Search Results

Search found 43031 results on 1722 pages for 'point and click games'.

Page 322/1722 | < Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• dynamical binding or switch/case?

  - by kingkai

  A scene like this: I've different of objects do the similar operation as respective func() implements. There're 2 kinds of solution for func_manager() to call func() according to different objects Solution 1: Use virtual function character specified in c++. func_manager works differently accroding to different object point pass in. class Object{ virtual void func() = 0; } class Object_A : public Object{ void func() {}; } class Object_B : public Object{ void func() {}; } void func_manager(Object* a) { a->func(); } Solution 2: Use plain switch/case. func_manager works differently accroding to different type pass in typedef _type_t { TYPE_A, TYPE_B }type_t; void func_by_a() { // do as func() in Object_A } void func_by_b() { // do as func() in Object_A } void func_manager(type_t type) { switch(type){ case TYPE_A: func_by_a(); break; case TYPE_B: func_by_b(); default: break; } } My Question are 2: 1. at the view point of DESIGN PATTERN, which one is better? 2. at the view point of RUNTIME EFFCIENCE, which one is better? Especailly as the kinds of Object increases, may be up to 10-15 total, which one's overhead oversteps the other? I don't know how switch/case implements innerly, just a bunch of if/else? Thanks very much!

  Read the article

• Why am I getting "Message sent to deallocated instance" in Objective-C?

  - by Dave C

  I have several buttons on my app that are being created dynamically. They are all pointed at the button click event when pressed. When the button pressed method is called, the sender's tag (int value) is parsed into the controller's house ID. It works with one of the buttons — the first one created, to be specific — but the others throw the following error: -[CFNumber intValue]: message sent to deallocated instance 0xc4bb0ff0 I am not releasing these buttons anywhere in my code. I haven't set them to autorelease or anything like that. I'm just wondering why they are doing this on the click. The button click event: - (IBAction) ButtonClick: (id) sender { HouseholdViewController *controller = [[HouseholdViewController alloc] initWithNibName:@"HouseholdViewController" bundle:nil]; controller.delegate = self; controller.HouseID = [(NSInteger)[(UIButton *)sender tag] intValue]; //this line throws an error controller.modalTransitionStyle = UIModalTransitionStyleFlipHorizontal; [self presentModalViewController:controller animated:YES]; [controller release]; } Where I am creating the buttons: UIButton *button = [UIButton buttonWithType:UIButtonTypeCustom]; button.frame = CGRectMake(MyLongInScreenCoords, MyLatInScreenCoords, 50, 50); UIImage *buttonImageNormal = [UIImage imageNamed:@"blue_pin.png"]; UIImage *strechableButtonImageNormal = [buttonImageNormal stretchableImageWithLeftCapWidth:50 topCapHeight:50]; [button setBackgroundImage:strechableButtonImageNormal forState:UIControlStateNormal]; [self.view addSubview:button]; button.tag = [NSNumber numberWithInt:[[words objectAtIndex: i] intValue]]; ButtonPoints[CurrentHouseCount][0] = button; ButtonPoints[CurrentHouseCount][1] = [NSValue valueWithCGPoint:CGPointMake(MyActualLat, MyActualLong)]; [button addTarget:self action:@selector(ButtonClick:) forControlEvents:UIControlEventTouchUpInside]; CurrentHouseCount++;

  Read the article

• How to use QCOMPARE Macro to compare events

  - by vels

  Hi, I have MyWindow class which popus a blank window, which accepts a mouse click, I need to unit test the mouse click event Code snippet: void TestGui::testGUI_data() { QTest::addColumn<QTestEventList>("events"); QTest::addColumn<QTestEventList>("expected"); Mywindow mywindow; QSize editWidgetSize = mywindow.size(); QPoint clickPoint(editWidgetSize.rwidth()-2, editWidgetSize.rheight()-2); QTestEventList events, expected ; events.addMouseClick( Qt::LeftButton, 0, clickPoint); expected.addMouseClick( Qt::LeftButton, 0, clickPoint); QTest::newRow("mouseclick") << events << expected ; } void TestGui::testGUI() { QFETCH(QTestEventList, events); QFETCH(QTestEventList, expected); Mywindow mywindow; mywindow.show(); events.simulate(&mywindow); QCOMPARE(events, expected); } // prints FAIL! : TestGui::testGUI(mouseclick) Compared values are not the same How to test the mouse click on mywindow. is there any beeter approach to unit test mouse events? Thanks, vels

