Search Results

Search found 12846 results on 514 pages for 'ghost answer'.

Page 484/514 | < Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >

• Remote Postgresql - extremely slow

  - by Muffinbubble

  Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

  Read the article

• Mocking methods that call other methods Still hit database.Can I avoid it?

  - by devnet247

  Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

  Read the article

• Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

  - by Vatsala

  Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

  Read the article

• How can I create a Base64-Encoded string from an GDI+ Image in C++?

  - by Schnapple

  I asked a question recently, How can I create an Image in GDI+ from a Base64-Encoded string in C++?, which got a response that led me to the answer. Now I need to do the opposite - I have an Image in GDI+ whose image data I need to turn into a Base64-Encoded string. Due to its nature, it's not straightforward. The crux of the issue is that an Image in GDI+ can save out its data to either a file or an IStream*. I don't want to save to a file, so I need to use the resulting stream. Problem is, this is where my knowledge breaks down. This first part is what I figured out in the other question // Initialize GDI+. GdiplusStartupInput gdiplusStartupInput; ULONG_PTR gdiplusToken; GdiplusStartup(&gdiplusToken, &gdiplusStartupInput, NULL); // I have this decode function from elsewhere std::string decodedImage = base64_decode(Base64EncodedImage); // Allocate the space for the stream DWORD imageSize = decodedImage.length(); HGLOBAL hMem = ::GlobalAlloc(GMEM_MOVEABLE, imageSize); LPVOID pImage = ::GlobalLock(hMem); memcpy(pImage, decodedImage.c_str(), imageSize); // Create the stream IStream* pStream = NULL; ::CreateStreamOnHGlobal(hMem, FALSE, &pStream); // Create the image from the stream Image image(pStream); // Cleanup pStream->Release(); GlobalUnlock(hMem); GlobalFree(hMem); (Base64 code) And now I'm going to perform an operation on the resulting image, in this case rotating it, and now I want the Base64-equivalent string when I'm done. // Perform operation (rotate) image.RotateFlip(Gdiplus::Rotate180FlipNone); IStream* oStream = NULL; CLSID tiffClsid; GetEncoderClsid(L"image/tiff", &tiffClsid); // Function defined elsewhere image.Save(oStream, &tiffClsid); // And here's where I'm stumped. (GetEncoderClsid) So what I wind up with at the end is an IStream* object. But here's where both my knowledge and Google break down for me. IStream shouldn't be an object itself, it's an interface for other types of streams. I'd go down the road from getting string-Image in reverse, but I don't know how to determine the size of the stream, which appears to be key to that route. How can I go from an IStream* to a string (which I will then Base64-Encode)? Or is there a much better way to go from a GDI+ Image to a string?

  Read the article

• Best way to test for a variable's existence in PHP; isset() is clearly broken

  - by chazomaticus

  From the isset() docs: isset() will return FALSE if testing a variable that has been set to NULL. Basically, isset() doesn't check for whether the variable is set at all, but whether it's set to anything but NULL. Given that, what's the best way to actually check for the existence of a variable? I tried something like: if(isset($v) || @is_null($v)) (the @ is necessary to avoid the warning when $v is not set) but is_null() has a similar problem to isset(): it returns TRUE on unset variables! It also appears that: @($v === NULL) works exactly like @is_null($v), so that's out, too. How are we supposed to reliably check for the existence of a variable in PHP? Edit: there is clearly a difference in PHP between variables that are not set, and variables that are set to NULL: <?php $a = array('b' => NULL); var_dump($a); PHP shows that $a['b'] exists, and has a NULL value. If you add: var_dump(isset($a['b'])); var_dump(isset($a['c'])); you can see the ambiguity I'm talking about with the isset() function. Here's the output of all three of these var_dump()s: array(1) { ["b"]=> NULL } bool(false) bool(false) Further edit: two things. One, a use case. An array being turned into the data of an SQL UPDATE statement, where the array's keys are the table's columns, and the array's values are the values to be applied to each column. Any of the table's columns can hold a NULL value, signified by passing a NULL value in the array. You need a way to differentiate between an array key not existing, and an array's value being set to NULL; that's the difference between not updating the column's value and updating the column's value to NULL. Second, Zoredache's answer, array_key_exists() works correctly, for my above use case and for any global variables: <?php $a = NULL; var_dump(array_key_exists('a', $GLOBALS)); var_dump(array_key_exists('b', $GLOBALS)); outputs: bool(true) bool(false) Since that properly handles just about everywhere I can see there being any ambiguity between variables that don't exist and variables that are set to NULL, I'm calling array_key_exists() the official easiest way in PHP to truly check for the existence of a variable. (Only other case I can think of is for class properties, for which there's property_exists(), which, according to its docs, works similarly to array_key_exists() in that it properly distinguishes between not being set and being set to NULL.)

