Search Results

Search found 46143 results on 1846 pages for 'input method'.

Page 552/1846 | < Previous Page | 548 549 550 551 552 553 554 555 556 557 558 559  | Next Page >

  • <button type="submit"> compatibility?

    - by Mark
    I'd like to have a submit button that submits a different value than is displayed on the button. With <input type="submit"> you can't seem to do this. With <button type="submit"> however, these can be two different values. The question is, will it work in all browsers? Trying this test code here: <form method="get" action=""> <input type="text" name="txt"/> <button type="submit" name="btn" value="val">text</button> </form> In FF 3.6 it updates my address bar with both values appropriately (and responds to me pressing enter in the text box). In IE 8, it also accepts pressing enter, displays the text value in the address bar, but it show the button's value as a GET param at all... does that mean it's not submitting it?

    Read the article

  • Why does the compiler complain "while expected" when I try to add more code?

    - by user1893578
    Write a program with a word containing @ character as an input. If the word doesn't contain @, it should prompt the user for a word with @. Once a word with @ is read, it should output the word then terminate. This is what I have done so far: public class find { public static void main(String[] args) { System.out.println(" Please enter a word with @ "); Scanner scan = new Scanner(System.in); String bad = "@"; String word = scan.next(); do if (!word.contains(bad)) System.out.println(" Please try again "); else System.out.println(" " + word); while (!word.contains(bad)); } } I can get it to terminate after a word containing "@" is given as input, but if I try to add a Scanner to the line after "please try again", it says while expected.

    Read the article

  • Using php to create a password system with chinese characters

    - by WillDonohoe
    Hi guys, I'm having an issue with validating chinese characters against other chinese characters, for example I'm creating a simple password script which gets data from a database, and gets the user input through get. The issue I'm having is for some reason, even though the characters look exactly the same when you echo them out, my if statement still thinks they are different. I have tried using the htmlentities() function to encode the characters, the password from the database encodes nicely, giving me a working '& #35441;' (I've put a space in it to stop it from converting to a chinese character!). The other user input value gives me a load of funny characters. The only thing which I believe must be breaking it, is it encodes in a different way and therefore the php thinks it's 2 completely different strings. Does anybody have any ideas? Thanks in advance, Will

    Read the article

  • IIS7 URL Redirect with Regex

    - by andyjv
    I'm preparing for a major overhaul of our shopping cart, which is going to completely change how the urls are structured. For what its worth, this is for Magento 1.7. An example URL would be: {domain}/item/sub-domain/sub-sub-domain-5-16-7-16-/8083770?plpver=98&categid=1027&prodid=8090&origin=keyword and redirect it to {domain}/catalogsearch/result/?q=8083710 My web.config is: <?xml version="1.0" encoding="UTF-8"?> <configuration> <system.webServer> <rewrite> <rules> <rule name="Magento Required" stopProcessing="false"> <match url=".*" ignoreCase="false" /> <conditions> <add input="{URL}" pattern="^/(media|skin|js)/" ignoreCase="false" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Item Redirect" stopProcessing="true"> <match url="^item/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)/([_\-a-zA-Z0-9]+)(\?.*)" /> <action type="Redirect" url="catalogsearch/result/?q={R:3}" appendQueryString="true" redirectType="Permanent" /> <conditions trackAllCaptures="true"> </conditions> </rule> </rules> </rewrite> <httpProtocol allowKeepAlive="false" /> <caching enabled="false" /> <urlCompression doDynamicCompression="true" /> </system.webServer> </configuration> Right now it seems the redirect is completely ignored, even though in the IIS GUI the sample url passes the regex test. Is there a better way to redirect or is there something wrong with my web.config?

    Read the article

  • Writing out to a file in scheme

    - by Ceelos
    The goal of this is to check if the character taken into account is a number or operand and then output it into a list which will be written out to a txt file. I'm wondering which process would be more efficient, whether to do it as I stated above (writing it to a list and then writing that list out into a file) or being writing out into a txt file right from the procedure. I'm new with scheme so I apologize if I am not using the correct terminology (define input '("3" "+" "4")) (define check (if (number? (car input)) (write this out to a list or directly to a file) (check the rest of file))) Another question I had in mind, how can I make it so that the check process is recursive? I know it's a lot of asking but I've getting a little frustrated with checking out the methods that I have found on other sites. I really appreciate the help!