  Read the article

• Elements added later All images and text loaded to function. (jQuery or Javascript)

  - by Tayatt

  #clickArea click to #contents prepend #loadingText(Loading...) and #contents append HTML-source. If append HTML-source(All images and text) Load complete to #loadingText(Loading...) is fadeOut. The code that it is the best in this case? HTML <div id="contents"> <p id="clickArea">Click</p> </div> JavaScript(jQuery) $('p#clickArea').click(function(){ $('div#contents').prepend('<p id="loadingText">Loading...</p>'); $('div#contents').append('<div><p class="image"><img src="bigSizeImage01.jpg" alt="" /></p><p class="image"><img src="bigSizeImage02.jpg" alt="" /></p><p class="image"><img src="bigSizeImage03.jpg" alt="" /></p><p class="text">Hello, this is text.</p><p class="text">Hello, this is text.</p></div>'); $('**********').load( function(){ $('#loadingText').fadeOut(1200); } ); }); Supplement : $('div#contents').append(HTML-source) <div> <p class="image"><img src="bigSizeImage01.jpg" alt="" /></p> <p class="image"><img src="bigSizeImage02.jpg" alt="" /></p> <p class="image"><img src="bigSizeImage03.jpg" alt="" /></p> <p class="text">Hello, this is text.</p> <p class="text">Hello, this is text.</p> </div>

  Read the article

• Is integrated graphics card Radeon HD 4200 capable to handle full HD?

  - by develroot

  I enjoy my integrated graphics card Radeon HD 4200 at resolution of 1280x1024 pixels on a 19" inches LG Flatron (5:4 aspect ratio) (playing FIFA 10 at max resolution, max quality). But recently i decided to upgrade my monitor and to get an 24" inches BENQ, 1920x1080, fullHD. Would I experience any problems with that graphics card on a such a big monitor? Usually I don't play games, just movies/music/and of programming, but it would be nice to be able to play some Counter Strike without artifacts.

  Read the article

• Problems with overriding OnPaint and grabbing mouse events in C# UserControl containing other controls

  - by MoreThanChaos

  I've made a control which contains few other controls like PictureBox, Label and TextBox. But I'm having two problems: 1. I tried to paint some things on top of my control and when I'm overriding OnPaint, it results that things I try to draw are under controls that my control contains. Areas on which I would like to draw intersect with controls in ways that are not easy to predict. I mean that it includes something drawn on controls inside as well as on base of control. Is there a simple way to draw something on top of all contents of my control? Setting ForeColor to Transparent isn't a solution that would help me much. 2. I have a problem with grabbing mouse click events when I place my control on a form and add click event handling. It only works when I click on an area not occupied by controls inside. I would like the whole control to react to clicks and other actions like it was one consistent control. How can I redirect/handle these clicks to make them work the way I want? Thanks in advance for any tips

  Read the article

• jquery events on input submit fields

  - by dfilkovi

  I have a problem with jquery submit button onclick and default event. What I want to do is replace an click event on submit button if it has one, and get an dialog box to show up, on clicking yes the dialog should start that default onclick event if submit button has one defined, if it hasn't than the default event should happen (button submits form), .submit() function does not work for me in any case cause I need to send this button also through a form and if button wasn't clicked .submit() sends form data without submit data. Bellow code has a problem, alert('xxx') is always called and it shouldn't, and on clicking yes button alert and dialog creation is called again, also if I remove alert button, I cannot call default submit button event (form submitting with a button). $('input.confirm').each(function() { var input = this; var dialog = document.createElement("div"); $(dialog).html('<p>AREYOUSHURE</p>'); $(input).click(function(event) { event.preventDefault(); var buttons = {}; buttons['NO'] = function() { $(this).dialog("close"); }; buttons['YES'] = function() { $(input).trigger('click'); $(this).dialog("close"); }; $(dialog).dialog( { autoOpen: false, width: 200, modal: true, resizable: false, buttons: buttons }); $(dialog).dialog('open'); return false; }); }); <form method="post" action=""> <input type="hidden" value="1" name="eventId" /> <input type="submit" value="Check" name="checkEvent" class="confirm" onclick="alert('xxx');" /> </form>

  Read the article

• Flash - Http service bound to a button can be used only once ?