  Read the article

• How to measure a canvas that has auto height and width

  - by Wymmeroo

  Hi Folks, I'm a beginner in silverlight so i hope i can get an answer that brings me some more light in the measure process of silverlight. I found an interessting flap out control from silverlight slide control and now I try to use it in my project. So that the slide out is working proper, I have to place the user control on a canvas. The user control then uses for itself the height of its content. I just wanna change that behavior so that the height is set to the available space from the parent canvas. You see the uxBorder where the height is set. How can I measure the actual height and set it to the border? I tried it with Height={Binding ElementName=notificationCanvas, Path=ActualHeight} but this dependency property has no callback, so the actualHeight is never set. What I want to achieve is a usercontrol like the tweetboard per example on Jesse Liberty's blog Sorry for my English writing, I hope you understand my question. <Canvas x:Name="notificationCanvas" Background="Red"> <SlideEffectEx:SimpleSlideControl GripWidth="20" GripTitle="Task" GripHeight="100"> <Border x:Name="uxBorder" BorderThickness="2" CornerRadius="5" BorderBrush="DarkGray" Background="DarkGray" Padding="5" Width="300" Height="700" > <StackPanel> <TextBlock Text="Tasks"></TextBlock> <Button x:Name="btn1" Margin="5" Content="{Binding ElementName=MainBorder, Path=Height}"></Button> <Button x:Name="btn2" Margin="5" Content="Second Button"></Button> <Button x:Name="btn3" Margin="5" Content="Third Button"></Button> <Button x:Name="btn1_Copy" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy1" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy2" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy3" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy4" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy5" Margin="5" Content="First Button"/> <Button x:Name="btn1_Copy6" Margin="5" Content="First Button"/> </StackPanel> </Border> </SlideEffectEx:SimpleSlideControl>

  Read the article

• overwrite existing entity via bulkloader.Loader

  - by Ray Yun

  I was going to CSV based export/import for large data with app engine. My idea was just simple. First column of CSV would be key of entity. If it's not empty, that row means existing entity and should overwrite old one. Else, that row is new entity and should create new one. I could export key of entity by adding key property. class FrontExporter(bulkloader.Exporter): def __init__(self): bulkloader.Exporter.__init__(self, 'Front', [ ('__key__', str, None), ('name', str, None), ]) But when I was trying to upload CSV, it had failed because bulkloader.Loader.generate_key() was just for "key_name" not "key" itself. That means all exported entities in CSV should have unique 'key_name' if I want to modify-and-reupload them. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('_UNUSED', lambda x: None), ('name', lambda x: x.decode('utf-8')), ]) def generate_key(self,i,values): # first column is key keystr = values[0] if len(keystr)==0: return None return keystr I also tried to load key directly without using generate_key(), but both failed. class FrontLoader(bulkloader.Loader): def __init__(self): bulkloader.Loader.__init__(self, 'Front', [ ('Key', db.Key), # not working. just create new one. ('__key__', db.Key), # same... So, how can I overwrite existing entity which has no 'key_name'? It would be horrible if I should give unique name to all entities..... From the first answer, I could handle this problem. :) def create_entity(self, values, key_name=None, parent=None): # if key_name is None: # print 'key_name is None' # else: # print 'key_name=<',key_name,'> : length=',len(key_name) Validate(values, (list, tuple)) assert len(values) == len(self._Loader__properties), ( 'Expected %d columns, found %d.' % (len(self._Loader__properties), len(values))) model_class = GetImplementationClass(self.kind) properties = { 'key_name': key_name, 'parent': parent, } for (name, converter), val in zip(self._Loader__properties, values): if converter is bool and val.lower() in ('0', 'false', 'no'): val = False properties[name] = converter(val) if key_name is None: entity = model_class(**properties) #print 'create new one' else: entity = model_class.get(key_name) for key, value in properties.items(): setattr(entity, key, value) #print 'overwrite old one' entities = self.handle_entity(entity) if entities: if not isinstance(entities, (list, tuple)): entities = [entities] for entity in entities: if not isinstance(entity, db.Model): raise TypeError('Expected a db.Model, received %s (a %s).' % (entity, entity.__class__)) return entities def generate_key(self,i,values): # first column is key if values[0] is None or values[0] in ('',' ','-','.'): return None return values[0]