    Read the article

  • jQuery/Javascript problem with IE

    - by Shadyn
    I have two radio buttons each with a unique ID. When one is clicked, I would like to add $10 to a total. When the other is clicked, we go back to the original total price. My jquery looks like this: function check_ceu() { var price = <%= conference_price %>; if($('#ceu_yes').is(':checked')){ $('#total').val(parseFloat(price) + 10) } else{ $('#total').val(price) } } I have this function bound to document.ready (for page refreshes) and also the onchange handler of the radio buttons. In FF and Chrome this works fine. In IE, when the radio button with ID of "ceu_yes" is checked nothing happens, then when clicking back to the other radio button, 10 is added. So in essence, IE has the checkbox functionality reversed. Below is my code for the buttons: <input type="radio" name="ceu" id="ceu_yes" value="1" onchange="check_ceu()" /> $10 <input type="radio" name="ceu" id="ceu_no" value="0" checked="checked" onchange="check_ceu()" /> No, thank you Any ideas on this?

    Read the article

  • Javascript Function wont submit form..

    - by Josh K
    Here is my function: function processCheck() { var numberClicked = 0; var frm = document.getElementById('form'); for (var i=0; i<form.elements.length; i++) { if (frm.elements[i].checked) numberClicked++; } if(numberClicked != 8) alert('Must choose 8 Teams'); else frm.submit(); } My forms name is 'form', here is my input: echo "<input type='button' name='submit' value='Update' onclick='processCheck()' />"; When i click the button and there is anything but 8 boxes selected it displays the alert, if there is 8 boxes it does nothing (<-- The problem). I have the form action set to another page.

    Read the article

  • Firefox Back Button is occaisionally breaking the back button.

    - by Webjedi
    Having a really frustrating time with Firefox and the back button...given this simple ASP form: <head> <title>Form 1</title> </head> <body> <form action="form2.asp" method="post"> Enter some text:<input type="text" name="thetext" id="thetext"> <input type="submit" id="submit" name="submit"> </form> </body> </html> Firefox (3.6.3) will occasionally clear the value of the text box after hitting submit and then the back button. It's unpredictable when it will strike. And it will work for dozens to hundreds of times, and then all of a sudden it stops working. Any ideas where I should start?

    Read the article

  • Form POST or sessions?

    - by eddienotizzard
    If you have an item where you allow users to add comments, how can you pass which item the user is replying too? I've though of using a hidden field in a form, however this can be easily changed using plugins such as firebug: <form method="post" action="blah"> <input type="hidden" name="item_id" value="<?php echo $item_id; ?>"> <!-- other form data here --> <input type="submit" name="submit"> </form> Or just simply using a session: $_SESSION['item_id'] = $item_id Is there a safe way to send the item data in a form?

    Read the article

  • How do I do Textbox Submit

    - by Newb
    Hello everyone, I have a search box and a buttion. currently a user enter some text and press the search button. But I want to add another feature that instead of clicking the search button people can hit enter to search. How can I do that? Here is my code sample: <form method="post" action=""> <input id="search" name="search" type="text" /> <input id="search_btn" name="search_btn" type="submit" /> </form> Thanks in advance

    Read the article

  • javascript - Google Chrome cluttering Array generated from .split()

    - by patrick
    Given the following string: var str = "one,two,three"; If I split the string on the commas, I normally get an array, as expected: var arr = str.split(/\s*,\s*/); Trouble is that in Google Chrome (for Mac), it appends extra properties to the array. Output from Chrome's debugger: arr: Array 0: one 1: two 2: three constructor: function Array() index: undefined input: undefined length: 3 So if I iterate over the array with a for/in loop, it iterates over the new properties. Specifically the input and index properties. Using hasOwnProperty doesn't seem to help. A fix would be to do a for loop based on the length of the Array. Still I'm wondering if anyone has insight into why Chrome behaves this way. Firefox and Safari don't have this issue.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • preg_replace replacing with array

    - by Scott
    What I want to do is replace the "[replace]" in input string with the corresponding vaule in the replace array. The total number of values will change but there will always be the same number in the replace array as in input string. I have tried doing this with preg_replace and preg_replace_callback but I can't get the pattern right for [replace], I also tried using vsprintf but the % in <table width="100%"> was messing it up. All help is greatly appreciated! Replace Array: $array = array('value 1','value 2','value 3'); Input String $string = ' <table width="100%"> <tr> <td>Name:</td> <td>[replace]</td> </tr> <tr> <td>Date:</td> <td>[replace]</td> </tr> <tr> <td>Info:</td> <td>[replace]</td> </tr> </table> '; Desired Result <table width="100%"> <tr> <td>Name:</td> <td>value 1</td> </tr> <tr> <td>Date:</td> <td>value 2</td> </tr> <tr> <td>Info:</td> <td>value 3</td> </tr> </table>

    Read the article

  • HTML5 Video Javascript

    - by user373721
    Hi, I am not experienced in Javascript, I have the following script to play video files on Andriod phone, and it works fine. <script type="text/javascript"> function PlayMyVideo(arg) { var myVideo = document.getElementById([arg]); myVideo.play(); } </script> <video id="what" src="what.mp4" poster="" /> <input type="button" onclick="PlayMyVideo('what')" value="Play" /> I am trying to write the tag on the fly: <script type="text/javascript"> function PlayVideo() { new_video = document.createElement('video'); new_video.setAttribute('scr', 'what.mp4'); new_video.play(); } </script> <input type="button" onclick="PlayVideo()" value="Play2" /> Nothing happen, would appreciate your suggestions. Thanks in advance

