Search Results

Search found 17754 results on 711 pages for 'field description'.

Page 661/711 | < Previous Page | 657 658 659 660 661 662 663 664 665 666 667 668  | Next Page >

  • ASP.NET MVC: How can I explain an invalid type violation to an end-user with Html.ValidationSummary?

    - by Terminal Frost
    Serious n00b warning here; please take mercy! So I finished the Nerd Dinner MVC Tutorial and I'm now in the process of converting a VB.NET application to ASP.NET MVC using the Nerd Dinner program as a sort of rough template. I am using the "IsValid / GetRuleViolations()" pattern to identify invalid user input or values that violate business rules. I am using LINQ to SQL and am taking advantage of the "OnValidate()" hook that allows me to run the validation and throw an application exception upon trying to save changes to the database via the CustomerRepository class. Anyway, everything works well, except that by the time the form values reach my validation method invalid types have already been converted to a default or existing value. (I have a "StreetNumber" property that is an integer, though I imagine this would be a problem for DateTime or any other non-strings as well.) Now, I am guessing that the UpdateModel() method throws an exception and then alters the value because the Html.ValidationMessage is displayed next to the StreetNumber field but my validation method never sees the original input. There are two problems with this: While the Html.ValidationMessage does signal that something is wrong, there is no corresponding entry in the Html.ValidationSummary. If I could even get the exception message to show up there indicating an invalid cast or something that would be better than nothing. My validation method which resides in my Customer partial class never sees the original user input so I do not know if the problem is a missing entry or an invalid type. I can't figure out how I can keep my validation logic nice and neat in one place and still get access to the form values. I could of course write some logic in the View that processes the user input, however that seems like the exact opposite of what I should be doing with MVC. Do I need a new validation pattern or is there some way to pass the original form values to my model class for processing? CustomerController Code // POST: /Customers/Edit/[id] [AcceptVerbs(HttpVerbs.Post)] public ActionResult Edit(int id, FormCollection formValues) { Customer customer = customerRepository.GetCustomer(id); try { UpdateModel(customer); customerRepository.Save(); return RedirectToAction("Details", new { id = customer.AccountID }); } catch { foreach (var issue in customer.GetRuleViolations()) ModelState.AddModelError(issue.PropertyName, issue.ErrorMessage); } return View(customer); }

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • jQuery function execute on Button Click and Enter/Return (key)

    - by Alvin Jones
    I'm trying to create a little search box that allows you to search Twitter based on the keyword you enter in the input field. While it's work, it only works if you press the Submit button. I would also like to be able to press the Enter or Return key to initiate the search. I've tried using the .sumbit function and wrapping my input around a form element with no success. Any insight would be greatly appreciate! Live example: http://tinyurl.com/84axyym <script src="http://ajax.googleapis.com/ajax/libs/jquery/1/jquery.min.js"></script> <script> $(document).ready(function(){ function(data) { $('#startSearch').click(function(){ $('#tweets .results').remove(); var searchTerm = 'http://search.twitter.com/search.json?q=' + $('#twitterSearch').val() + '&callback=?' $.getJSON(searchTerm, function(data) { $.each(data.results, function() { $('<div class="results"></div>') .hide() .append('<a class="userPicLink" href="http://twitter.com/' + this.from_user + '">' + '<img class="userImg" src="' + this.profile_image_url + '">' + '</a>') .append('<span class="userName">' + '<a href="http://twitter.com/' + this.from_user + '">' + this.from_user + '</span>') .append('<span class="userText">' + this.text + '</span>') .append('<time class="textTime">' + relTime(this.created_at) + '</time>') .appendTo('#tweets') .fadeIn(); }); }); </script> <body> <label id="searchLabel" for="twitterSearch">Search</label> <input type="search" list="searchSugg" id="twitterSearch" placeholder="css3 animation" required aria-required="true"> <input id="startSearch" type="submit"> <datalist id="searchSugg"> <option value="css3 mulitple backgrounds"> <option value="html5 video"> <option value="responsive web design"> <option value="twitter api"> </datalist> <div id="tweets"> </div> </body>

