> scancode text, descr text, price real)''') File "/usr/lib/python2.6/dist-packages/sqlite/main.py", line 237, in execute self.con._begin() File "/usr/lib/python2.6/dist-packages/sqlite/main.py", line 503, in _begin self.db.execute("BEGIN") _sqlite.OperationalError: database is locked Permissions for cache.db are ok. Any ideas?

  Read the article

• Access Git Repository using Eclipse and Netbeans Plugins with LDAP Users

  - by ukrania

  Hello everyone! I've configure a git server. I need to use ssh because I've defined permissions using users of my domain, using LDAP. Only users with permissions could read a project. So, the links to access my repositories are like that: ssh://[email protected]@hostname/var/git/repo.git When I clone, commit or push a project using linux git commands or using tortoisegit on windows, there is no problem, everything works as expected. However, I've tried to clone a project using plugins from Eclipse (EGit) and Netbeans (NBGit), with no success. Seems that they can't recognize the host. I've accessed using a user from the server (not from the domain) and it cloned the project perfectly. Seems that the plugins assume that the host is everything after the first @. Do you know how I can solve this problem? There are any other Git plugins for those IDEs? Thanks for your answers. Best Regards, ukrania

  Read the article

• Problem in using svn and buildix

  - by jani

  Hi all I ran into a problem in using svn and buildix. I have a project created in svn as well as in cruise control which was working fine. Since yesterday whenever I commit changes into svn they are successfully commited but buildix is not able to pick up those changes, Normally I used to run 'svn update' whenever this problem occurs but now this is not helping for this project. When I try to run 'svn update', I get Skipped '.' and when I try to run 'svn cleanup', I get svn: '.' is not a working copy directory I took the advice of some one and deleted the folder .svn in my project but that did not help. Any help, thanks in advance. Regards, Jani

  Read the article

• NHibernate transaction management in ASP.NET MVC - how should it be done?

  - by adrin

  I am writing a simple ASP.NET MVC using session per request and transaction per request patterns (custom HttpModule). It seems to work properly, but.. the performance is terrible (a simple page loads ~7 seconds). For every http request, graphical resources incuding (all images on the site) a transaction is created and that seems to delay the loading times (without the transactions loading times per one image are ~1-10 ms with transactions they are over 1 second). What is the proper way to manage transactions in ASP.NET MVC + NH stack? When i've put all transactions into my repository methods, for some obscure reasons I got 'implicit transactions' warning in NHProf (the SQL statements were executed outside transaction, even that in code session.Save()/Update()/etc methods were invoked within transaction 'using' scope and before transaction.Commit() call) BTW are implicit transactions really bad?

  Read the article

• RedirectToAction and validate MVC 2

  - by Dan

  Hi, my problem is the View where the user typed, the validation. I have to take RedirectToAction on the site because on the site upload a file. Thats my code. My model class public class Person { [Required(ErrorMessage= "Please enter name")] public string name { get; set; } } My View <%@ Page Title="" Language="C#" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage<MvcWebRole1.Models.Person>" %> Name <h2>Information Data</h2> <%= Html.ValidationSummary() %> <%using (Html.BeginForm ("upload","Home", FormMethod.Post, new{ enctype ="multipart/form-data" })) {%> <fieldset> <legend>Fields</legend> <p> <label for="name">name:</label> <%= Html.TextBox("name") %> <%= Html.ValidationMessage("name", "*") %> </p> </fieldset> <% } %> and the Controller [AcceptVerbs(HttpVerbs.Post)] public ActionResult upload(FormCollection form) { Person lastname = new Person(); lastname.name = form["name"]; return RedirectToAction("Index"); } Thx for answer my question In advance

  Read the article

• How can I attach a file using Wordpress custom fields / meta boxes?

  - by shipshape

  I am using Wordpress's add_meta_box() function to add customized meta fields to the Add New Post page, like this. I want one of these fields to allow the user to upload a file, so that a single image, pdf, audio file, or video can be associated with the post. The closest example I've seen is this one. Unfortunately it does not suit my needs, as I want my file to be processed by Wordpress's Media Uploader - so it should appear in the Media Library afterwards, and thumbnails should be generated according to the Media settings. I think ideally there would be a way to tap into Wordpress's existing Add Media dialog, and simply output the URL of the uploaded file into a text box, but I don't see how to do that. This question is similar, but the answers are a little clunky - I would like to keep this super simple for my end users. How can I accomplish this? Please do not recommend plugins such as Flutter or Magic Fields - I have tried these and they do not suit my purposes (I want the images to be processed by Wordpress's Media Uploader). I am using Wordpress 3.0-alpha. Thanks!

  Read the article

• Prototype's Ajax.Updater not actually updating on IE7.

  - by Ben S

  I am trying to submit a form using Ajax.Updater and have the result of that update a div element in my page. Everything works great in IE6, FF3, Chrome and Opera. However, In IE7 it sporadically works, but more often than not, it just doesn't seem to do anything. Here's the javascript: function testcaseHistoryUpdate(testcase, form) { document.body.style.cursor = 'wait'; var param = Form.serialize(form); new Ajax.Updater("content", "results/testcaseHistory/" + testcase, { onComplete: function(transport) {document.body.style.cursor = 'auto'}, parameters: param, method: 'post' } ); } I've verified using alert() calls that param is set to what I expect. I've read in many places that IE7 caches aggressively and that it might be the root cause, however every after adding the following to my php response, it still doesn't work. header("Last-Modified: " . gmdate("D, d M Y H:i:s") . " GMT"); header("Cache-Control: no-store, no-cache, must-revalidate"); header("Cache-Control: post-check=0, pre-check=0", false); header("Pragma: no-cache"); To further try to fix a caching issue I've tried adding a bogus parameter which just gets filled with a random value to have different parameters for every call, but that didn't help. I've also found this, where UTF-8 seemed to be causing an issue with IE7, but my page is clearly marked: <meta http-equiv="Content-Type" content="text/html; charset=iso-8859-1" /> Does anyone have any idea what could be wrong with IE7 as opposed to the other browsers I tested to cause this kind of issue?