    Read the article

  • move text from one div to another with javascript or mootools

    - by Ke
    Hi, I have two divs. I would like to move/populate the text from div id one to div id two using an onclick event. I am wondering how to do this? and also whether mootools can be used to accomplish the task or whether simple javascript is only necessary? <div id='one'> <ul> <input type="checkbox" onclick = "my_function()"/> <li>some text 1</li> <input type="checkbox" onclick = "my_function()"/> <li>some text 2</li> </ul> <div> <div id='two'> <div> Cheers in advance for any helps. Bangin my head against a brick wall here, because my javascript skillz are limited! Ke

    Read the article

  • finding the value of radio button with jquery

    - by oo
    i have this code below to show different divs when i choose certain radio buttons: if ($("input[@name='exerciseRB']:checked").val() == 'New') { $("#newExercise").show(); $("#existingExercise").hide(); } else { $("#newExercise").hide(); $("#existingExercise").show(); } at first, i just had two radio buttons (both named exerciseRB and everything works fine. Now, later in my web page i added two new radio buttons (with the name lessonRB). The issue is that once i added these other new radio buttons when i look up this in firebug: $("input[@name='exerciseRB']:checked") i actually get an array back with both the exerciseRB item as well as the lessonRB item. Its almost as if the @name='exerciseRB' is being ignored. any ideas here?

    Read the article

  • Confused on the basics of AJAX

    - by Doug
    So right now, I'm just using a basic form to check a password. I want it to check the password and basically remain on page.html so I can use JavaScript to alert incorrect password or something. I'm not really sure how to do that. It seems it would bring me to check.php. I'm not too sure on the whole process, any help appreciated! Thanks! Page.html <form action="check.php" method="post"> <input type="password" name="password" /> <input type="submit" value="Submit" /> </form> check.php <?php $password = $_POST['password']; if ( $password != "testing" ) { die(); } ?>

    Read the article

  • Shell Sort problem

    - by user191603
    Show the result of running Shell Sort on the input 9,8,7,6,5,4,3,2,1 using increments { 1,3,7 }. I have done this part. the result is: 9 8 7 6 5 4 3 2 1 (original) 2 1 7 6 5 4 3 9 8 ( 7-sort ) 2 1 4 3 5 7 6 9 8 ( 3-sort ) 1 2 3 4 5 6 7 8 9 ( 1-sort ) Then the question requires me to determine the running time of Shell Sort using Shell's increments of N/2, N/4, ..., 1 for sorted input. I am not quite sure how to answer the second question as I don't understand the requirement of this question. So, would anyone give some hints to let me finish this question? Thank you for your help first!

    Read the article

  • VC++ - Asynchronous Thread

    - by JVNR
    I am working on VC++ project, in that my application process a file from input path and generates 3 output "*.DAT" files in the destination path. I will FTP these DAT file to the destination server. After FTP, I need to delete only two output .DAT files the folder. I am able to delete those files, because there one Asynchronous thread running behind the process. Since the thread is running, while deleting it says, "Cannot delete, the file is used by another person". I need to stop that thread and delete the files. Multiple files can also be taken from the input path to process. Please help me in resolving this issue. Its very high priority issue for me. Please help me ASAP.

    Read the article

  • JavaScript not working with Chrome & Xampp!

    - by Anonymous
    Hi, I've been trying for a couple hours now to figure out why JavaScript wouldn't work. The code works, but here it is anyway. <script type="text/javascript"> function change(text) { document.f1.ta.value="Hi!"; } </script> <form name="f1"> <input type="textarea" id="ta"/> <input type="button" action='change("Hi!")'/> </form> When I click the button, it does nothing. When I write "document.f1.ta.value="Hi!";" in the Chrome's inspector console, it works. I am using XAMPP (for Windows) 1.7.3 Windows 7 Ultimate.