  - by SAKIROGLU Koray

  I have a flex project, in one of the screen of my UI, I create a HTTP service that call a "doGet" J2EE servlet through the GET method; and I bind the service call to a button. The service print log to system.out so I know when it is run. The problem I have is, when I click said button the first time, the servlets do what it is supposed to do, and print the stack to system.out, but if I click another time, nothing happens. Any idea what might be the cause ? Here's the flex code (code and service has been generated by Eclipse flex plugin) <mx:Script> <![CDATA[ protected function button_clickHandler(event:MouseEvent):void { LaunchSimulResult.token = simulation.LaunchSimul(); } ]]> </mx:Script> <mx:Canvas> ... <mx:Button label="Simulation" id="button" click="button_clickHandler(event)"/> .. </mx:Canvas> <mx:CallResponder id="LaunchSimulResult"/> <simulation:Simulation id="simulation" fault="Alert.show(event.fault.faultString + '\n' + event.fault.faultDetail)" showBusyCursor="true"/>

  Read the article

• Upgrading PS1 Light Gun [on hold]

  - by Nathan Taylor

  Is There any possible way to upgrade the retro G-con Light Gun for PS1 to allow it to interact with HD TV's? I am aware that they were Designed purely for Tube TV's but I would be happy to know of any hardware that would maybe convert the light to hit the Pixels on an LCD TV. If not is there any other Light gun that would work on PS1 games but has the newer light gun hardware that can interact with a higher Pixel LCD TV?

  Read the article

• JQuery fadeIn fadeOut loop issue

  - by Tarun

  I am trying to create a jQuery fadeIn fadeout effect for my page content using the code below. $(document).ready(function (){ $("#main").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("main.html", function(){ $("#content").fadeIn(800); }); }); }); $("#gallery").click(function(){ $("#content").fadeOut(800, function(){ $("#content").load("gallery.html", function(){ $("#content").fadeIn(800); }); }); }); }); So whenever a user clicks on either the main link or gallery link, the old content fades out and new content fades in. The problem I am facing is that for every link I have to repeat the same code again and again. So I tried to use a loop to simplify this but it doesn't work. Here is my code: var p = ["#main","#gallery", "#contact"]; var q = ["main.html", "gallery.html", "contact.html"]; for (i=0;i<=(p.length-1);i++){ $(p[i]).click(function(){ $("#content").fadeOut(500, function(){ $("#content").load(q[i], function(){ $("#content").fadeIn(500); }); }); }); } It works fine when I write repeat the scripts for each link but it doesn't work when I combine them in a loop. I only get the FadeOut effect and nothing happens after that. This might be a very simple issue or may be something deep into jQuery. Any hint or help is greatly appreciated. TK

  Read the article

• Is anyone familiar with SDPT.clsSDPT?

  - by David Stratton

  Normally I wouldn't ask this kind of question here, but I'm desperate at this point. I'm attempting to support a classic ASP app written by a predecessor who is no longer available. Keeping it short, several applications use a dll to perform encryption of sensitive data. This dll is named SDPT.dll, and the line of code used to create an object is set objSDPT = server.CreateObject("SDPT.clsSDPT") At this point, I am getting errors in a critical app on one of my servers, and I've actually hit a dead end. The error is a standard "Server.CreateObject Failed" message, which I know how to troubleshoot in most cases. However, in this case, all of my normal tries, plus several hours of Google searches are coming up with nothing that works. At this point, I'm not so much looking for help in troubleshooting the issue as I am in finding any sort of reference on this third party component. Even finding that is proving to be difficult, so I'm resorting to asking any of the seasoned developers that hang out here if they are familiar with this product, who it was developed by, and if any documentation on it exists anywhere.

  Read the article

• how to add text in a created table in a richtextbox?