  Read the article

• Verifying existence of name and password in NSUserDefaults to Skip a login/Screen

  - by Michael Robinson

  I have a Tabbar/Tableview App that modally loads a Login/Signup view when the app loads, I have set up a Root.plist in a settings bundle for the name and password and have successfully retrieved the items. I want to be able to do two things: 1) Do a test to see if the NSUserDefault Strings are empty and if so load the Login/Signup view. 2) If the strings are available then use the string contents to login to my Webservice. Thanks in advance. Here is my LoginViewController .m : @synthesize usernameField; @synthesize passwordField; @synthesize loginButton; @synthesize loginIndicator; @synthesize usernameLabel; @synthesize passwordLabel; -(void)refreshFields { NSUserDefaults *defaults = [NSUserDefaults standardUserDefaults]; usernameLabel.text = [defaults objectForKey:kUsernameKey]; passwordLabel.text = [defaults objectForKey:kPasswordKey]; } - (void)viewDidAppear:(BOOL)animated { [self refreshFields]; [super viewDidAppear:animated]; } - (void)viewDidLoad { [super viewDidLoad]; [self refreshFields]; [self.navigationController setNavigationBarHidden:YES animated:NO]; } - (IBAction) login: (id) sender { { NSString *post =[NSString stringWithFormat:@"username=%@&password=%@",usernameField.text, passwordField.text]; NSString *hostStr = @"http:~iphone_login.php?"; hostStr = [hostStr stringByAppendingString:post]; NSData *dataURL = [NSData dataWithContentsOfURL: [ NSURL URLWithString: hostStr ]]; NSString *serverOutput = [[NSString alloc] initWithData:dataURL encoding: NSASCIIStringEncoding]; NSLog(@"Site: %@",hostStr); NSLog(@"Site: %@",serverOutput); if([serverOutput isEqualToString:@"Yes"]){ UIAlertView *alertsuccess = [[UIAlertView alloc] initWithTitle:@"Congrats" message:@"You are authorized " delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil, nil]; [alertsuccess show]; [alertsuccess release];

  Read the article

• Deleting index from Solr using solrj as a client

  - by Azhar

  Hello, I am using solrj as client for indexing documents on the solr server. I am having problem while deleting the indexes by 'id' from the solr server. I am using following code to delete the indexes: server.deleteById("id:20"); server.commit(true,true); After this when i again search for the documents, the search result contains the above document also. Dont know what is going wrong with this code. Please help me out with issue. Thanks!

  Read the article

• ODP.NET Code Example Critque or best practices

  - by andrewWinn

  I currently have a DataAccess Layer in Vb.Net. I am not too happy with my implementation of both my ExecuteQuery (as DataSet) and ExecuteNonQuery functions. Does anyone have any code that I could see? My code just doesn't look clean. Any thoughts or critiques on it would be appreciated also. Using odpConn As OracleConnection = New OracleConnection(_myConnString) odpConn.Open() If _beginTransaction Then txn = odpConn.BeginTransaction(IsolationLevel.Serializable) End If Try Using odpCmd As OracleCommand = odpConn.CreateCommand() odpCmd.CommandType = CommandType.Text odpCmd.CommandText = sSql For i = 0 To parameters.Parameters.Count - 1 Dim prm As New OracleParameter prm = DirectCast(parameters.Parameters(i), ICloneable).Clone odpCmd.Parameters.Add(prm) Next If (odpConn.State = ConnectionState.Closed) Then odpConn.Open() End If iToReturn = odpCmd.ExecuteNonQuery() If _beginTransaction Then txn.Commit() End If End Using Catch txn.Rollback() End Try End Using

  Read the article

• How to log in to craigslist using c#

  - by kosikiza

  i m using the following code to log in to craigslist, but haven't succeeded yet. string formParams = string.Format("inputEmailHandle={0}&inputPassword={1}", "[email protected]", "removed"); //string postData = "[email protected]&inputPassword=removed"; string uri = "https://accounts.craigslist.org/"; HttpWebRequest request = (HttpWebRequest)WebRequest.Create(uri); request.KeepAlive = true; request.ProtocolVersion = HttpVersion.Version10; request.Method = "POST"; byte[] postBytes = Encoding.ASCII.GetBytes(formParams); request.ContentType = "application/x-www-form-urlencoded"; request.ContentLength = postBytes.Length; Stream requestStream = request.GetRequestStream(); requestStream.Write(postBytes, 0, postBytes.Length); requestStream.Close(); HttpWebResponse response = (HttpWebResponse)request.GetResponse(); cookyHeader = response.Headers["Set-cookie"]; string pageSource; string getUrl = "https://post.craigslist.org/del"; WebRequest getRequest = WebRequest.Create(getUrl); getRequest.Headers.Add("Cookie", cookyHeader); WebResponse getResponse = getRequest.GetResponse(); using (StreamReader sr = new StreamReader(getResponse.GetResponseStream())) { pageSource = sr.ReadToEnd(); }

  Read the article

< Previous Page | 301 302 303 304 305 306 307 308 309 310 311 312  | Next Page >