  Read the article

• mysql timeout - c/C++

  - by user1262876

  Guys i'm facing a problem with this code, the problem is the timeout by timeout i mean the time it takes the program to tell me if the server is connected or not. If i use my localhost i get the answer fast, but when i connect to outside my localhost it takes 50sc - 1.5 min to response and the program frezz until it done. HOw can i fix the frezzing, or make my own timeout, like if still waiting after 50sc, tell me connection failed and stop? please use codes as help, becouse i would understand it better, thanks for any help i get PS: USING MAC #include "mysql.h" #include <stdio.h> #include <stdlib.h> // Other Linker Flags: -lmysqlclient -lm -lz // just going to input the general details and not the port numbers struct connection_details { char *server; char *user; char *password; char *database; }; MYSQL* mysql_connection_setup(struct connection_details mysql_details) { // first of all create a mysql instance and initialize the variables within MYSQL *connection = mysql_init(NULL); // connect to the database with the details attached. if (!mysql_real_connect(connection,mysql_details.server, mysql_details.user, mysql_details.password, mysql_details.database, 0, NULL, 0)) { printf("Conection error : %s\n", mysql_error(connection)); exit(1); } return connection; } MYSQL_RES* mysql_perform_query(MYSQL *connection, char *sql_query) { // send the query to the database if (mysql_query(connection, sql_query)) { printf("MySQL query error : %s\n", mysql_error(connection)); exit(1); } return mysql_use_result(connection); } int main() { MYSQL *conn; // the connection MYSQL_RES *res; // the results MYSQL_ROW row; // the results row (line by line) struct connection_details mysqlD; mysqlD.server = (char*)"Localhost"; // where the mysql database is mysqlD.user = (char*)"root"; // the root user of mysql mysqlD.password = (char*)"123456"; // the password of the root user in mysql mysqlD.database = (char*)"test"; // the databse to pick // connect to the mysql database conn = mysql_connection_setup(mysqlD); // assign the results return to the MYSQL_RES pointer res = mysql_perform_query(conn, (char*) "SELECT * FROM me"); printf("MySQL Tables in mysql database:\n"); while ((row = mysql_fetch_row(res)) !=NULL) printf("%s - %s\n", row[0], row[1], row[2]); // <-- Rows /* clean up the database result set */ mysql_free_result(res); /* clean up the database link */ mysql_close(conn); return 0; }

  Read the article

• dynamic module creation

  - by intuited

  I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

  Read the article

• To Interface or Not?: Creating a polymorphic model relationship in Ruby on Rails dynamically..

  - by Globalkeith

  Please bear with me for a moment as I try to explain exactly what I would like to achieve. In my Ruby on Rails application I have a model called Page. It represents a web page. I would like to enable the user to arbitrarily attach components to the page. Some examples of "components" would be Picture, PictureCollection, Video, VideoCollection, Background, Audio, Form, Comments. Currently I have a direct relationship between Page and Picture like this: class Page < ActiveRecord::Base has_many :pictures, :as => :imageable, :dependent => :destroy end class Picture < ActiveRecord::Base belongs_to :imageable, :polymorphic => true end This relationship enables the user to associate an arbitrary number of Pictures to the page. Now if I want to provide multiple collections i would need an additional model: class PictureCollection < ActiveRecord::Base belongs_to :collectionable, :polymorphic => true has_many :pictures, :as => :imageable, :dependent => :destroy end And alter Page to reference the new model: class Page < ActiveRecord::Base has_many :picture_collections, :as => :collectionable, :dependent => :destroy end Now it would be possible for the user to add any number of image collections to the page. However this is still very static in term of the :picture_collections reference in the Page model. If I add another "component", for example :video_collections, I would need to declare another reference in page for that component type. So my question is this: Do I need to add a new reference for each component type, or is there some other way? In Actionscript/Java I would declare an interface Component and make all components implement that interface, then I could just have a single attribute :components which contains all of the dynamically associated model objects. This is Rails, and I'm sure there is a great way to achieve this, but its a tricky one to Google. Perhaps you good people have some wise suggestions. Thanks in advance for taking the time to read and answer this.