  - by francops henri

  I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

  Read the article

• Insert Stored Procedure does not Create Database Record

  - by SidC

  Hello All, I have the following stored procedure: ALTER PROCEDURE Pro_members_Insert @id int outPut, @LoginName nvarchar(50), @Password nvarchar(15), @FirstName nvarchar(100), @LastName nvarchar(100), @signupDate smalldatetime, @Company nvarchar(100), @Phone nvarchar(50), @Email nvarchar(150), @Address nvarchar(255), @PostalCode nvarchar(10), @State_Province nvarchar(100), @City nvarchar(50), @countryCode nvarchar(4), @active bit, @activationCode nvarchar(50) AS declare @usName as varchar(50) set @usName='' select @usName=isnull(LoginName,'') from members where LoginName=@LoginName if @usName <> '' begin set @ID=-3 RAISERROR('User Already exist.', 16, 1) return end set @usName='' select @usName=isnull(email,'') from members where Email=@Email if @usName <> '' begin set @ID=-4 RAISERROR('Email Already exist.', 16, 1) return end declare @MemID as int select @memID=isnull(max(ID),0)+1 from members INSERT INTO members ( id, LoginName, Password, FirstName, LastName, signupDate, Company, Phone, Email, Address, PostalCode, State_Province, City, countryCode, active,activationCode) VALUES ( @Memid, @LoginName, @Password, @FirstName, @LastName, @signupDate, @Company, @Phone, @Email, @Address, @PostalCode, @State_Province, @City, @countryCode, @active,@activationCode) if @@error <> 0 set @ID=-1 else set @id=@memID Note that I've "inherited" this sproc and the database. I am trying to insert a new record from my signup.aspx page. My SQLDataSource is as follows: <asp:SqlDataSource runat="server" ID="dsAddMember" ConnectionString="rmsdbuser" InsertCommandType="StoredProcedure" InsertCommand="Pro_members_Insert" ProviderName="System.Data.SqlClient"> The click handler for btnSave is as follows: Protected Sub btnSave_Click(ByVal sender As Object, ByVal e As EventArgs) Handles btnSave.Click Try dsAddMember.DataBind() Catch ex As Exception End Try End Sub When I run this page, signup.aspx, provide required fields and click submit, the page simply reloads and the database table does not reflect the newly-inserted record. Questions: 1. How do I catch the error messages that might be returned from the sproc? 2. Please advise how to change signup.aspx so that the insert occurs. Thanks, Sid

  Read the article

• Free media center PC software which runs on Windows XP

  - by Deleted

  Is there something which may: Play music, at the very least in MP3-format Play video in various codec's Helps in recording video of shows from TV through a TV-in card Helps in organizing music and videos Works with a keyboard and mouse Additional pluses are: If it also is possible to browse the web through it, or at least start the web browser Has some games. Maybe through MAME or some other emulation like SNES or something. If it's also possible to control it through a game pad.

  Read the article

• MSSQL 2005 FOR XML

  - by Lima

  Hi, I am wanting to export data from a table to a specifically formated XML file. I am fairly new to XML files, so what I am after may be quite obvious but I just cant find what I am looking for on the net. The format of the XML results I need are: <data> <event start="May 28 2006 09:00:00 GMT" end="Jun 15 2006 09:00:00 GMT" isDuration="true" title="Writing Timeline documentation" image="http://simile.mit.edu/images/csail-logo.gif"> A few days to write some documentation </event> </data> My table structure is: name VARCHAR(50), description VARCHAR(255), startDate DATETIME, endDate DATETIME (I am not too interested in the XML fields image or isDuration at this point in time). I have tried: SELECT [name] ,[description] ,[startDate] ,[endTime] FROM [testing].[dbo].[time_timeline] FOR XML RAW('event'), ROOT('data'), type Which gives me: <data> <event name="Test1" description="Test 1 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> <event name="Test2" description="Test 2 Description...." startDate="1900-01-01T00:00:00" endTime="1900-01-01T00:00:00" /> </data> What I am missing, is the description needs to be outside of the event attributes, and there needs to be a tag. Is anyone able to point me in the correct direction, or point me to a tutorial or similar on how to accomplish this? Thanks, Matt