    Read the article

  • how to change color of text following function in javascript

    - by OVERTONE
    Ok before i make spaghetti of this code i thought id ask around here. ive made a quiz for an online site. The answers are stored in an array, and ive a function that checks the answers array to what youve clicked. then it counts them and gives you your score. but i want to change the clor of the right answer wen the user clicks the score button. so the correct answers are highlighted. something like this https://www.shutterpoint.com/Home-Quiz.cfm (just hit submit at the bottom, no need to do the quiz). the little answer icon at the side looks flashy but id rather just have the text change color. heres how my questions are formatted <p>Depth of field is controlled by :?</p> <p id = "question2"><input type="radio" name="question2" id="Answer1" value = "a" onClick ="recordAnswer(2,this.value)"/> The focal length of the lens. <br/> <input type="radio" name="question2" id="Answer2" value = "b" onClick = "recordAnswer(2,this.value)"/> The size of the aperture opening. <br/> <input type="radio" name="question2" id="Answer3" value = "c" onClick = "recordAnswer(2,this.value)"/> The distance between the camera and lens. <br/> <input type="radio" name="question2" id="Answer4" value = "d" onClick = "recordAnswer(2,this.value)"/> All of these. <br/></p> and these are the two functions that are called throughout. record answer is called every time the user clicks a button function recordAnswer(question,answer) { answers[question-1] = answer; } this is the final button which calculates the score function scoreQuiz() { var totalCorrect = 0; for(var count = 0; count<correctAnswers.length;count++) { if(answers[count]== correctAnswers[count]) totalCorrect++; } <!-- alert("You scored " + totalCorrect + " out of 12 correct!"); --> } another function is best i think. ive already made attemots at it and know i have to set the color using document.getElementById('question2').style.color = '#0000ff'; question2 being the p id i think if i take in the value part of (input type....) ill be able to compare it to the answers array. but im not quite sure how to do this. any helpers? maybe something like this document.getElementById("Answer1").style.color = '#0000ff'; using the id part of the (input type line) i think i got it actually. ill post my answer in a sec

    Read the article

  • asp:Button is not calling server-side function

    - by Richard Neil Ilagan
    Hi guys, I know that there has been much discussion here about this topic, but none of the threads I got across helped me solve this problem. I'm hoping that mine is somewhat unique, and may actually merit a different solution. I'm instantiating an asp:Button inside a data-bound asp:GridView through template fields. Some of the buttons are supposed to call a server-side function, but for some weird reason, it doesn't. All the buttons do when you click them is fire a postback to the current page, doing nothing, effectively just reloading the page. Below is a fragment of the code: <asp:GridView ID="gv" runat="server" AutoGenerateColumns="false" CssClass="l2 submissions" ShowHeader="false"> <Columns> <asp:TemplateField> <ItemTemplate><asp:Panel ID="swatchpanel" CssClass='<%# Bind("status") %>' runat="server"></asp:Panel></ItemTemplate> <ItemStyle Width="50px" CssClass="sw" /> </asp:TemplateField> <asp:BoundField DataField="description" ReadOnly="true"> </asp:BoundField> <asp:BoundField DataField="owner" ReadOnly="true"> <ItemStyle Font-Italic="true" /> </asp:BoundField> <asp:BoundField DataField="last-modified" ReadOnly="true"> <ItemStyle Width="100px" /> </asp:BoundField> <asp:TemplateField> <ItemTemplate> <asp:Button ID="viewBtn" cssclass='<%# Bind("sid") %>' runat="server" Text="View" OnClick="viewBtnClick" /> </ItemTemplate> </asp:TemplateField> </Columns> </asp:GridView> The viewBtn above should call the viewBtnClick() function on server-side. I do have that function defined, along with a proper signature (object,EventArgs). One thing that may be of note is that this code is actually inside an ASCX, which is loaded in another ASCX, finally loaded into an ASPX. Any help or insight into the matter will be SO appreciated. Thanks! (oh, and please don't mind my trashy HTML/CSS semantics - this is still in a very,very early stage :p)

    Read the article

  • NSSortDescriptor for NSFetchRequestController causes crash when value of sorted attribute is changed