  Read the article

• Just a small problem regarding javscript BOM question

  - by caramel1991

  The question is this: Create a page with a number of links. Then write code that fires on the window onload event, displaying the href of each of the links on the page. And this is my solution <html> <body language="Javascript" onload="displayLink()"> <a href="http://www.google.com/">First link</a> <a href="http://www.yahoo.com/">Second link</a> <a href="http://www.msn.com/">Third link</a> <script type="text/javascript" language="Javascript"> function displayLink() { for(var i = 0;document.links[i];i++) { alert(document.links[i].href); } } </script> </body> </html> This is the answer provided by the book <html> <head> <script language=”JavaScript” type=”text/javascript”> function displayLinks() { var linksCounter; for (linksCounter = 0; linksCounter < document.links.length; linksCounter++) { alert(document.links[linksCounter].href); } } </script> </head> <body onload=”displayLinks()”> <A href=”link0.htm” >Link 0</A> <A href=”link1.htm”>Link 2</A> <A href=”link2.htm”>Link 2</A> </body> </html> Before I get into the javascript tutorial on how to check user browser version or model,I was using the same method as the example,by acessing the length property of the links array for the loop,but after I read through the tutorial,I find out that I can also use this alternative ways,by using the method that the test condition will evalute to true only if the document.links[i] return a valid value,so does my code is written using the valid method??If it's not,any comment regarding how to write a better code??Correct me if I'm wrong,I heard some of the people say "a good code is not evaluate solely on whether it works or not,but in terms of speed,the ability to comprehend the code,and could posssibly let others to understand the code easily".Is is true??

  Read the article

• One registry key for many products not deleted on uninstall

  - by NC1

  My company has many products, we want to create a registry key Software\$(var.Manufacturer)that will have all of our products if our customers have installed more than one (which is likely) I then want to have a secondary key for each of our products which get removed on uninstall but the main one does not. I have tried to achieve this like below but my main key gets deleted so all of my other products also get deleted from the registry. I know this is trivial but I cannot find an answer. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="*" MultiInstance="yes" Permanent="yes"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="*" MultiInstance="yes" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" Action="createAndRemoveOnUninstall"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef> EDIT: I have got my registry keys to stay using the following code. However they only all delete wen all products are deleted, not one by one as they need to. <DirectoryRef Id="TARGETDIR"> <Component Id="Registry" Guid="FF75CA48-27DE-430E-B78F-A1DC9468D699" Permanent="yes" Shared="yes" Win64="$(var.Win64)"> <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)" ForceCreateOnInstall="yes"> <RegistryValue Type="string" Name="Default" Value="true" KeyPath="yes"/> </RegistryKey> </Component> </DirectoryRef> <DirectoryRef Id="TARGETDIR"> <Component Id="RegistryEntries" Guid="D94FA576-970F-4503-B6C6-BA6FBEF8A60A" Win64="$(var.Win64)" > <RegistryKey Root="HKLM" Key="Software\$(var.Manufacturer)\[PRODUCTNAME]" ForceDeleteOnUninstall="yes"> <RegistryValue Type="string" Name="Installed" Value="true" KeyPath="yes"/> <RegistryValue Type="string" Name="ProductName" Value="[PRODUCTNAME]"/> </RegistryKey> </Component> </DirectoryRef>

  Read the article

• Ruby: Parse, replace, and evaluate a string formula

  - by Swartz

  I'm creating a simple Ruby on Rails survey application for a friend's psychological survey project. So we have surveys, each survey has a bunch of questions, and each question has one of the options participants can choose from. Nothing exciting. One of the interesting aspects is that each answer option has a score value associated with it. And so for each survey a total score needs to be calculated based on these values. Now my idea is instead of hard-coding calculations is to allow user add a formula by which the total survey score will be calculated. Example formulas: "Q1 + Q2 + Q3" "(Q1 + Q2 + Q3) / 3" "(10 - Q1) + Q2 + (Q3 * 2)" So just basic math (with some extra parenthesis for clarity). The idea is to keep the formulas very simple such that anyone with basic math can enter them without resolving to some fancy syntax. My idea is to take any given formula and replace placeholders such as Q1, Q2, etc with the score values based on what the participant chooses. And then eval() the newly formed string. Something like this: f = "(Q1 + Q2 + Q3) / 2" # some crazy formula for this survey values = {:Q1 => 1, :Q2 => 2, :Q3 => 2} # values for substitution result = f.gsub(/(Q\d+)/) {|m| values[$1.to_sym] } # string to be eval()-ed eval(result) So my questions are: Is there a better way to do this? I'm open to any suggestions. How to handle formulas where not all placeholders were successfully replaced (e.g. one question wasn't answered)? Ex: {:Q3 = 2} wasn't in values hash? My idea is to rescue eval()... any thoughts? How to get proper result? Should be 2.5, but due to integer arithmetic, it will truncate to 2. I can't expect people who provide the correct formula (e.g. / 2.0 ) to understand this nuance. I do not expect this, but how to best protect eval() from abuse (e.g. bad formula, manipulated values coming in)? Thank you!