  Read the article

• How to use WebSockets refresh multi-window for play framework 1.2.7

  - by user2468652

  My code can work.But only refresh a page of one window. If I open window1 and window2 , both open websocket connect. I keyin word "test123" in window1, click sendbutton. Only refresh window1. How to refresh window1 and window2 ? Client <script> window.onload = function() { document.getElementById('sendbutton').addEventListener('click', sendMessage,false); document.getElementById('connectbutton').addEventListener('click', connect, false); } function writeStatus(message) { var html = document.createElement("div"); html.setAttribute('class', 'message'); html.innerHTML = message; document.getElementById("status").appendChild(html); } function connect() { ws = new WebSocket("ws://localhost:9000/ws?name=test"); ws.onopen = function(evt) { writeStatus("connected"); } ws.onmessage = function(evt) { writeStatus("response: " + evt.data); } } function sendMessage() { ws.send(document.getElementById('messagefield').value); } </script> </head> <body> <button id="connectbutton">Connect</button> <input type="text" id="messagefield"/> <button id="sendbutton">Send</button> <div id="status"></div> </body> Play Framework WebSocketController public class WebSocket extends WebSocketController { public static void test(String name) { while(inbound.isOpen()) { WebSocketEvent evt = await(inbound.nextEvent()); if(evt instanceof WebSocketFrame) { WebSocketFrame frame = (WebSocketFrame)evt; System.out.println("received: " + frame.getTextData()); if(!frame.isBinary()) { if(frame.getTextData().equals("quit")) { outbound.send("Bye!"); disconnect(); } else { outbound.send("Echo: %s", frame.getTextData()); } } } } } }

  Read the article

• flash as3, Error #1009

  - by smerels

  I'm making a website that exist out of linked pages. All the pages are on the time line and all the code is in an as3 file. The first page with links works but if I want to place a link on the second frame I get the 1009 error Cannot access a property or method of a null object reference. Because the link doesn't exist on the first frame. This is my code. package { import flash.display.MovieClip; import flash.events.MouseEvent; public class Honger extends MovieClip { public function Honger():void { weten.buttonMode = true; weten.addEventListener(MouseEvent.CLICK, onClickWeten); spelen.buttonMode = true; spelen.addEventListener(MouseEvent.CLICK, onClickSpelen); antwoorden.buttonMode = true; antwoorden.addEventListener(MouseEvent.CLICK, onClickAntwoorden); } public function onClickWeten(e:MouseEvent):void { this.gotoAndStop("vragen"); } public function onClickSpelen(e:MouseEvent):void{ this.gotoAndStop("spel"); } public function onClickAntwoorden(e:MouseEvent):void{ this.gotoAndStop("sp"); } } } Does anyone know how to solve this problem within the code?

  Read the article

• Cron Job that Boots Screen at Start

  - by Pez Cuckow

  I am trying to set up a number of processes that start during boot (servers for games) with the below command as the cron item: @reboot /usr/bin/screen -fa -d -m -S NAME COMMAND However if the server crashes for what ever reason screen closes and the server doesn't get a chance to run it's auto restart (as far as I understand; screen sees no processes in the socket and so closes). Is there a way that I can get around this so screen will sit there even if nothing is running in it?

  Read the article

• Custom server control disappears from page when UpdatePanel updates

  - by Sasha

  Hi all. I created a custom asp.net server control. It works fine on a regular asp.net page and as a DOM object inside of the browser. But I've never used the UpdatePanel before and now I'm trying to make sure that this control works there as well. It doesn't. If I add my control to the page outside of an update panel and click some panel's inside button (trigger), everything works fine. But if I place my control inside of update panel and click that button again, the control "disappears" from the page completely. I still can see my control in javascript debugger and the update, meaning that the object itself is still in DOM. It looks like the panel just "hides" the outer div element of my control for some reason. I tried to call panel's Update() method on button click handler, set panel's UpdateMode to both Conditional and Always. All with the same result. How can I fix that? Thank you!