    Read the article

  • PHP setcookie warning

    - by Ranking
    Hello guys, I have a problem with 'setcookie' in PHP and I can't solve it. so I receive this error "Warning: Cannot modify header information - headers already sent by (output started at C:\Program Files\VertrigoServ\www\vote.php:14) in C:\Program Files\VertrigoServ\www\vote.php on line 86" and here is the file.. line 86 is setcookie ($cookie_name, 1, time()+86400, '/', '', 0); is there any other way to do this ?? <html> <head> <title>Ranking</title> <link href="style.css" rel="stylesheet" type="text/css"> </head> <body bgcolor="#EEF0FF"> <div align="center"> <br/> <div align="center"><div id="header"></div></div> <br/> <table width="800" border="0" align="center" cellpadding="5" cellspacing="0" class="mid-table"> <tr><td height="5"> <center> <table border="0" cellpadding="0" cellspacing="0" align="center" style="padding-top:5px;"> <tr> <td align="center" valign="top"><img src="images/ads/top_banner.png"></td> </tr> </table> </center> </td></tr> <tr><td height="5"></td></tr> </table> <br/> <?php include "conf.php"; $id = $_GET['id']; if (!isset($_POST['submitted'])) { if (isset($_GET['id']) && is_numeric($_GET['id'])) { $id = mysql_real_escape_string($_GET['id']); $query = mysql_query("SELECT SQL_CACHE id, name FROM s_servers WHERE id = $id"); $row = mysql_fetch_assoc($query); ?> <form action="" method="POST"> <table width="800" height="106" border="0" align="center" cellpadding="3" cellspacing="0" class="mid-table"> <tr><td><div align="center"> <p>Code: <input type="text" name="kod" class="port" /><img src="img.php" id="captcha2" alt="" /><a href="javascript:void(0);" onclick="document.getElementById('captcha2').src = document.getElementById('captcha2').src + '?' + (new Date()).getMilliseconds()">Refresh</a></p><br /> <p><input type="submit" class="vote-button" name="vote" value="Vote for <?php echo $row['name']; ?>" /></p> <input type="hidden" name="submitted" value="TRUE" /> <input type="hidden" name="id" value="<?php echo $row['id']; ?>" /> </div></td></tr> <tr><td align="center" valign="top"><img src="images/ads/top_banner.png"></td></tr> </table> </form> <?php } else { echo '<font color="red">You must select a valid server to vote for it!</font>'; } } else { $kod=$_POST['kod']; if($kod!=$_COOKIE[imgcodepage]) { echo "The code does not match"; } else { $id = mysql_real_escape_string($_POST['id']); $query = "SELECT SQL_CACHE id, votes FROM s_servers WHERE id = $id"; $result = mysql_query($query) OR die(mysql_error()); $row = mysql_fetch_array($result, MYSQL_ASSOC); $votes = $row['votes']; $id = $row['id']; $cookie_name = 'vote_'.$id; $ip = $_SERVER['REMOTE_ADDR']; $ltime = mysql_fetch_assoc(mysql_query("SELECT SQL_CACHE `time` FROM `s_votes` WHERE `sid`='$id' AND `ip`='$ip'")); $ltime = $ltime['time'] + 86400; $time = time(); if (isset($_COOKIE['vote_'.$id]) OR $ltime > $time) { echo 'You have already voted in last 24 hours! Your vote is not recorded.'; } else { $votes++; $query = "UPDATE s_servers SET votes = $votes WHERE id = $id"; $time = time(); $query2 = mysql_query("INSERT INTO `s_votes` (`ip`, `time`, `sid`) VALUES ('$ip', '$time', '$id')"); $result = mysql_query($query) OR die(mysql_error()); setcookie ($cookie_name, 1, time()+86400, '/', '', 0); } } } ?> <p><a href="index.php">[Click here if you don't want to vote]</a></p><br/> <p><a href="index.php">Ranking.net</a> &copy; 2010-2011<br> </p> </div> </body> </html> Thanks a lot!

    Read the article

  • Make a simulation using python

    - by user3727759
    I am new to programming and using python. What I am trying to do is create a simulation of a thermostat system by using python. Is there a way to create a program that I can input data, for example temperature and humidity values and then have python constantly plotting the data as I enter the values. This is to simulate a device gathering data and sending it to this program and having it being plotted. I have found ways to plot data by using matplotlib but I have not been able to find a way that I can input the data and have the plot upgrade constantly. Thanks any advise is appreciated.

    Read the article

  • Is it possible to block a certain character or group of characters from entering into text box or an

    - by Param-Ganak
    Hello friends! I have a text input field like text box or text area. I want to prevent the user from entering certain character or a group of characters. That is for example if I dont want # * @ and numbers from 0-9 these characters. So Whenever user press any of the above character key then that character should not appear in to an input field. It means directly blocking that character. Is this possible in Jquery? Please give me some guidelines to achive it. Thank You

    Read the article

  • Best use of Jquery sliders and PHP

    - by Coronier
    Hello there, I have two questions: What's the best way to send sliders' values to a PHP page ? I'm associating each slider (several per page) with an hidden form so far, but I wonder if there's a "cleaner" way to do this. Related to the 1st question; I've some trouble with the script: var score = $(this).slider( "option", "value" ); $(this).closest("input[type=='hidden']").val(score); It doesn't set the value of the hidden input. Can somebody tells me what's wrong ? Thanks

    Read the article

< Previous Page | 548 549 550 551 552 553 554 555 556 557 558 559  | Next Page >