  Read the article

• Mysql select - improve performances

  - by realshadow

  Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

  Read the article

• how to develop a program to minimize errors in human transcription of hand written surveys

  - by Alex. S.

  I need to develop custom software to do surveys. Questions may be of multiple choice, or free text in a very few cases. I was asked to design a subsystem to check if there is any error in the manual data entry for the multiple choices part. We're trying to speed up the user data entry process and to minimize human input differences between digital forms and the original questionnaires. The surveys are filled with handwritten marks and text by human interviewers, so it's possible to find hard to read marks, or also the user could accidentally select a different value in some question, and we would like to avoid that. The software must include some automatic control to detect possible typing differences. Each answer of the multiple choice questions has the same probability of being selected. This question has two parts: The GUI. The most simple thing I have in mind is to implement the most usable design of the questions display: use of large and readable fonts and space generously the choices. Is there something else? For faster input, I would like to use drop down lists (favoring keyboard over mouse). Given the questions are grouped in sections, I would like to show the answers selected for the questions of that section, but this could slow down the process. Any other ideas? The error checking subsystem. What else can I do to minimize or to check human typos in the multiple choice questions? Is this a solvable problem? is there some statistical methodology to check values that were entered by the users are the same from the hand filled forms? For example, let's suppose the survey has 5 questions, and each has 4 options. Let's say I have n survey forms filled in paper by interviewers, and they're ready to be entered in the software, then how to minimize the accidental differences that can have the manual transcription of the n surveys, without having to double check everything in the 5 questions of the n surveys? My first suggestion is that at the end of the processing of all the hand filled forms, the software could choose some forms randomly to make a double check of the responses in a few instances, but on what criteria can I make this selection? This validation would be enough to cover everything in a significant way? The actual survey is nation level and it has 56 pages with over 200 questions in total, so it will be a lot of hand written pages by many people, and the intention is to reduce the likelihood of errors and to optimize speed in the data entry process. The surveys must filled in paper first, given the complications of taking laptops or handhelds with the interviewers.

  Read the article

• Which network protocol to use for lightweight notification of remote apps?

  - by Chris Thornton

  I have this situation.... Client-initiated SOAP 1.1 communication between one server and let's say, tens of thousands of clients. Clients are external, coming in through our firewall, authenticated by certificate, https, etc.. They can be anywhere, and usually have their own firewalls, NAT routers, etc... They're truely external, not just remote corporate offices. They could be in a corporate/campus network, DSL/Cable, even Dialup. Client uses Delphi (2005 + SOAP fixes from 2007), and the server is C#, but from an architecture/design standpoint, that shouldn't matter. Currently, clients push new data to the server and pull new data from the server on 15-minute polling loop. The server currently does not push data - the client hits the "messagecount" method, to see if there is new data to pull. If 0, it sleeps for another 15 min and checks again. We're trying to get that down to 7 seconds. If this were an internal app, with one or just a few dozen clients, we'd write a cilent "listener" soap service, and would push data to it. But since they're external, sit behind their own firewalls, and sometimes private networks behind NAT routers, this is not practical. So we're left with polling on a much quicker loop. 10K clients, each checking their messagecount every 10 seconds, is going to be 1000/sec messages that will mostly just waste bandwidth, server, firewall, and authenticator resources. So I'm trying to design something better than what would amount to a self-inflicted DoS attack. I don't think it's practical to have the server send soap messages to the client (push) as this would require too much configuration at the client end. But I think there are alternatives that I don't know about. Such as: 1) Is there a way for the client to make a request for GetMessageCount() via Soap 1.1, and get the response, and then perhaps, "stay on the line" for perhaps 5-10 minutes to get additional responses in case new data arrives? i.e the server says "0", then a minute later in response to some SQL trigger (the server is C# on Sql Server, btw), knows that this client is still "on the line" and sends the updated message count of "5"? 2) Is there some other protocol that we could use to "ping" the client, using information gathered from their last GetMessageCount() request? 3) I don't even know. I guess I'm looking for some magic protocol where the client can send a GetMessageCount() request, which would include info for "oh by the way, in case the answer changes in the next hour, ping me at this address...". Also, I'm assuming that any of these "keep the line open" schemes would seriously impact the server sizing, as it would need to keep many thousands of connections open, simultaneously. That would likely impact the firewalls too, I think. Is there anything out there like that? Or am I pretty much stuck with polling? TIA, Chris

  Read the article

• SQL Server architecture guidance

  - by Liam

  Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

  Read the article

• How to override loading a TImage from the object inspector (at run-time)?