  Read the article

• Jquery Append() and remove() element

  - by BandonRandon

  Hi, I have a form where I'm dynamically adding the ability to upload files with the append function but I would also like to be able to remove unused fields. Here is the html markup <span class="inputname">Project Images: <a href="#" class="add_project_file"><img src="images/add_small.gif" border="0"></a></span> <span class="project_images"> <input name="upload_project_images[]" type="file" /><br/> </span> Right now if they click on the "add" gif a new row is added with this jquery $('a.add_project_file').click(function() { $(".project_images").append('<input name="upload_project_images[]" type="file" class="new_project_image" /> <a href="#" class="remove_project_file" border="2"><img src="images/delete.gif"></a><br/>'); return false; }); To remove the input box i've tried to add the class "remove_project_file" then add this function. $('a.remove_project_file').click(function() { $('.project_images').remove(); return false;}); I think there should be a much easier way to do this. Maybe i need to use the $(this) function for the remove. Another possible solution would be to expand the "add project file" to do both adding and removing fields. Any of you JQuery wizards have any ideas that would be great

  Read the article

• Validation problem with a 'JotForm' template

  - by Thomas

  A client sent me a form template they had created using jotform.com to implement on their wordpress site. The form template is supposed to hide part of the form until the user clicks the 'next' button. At which point a script is supposed to validate all of the input fields the user has presumably filled out and then display the rest of the form. While I have successfully managed to get the form to display the next part of the form when the user clicks 'next', it fails to validate the input fields. Its kind of difficult to explain without a huge block of text so it is probably easier to show you: The original working template that the customer sent me: http://www.loftist.com/jotform/List_Your_Loft.html The problem child: http://www.loftist.com/?page_id=78 If you just click on one of the input fields and then click elsewhere on the page, the input fields successfully return a validation error message and prevent the user from clicking on the 'next' button. However, if you simply click on the next button than the next set of fields get displayed. Any thoughts? What am I doing wrong here? Im convinced this must be a really simple problem but Im not sure what it could be....

  Read the article

• Visual Basic Express 2008 Help

  - by khalidfazeli

  I have been given a task to: Develop a program where a child will be presented with picture of a fruit (one of five possible fruit) on the screen at the click of a start button. The child will then try to recognise the fruit and write its name in a specified place on the screen. On the click of a check button the name of the fruit written by the child will be checked by your program and if correct will reward the child with a suitable message. If the name presented by the child is not correct, a suitable message should be presented on a red background with the correct name of the fruit included in the message. so far I have managed to create a form with 5 different fruit pictures and a text box below them. a button at the bottom of the form then checks the results and presents a message box to tell them if they have passed or failed. Private Sub btnResults_Click(ByVal sender As System.Object, ByVal e As System.EventArgs) Handles btnResults.Click If txtApple.Text = "APPLE" And txtOrange.Text = "ORANGES" And txtStrawberry.Text = "STRAWBERRIES" And txtGrapes.Text = "GRAPES" And txtBanana.Text = "BANANAS" Then MsgBox("Congratulations! you got it all right!", MsgBoxStyle.OkOnly) End Else MsgBox("Incorrect, please try again", MsgBoxStyle.OkOnly) End End If End Sub but I can't get it to randomise the picture of the fruit, so it only displays one fruit at a time and checks against it. Any help is appreciated. Thanks

  Read the article

• Jquery Select Problem

  - by oraclee

  Hi; Jquery Code: $("[id$=mytable] tr").click(function() { alert($(this).html()); }); Html: <table id="mytable"> <tr> <td class="locked">1</td> <td>2</td> <td>3</td> </tr> <tr> <td class="locked">a</td> <td>b</td> <td>c</td> </tr> </table> i need only "td class='locked'" click return this click: <td class="locked">1</td> output: <tr> <td class="locked">1</td> <td>2</td> <td>3</td> </tr>

  Read the article

• loading a href's content into a shadowbox using .load() HELP!!!

  - by kielie

  <script type="text/javascript"> $(function() { $('#wp-calendar a').click(function(event) { event.preventDefault(); var url = $(this).attr('href') + ' #content'; var loaded = Shadowbox.load(url); Shadowbox.open({ content: loaded, player: "html", title: "<?php the_title(); ?>", height: 300, width: 470, }); }); }); </script> That is the code I am using to try and display content in a shadowbox, I am using the default wordpress calendar and with jQuery/AJAX (if I am not mistaken) adding this click event to every link in the calendar, so that when a link is clicked, the content is loaded and displayed in a shadowbox instead of opening on a new page. When I click on one of the links all I get inside of the shadowbox is "undefined". As I am sure you can see in my code, I am still very new to this, so any help or pointers would be appreciated. Thanx in advance!

  Read the article

< Previous Page | 318 319 320 321 322 323 324 325 326 327 328 329  | Next Page >