  - by Mawg

  Further to my previous question, which did not get a useful answer despite a bounty, I will try rephrasing the question. Basically, when the user clicks the ellipsis in the object inspector, Delphi opens a file/open dialog. I want to replace this handling with my own, so that I can save the image's path. I would have expected that all I need to do is to derive a class from TImage and override the Assign() function, as in the following code. However, when I do the assign function is never called. So, it looks like I need to override something else, but what? unit my_Image; interface uses Classes, ExtCtrls, Jpeg, Graphics; type Tmy_Image = class(Timage) private FPicture : TPicture; protected procedure OnChange(Sender: TObject); public { Public declarations } Constructor Create(AOwner: TComponent); override; procedure SetPicture(picture : TPicture); procedure Assign(Source: TPersistent); override; published { Published declarations - available in the Object Inspector at design-time } property Picture : TPicture read FPicture write SetPicture; end; // of class Tmy_Image() procedure Register; implementation uses Controls, Dialogs; procedure Register; begin RegisterComponents('Standard', [Tmy_Image]); end; Constructor Tmy_Image.Create(AOwner: TComponent); begin inherited; // Call the parent Create method Hint := 'Add an image from a file|Add an image from a file'; // Tooltip | status bar text AutoSize := True; // Control resizes when contents change (new image is loaded) Height := 104; Width := 104; FPicture := TPicture.Create(); self.Picture.Bitmap.LoadFromResourceName(hInstance, 'picture_poperty_bmp'); end; procedure Tmy_Image.OnChange(Sender: TObject); begin Constraints.MaxHeight := Picture.Height; Constraints.MaxWidth := Picture.Width; Self.Height := Picture.Height; Self.Width := Picture.Width; end; procedure Tmy_Image.SetPicture(picture : TPicture); begin MessageDlg('Tmy_Image.SetPicture', mtWarning, [mbOK], 0); // never called end; procedure Tmy_Image.Assign(Source: TPersistent); begin MessageDlg('Tmy_Image.Assign', mtWarning, [mbOK], 0); // never called end; end.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• How to refresh a fragment in a viewpager?

  - by aut_silvia

  I know there are already some questions to this problem. But I am really new in Android and ecspecially to Fragments and Viewpager. Pls have passion with me. I didn't found a answer which fits to my code. I dont know how to refresh a fragment or reload it when it's "active" again. TabsPagerAdapter.java: public class TabsPagerAdapter extends FragmentPagerAdapter{ public TabsPagerAdapter(FragmentManager fm){ super(fm); } @Override public Fragment getItem(int index) { switch (index) { case 0: return new KFZFragment(); case 1: return new LogFragment(); case 2: return new TrackFragment(); } return null; } @Override public int getCount() { // get item count - equal to number of tabs return 3; } } I have this 3 Fragments (KFZFragment,LogFragment,TrackFragment) and on the TrackFragment I calculate some data and this data should be display in a ListView in LogFragment. But when I change to LogFragment it's not the latest data. So it doesnt refresh. Now how should I modify my code to refresh the fragments when it's "active"? MainActivityFragment.java: public class MainActivityFragment extends FragmentActivity implements ActionBar.TabListener{ private ViewPager viewPager; private TabsPagerAdapter mAdapter; private ActionBar actionBar; List<Fragment> fragments; private String[] tabs = { "KFZ", "Fahrten Log", "Kosten Track" }; @Override protected void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.activity_main_fragment); // Initilization viewPager = (ViewPager) findViewById(R.id.pager); actionBar = getActionBar(); mAdapter = new TabsPagerAdapter(getSupportFragmentManager()); fragments = new Vector<Fragment>(); fragments.add(Fragment.instantiate(this, KFZFragment.class.getName(),savedInstanceState)); fragments.add(Fragment.instantiate(this, LogFragment.class.getName(),savedInstanceState)); viewPager.setAdapter(mAdapter); actionBar.setHomeButtonEnabled(false); actionBar.setNavigationMode(ActionBar.NAVIGATION_MODE_TABS); // Adding Tabs for (String tab_name : tabs) { actionBar.addTab(actionBar.newTab().setText(tab_name) .setTabListener(this)); } viewPager.setOnPageChangeListener(new ViewPager.OnPageChangeListener() { @Override public void onPageSelected(int position) { // on changing the page // make respected tab selected actionBar.setSelectedNavigationItem(position); } @Override public void onPageScrolled(int arg0, float arg1, int arg2) { } @Override public void onPageScrollStateChanged(int arg0) { } }); } @Override public void onTabReselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public void onTabSelected(Tab tab, FragmentTransaction ft) { viewPager.setCurrentItem(tab.getPosition()); } @Override public void onTabUnselected(Tab tab, FragmentTransaction ft) { // TODO Auto-generated method stub } @Override public boolean onKeyDown(int keyCode, KeyEvent event) { if (keyCode == KeyEvent.KEYCODE_BACK) { } return super.onKeyDown(keyCode, event); } } Pls help me out.

  Read the article

• Good design of mapping Java Domain objects to Tables (using Hibernate)

  - by M. McKenzie

  Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

  Read the article

• Truth tables in code? How to structure state machine?

  - by HanClinto

  I have a (somewhat) large truth table / state machine that I need to implement in my code (embedded C). I anticipate the behavior specification of this state machine to change in the future, and so I'd like to keep this easily modifiable in the future. My truth table has 4 inputs and 4 outputs. I have it all in an Excel spreadsheet, and if I could just paste that into my code with a little formatting, that would be ideal. I was thinking I would like to access my truth table like so: u8 newState[] = decisionTable[input1][input2][input3][input4]; And then I could access the output values with: setOutputPin( LINE_0, newState[0] ); setOutputPin( LINE_1, newState[1] ); setOutputPin( LINE_2, newState[2] ); setOutputPin( LINE_3, newState[3] ); But in order to get that, it looks like I would have to do a fairly confusing table like so: static u8 decisionTable[][][][][] = {{{{ 0, 0, 0, 0 }, { 0, 0, 0, 0 }}, {{ 0, 0, 0, 0 }, { 0, 0, 0, 0 }}}, {{{ 0, 0, 1, 1 }, { 0, 1, 1, 1 }}, {{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}}}, {{{{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}, {{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}}, {{{ 0, 1, 1, 1 }, { 0, 1, 1, 1 }}, {{ 0, 1, 0, 1 }, { 1, 1, 1, 1 }}}}; Those nested brackets can be somewhat confusing -- does anyone have a better idea for how I can keep a pretty looking table in my code? Thanks! Edit based on HUAGHAGUAH's answer: Using an amalgamation of everyone's input (thanks -- I wish I could "accept" 3 or 4 of these answers), I think I'm going to try it as a two dimensional array. I'll index into my array using a small bit-shifting macro: #define SM_INPUTS( in0, in1, in2, in3 ) ((in0 << 0) | (in1 << 1) | (in2 << 2) | (in3 << 3)) And that will let my truth table array look like this: static u8 decisionTable[][] = { { 0, 0, 0, 0 }, { 0, 0, 0, 0 }, { 0, 0, 0, 0 }, { 0, 0, 0, 0 }, { 0, 0, 1, 1 }, { 0, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }, { 0, 1, 1, 1 }, { 0, 1, 1, 1 }, { 0, 1, 0, 1 }, { 1, 1, 1, 1 }}; And I can then access my truth table like so: decisionTable[ SM_INPUTS( line1, line2, line3, line4 ) ] I'll give that a shot and see how it works out. I'll also be replacing the 0's and 1's with more helpful #defines that express what each state means, along with /**/ comments that explain the inputs for each line of outputs. Thanks for the help, everyone!

  Read the article

• How to handle very frequent updates to a Lucene index

  - by fsm

  I am trying to prototype an indexing/search application which uses very volatile indexing data sources (forums, social networks etc), here are some of the performance requirements, Very fast turn-around time (by this I mean that any new data (such as a new message on a forum) should be available in the search results very soon (less than a minute)) I need to discard old documents on a fairly regular basis to ensure that the search results are not dated. Last but not least, the search application needs to be responsive. (latency on the order of 100 milliseconds, and should support at least 10 qps) All of the requirements I have currently can be met w/o using Lucene (and that would let me satisfy all 1,2 and 3), but I am anticipating other requirements in the future (like search relevance etc) which Lucene makes easier to implement. However, since Lucene is designed for use cases far more complex than the one I'm currently working on, I'm having a hard time satisfying my performance requirements. Here are some questions, a. I read that the optimize() method in the IndexWriter class is expensive, and should not be used by applications that do frequent updates, what are the alternatives? b. In order to do incremental updates, I need to keep committing new data, and also keep refreshing the index reader to make sure it has the new data available. These are going to affect 1 and 3 above. Should I try duplicate indices? What are some common approaches to solving this problem? c. I know that Lucene provides a delete method, which lets you delete all documents that match a certain query, in my case, I need to delete all documents which are older than a certain age, now one option is to add a date field to every document and use that to delete documents later. Is it possible to do range queries on document ids (I can create my own id field since I think that the one created by lucene keeps changing) to delete documents? Is it any faster than comparing dates represented as strings? I know these are very open questions, so I am not looking for a detailed answer, I will try to treat all of your answers as suggestions and use them to inform my design. Thanks! Please let me know if you need any other information.

  Read the article

• Inbreeding-immune database structure

  - by Nick Savage

  I have an application that requires a "simple" family tree. I would like to be able to perform queries that will give me data for an entire family given one id from a member in the family. I say simple because it does not need to take into account adoption or any other obscurities. The requirements for the application are as follows: Any two people will not be able to breed if they're from the same genetic line Needs to allow for the addition of new family lines (new people with no previous family) Need to be able to pull siblings, parents separately through queries I'm having trouble coming up with the proper structure for the database. So far I've come up with two solutions but they're not very reliable and will probably get out of hand quite quickly. Solution 1 involves placing a family_ids field on the people table and storing a list of unique family ids. Each time two people breed the lists are checked against each other to make sure no ids match and if everything checks out will merge the two lists and set that as the child's family_ids field. Example: Father (family_ids: (null)) breeds with Mother (family_ids: (213, 519)) -> Child (family_ids: (213, 519)) breeds with Random Person (family_ids: (813, 712, 122, 767)) -> Grandchild (family_ids: (213, 519, 813, 712, 122, 767)) And so on and so forth... The problem I see with this is the lists becoming unreasonably large as time goes on. Solution 2 uses cakephp's associations to declare: public $belongsTo = array( 'Father' => array( 'className' => 'User', 'foreignKey' => 'father_id' ), 'Mother' => array( 'className' => 'User', 'foreignKey' => 'mother_id' ) ); Now setting recursive to 2 will fetch the results of the mother and father, along with their mother and father, and so on and so forth all the way down the line. The problem with this route is that the data is in nested arrays and I'm unsure of how to efficiently work through the code. If anyone would be able to steer me in the direction of the most efficient way to handle what I want to achieve that would be tremendously helpful. Any and all help is greatly appreciated and I'll gladly answer any questions anyone has. Thanks a lot.

  Read the article

• MySQL - Calculating fields on the fly vs storing calculated data

  - by Christian Varga

  Hi Everyone, I apologise if this has been asked before, but I can't seem to find an answer to a question that I have about calculating on the fly vs storing fields in a database. I read a few articles that suggested it was preferable to calculate when you can, but I would just like to know if that still applies to the following 2 examples. Example 1. Say you are storing data relating to a car. You store the fuel tank size in litres, and how many litres it uses per 100km. You also want to know how many KMs it can travel, which can be calculated from the tank size and economy. I see 2 ways of doing this: When a car is added or updated, calculate the amount of KMs and store this as a static field in the database. Every time a car is accessed, calculate the amount of KMs on the fly. Because the cars economy/tank size doesn't change (although it could be edited), the KMs is a pretty static value. I don't see why we would calculate it every single time the car is accessed. Wouldn't this waste cpu time as opposed to simply storing it in a separate field in the database and calculating only when a car is added or updated? My next example, which is almost an entirely different question (but on the same topic), relates to counting children. Let's say we have a app which has categories and items. We have a view where we display all the categories, and a count of all the items inside each category. Again, I'm wondering what's better. To perform a MySQL query to count all the items in each category every single time the page is accessed? Or store the count in a field in the categories table and update when an item is added / deleted? I know it is redundant to store anything that can be calculated, but I worry that calculating fields or counting records might be slow as opposed to storing the data in a field. If it's not then please let me know, I just want to learn about when to use either method. On a small scale I guess it wouldn't matter either way, but apps like Facebook, would they really count the amount of friends you have every time someone views your profile or would they just store it as a field? I'd appreciate any responses to both of these scenarios, and any resource that might explain the benefits of calculating vs storing. Thanks in advance, Christian

  Read the article

< Previous Page | 480 481 482 483 484 485 486 487 488 489 490 491  | Next Page >