    - by AJ
    I have an Core Data Entity with a number of attributes, which include amount(float), categoryTotal(float) and category(string) The initial ViewController uses a FethchedResultsController to retrieve the entities, and sorts them based on the category and then the categoryTotal. No problems so far. NSManagedObjectContext *moc = [self managedObjectContext]; NSEntityDescription *entityDescription = [NSEntityDescription entityForName:@"Transaction" inManagedObjectContext:moc]; NSFetchRequest *request = [[[NSFetchRequest alloc] init] autorelease]; [request setEntity:entityDescription]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"(dateStamp >= %@) AND (dateStamp =< %@)", startDate, endDate]; [request setPredicate:predicate]; NSSortDescriptor *sortByCategory = [[NSSortDescriptor alloc] initWithKey:@"category" ascending:sortOrder]; NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; NSArray *sortDescriptors = [[NSArray alloc] initWithObjects:sortByTotals, sortByCategory, nil]; [request setSortDescriptors:sortDescriptors]; NSFetchedResultsController *aFetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:request managedObjectContext:managedObjectContext sectionNameKeyPath:@"category" cacheName:nil]; aFetchedResultsController.delegate = self; self.fetchedResultsController = aFetchedResultsController; On selecting a row (tableView:didSelectRowAtIndexPath), another view controller is loaded that allows editing of the amount field for the selected entity. Before returning to the first view, categoryTotal is updated by the new ‘amount’. The problem comes when returning to the first view controller, the app bombs with *Serious application error. Exception was caught during Core Data change processing: Invalid update: invalid number of rows in section 0. The number of rows contained in an existing section after the update (1) must be equal to the number of rows contained in that section before the update (1), plus or minus the number of rows inserted or deleted from that section (0 inserted, 1 deleted). with userInfo (null) Program received signal: “EXC_BAD_ACCESS”.* This seems to be courtesy of NSSortDescriptor *sortByTotals = [[NSSortDescriptor alloc] initWithKey:@"categoryTotal" ascending:sortOrder]; If I remove this everything works as expected, but obviously without the sorting I want. I'm guessing this is to do with the sorting order changing due to categoryTotal changing (deletion / insertion) but can't find away fix this. I've verified that values are being modified correctly in the second view, so it appears down to the fetchedResultsController being confused. If the categoryAmount is changed to one that does not change the sort order, then no error is generated I'm not physically changing (ie deleting) the number of items the fetchedResultsController is returning ... the only other issue I can find that seem to generate this error Any ideas would be most welcome Thanks, AJ

    Read the article

  • In what circumstances are instance variables declared as '_var' in 'use fields' private?

    - by Pedro Silva
    I'm trying to understand the behavior of the fields pragma, which I find poorly documented, regarding fields prefixed with underscores. This is what the documentation has to say about it: Field names that start with an underscore character are made private to the class and are not visible to subclasses. Inherited fields can be overridden but will generate a warning if used together with the -w switch. This is not consistent with its actual behavior, according to my test, below. Not only are _-prefixed fields visible within a subclass, they are visible within foreign classes as well (unless I don't get what 'visible' means). Also, directly accessing the restricted hash works fine. Where can I find more about the behavior of the fields pragma, short of going at the source code? { package Foo; use strict; use warnings; use fields qw/a _b __c/; sub new { my ( $class ) = @_; my Foo $self = fields::new($class); $self->a = 1; $self->b = 2; $self->c = 3; return $self; } sub a : lvalue { shift->{a} } sub b : lvalue { shift->{_b} } sub c : lvalue { shift->{__c} } } { package Bar; use base 'Foo'; use strict; use warnings; use Data::Dumper; my $o = Bar->new; print Dumper $o; ##$VAR1 = bless({'_b' => 2, '__c' => 3, 'a' => 1}, 'Foo'); $o->a = 4; $o->b = 5; $o->c = 6; print Dumper $o; ##$VAR1 = bless({'_b' => 5, '__c' => 6, 'a' => 4}, 'Foo'); $o->{a} = 7; $o->{_b} = 8; $o->{__c} = 9; print Dumper $o; ##$VAR1 = bless({'_b' => 8, '__c' => 9, 'a' => 7}, 'Foo'); }

    Read the article

  • Displaying pic for user through a question's answer

    - by bgadoci
    Ok, I am trying to display the profile pic of a user. The application I have set up allows users to create questions and answers (I am calling answers 'sites' in the code) the view in which I am trying to do so is in the /views/questions/show.html.erb file. It might also be of note that I am using the Paperclip gem. Here is the set up: Associations Users class User < ActiveRecord::Base has_many :questions, :dependent => :destroy has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :through => :sites , :dependent => :destroy has_many :pics, :dependent => :destroy has_many :likes, :dependent => :destroy end Questions class Question < ActiveRecord::Base has_many :sites, :dependent => :destroy has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy belongs_to :user end Answers (sites) class Site < ActiveRecord::Base belongs_to :question belongs_to :user has_many :notes, :dependent => :destroy has_many :likes, :dependent => :destroy has_attached_file :photo, :styles => { :small => "250x250>" } end Pics class Pic < ActiveRecord::Base has_attached_file :profile_pic, :styles => { :small => "100x100" } belongs_to :user end The /views/questions/show.html.erb is rendering the partial /views/sites/_site.html.erb which is calling the Answer (site) with: <% div_for site do %> <%=h site.description %> <% end %> I have been trying to do things like: <%=image_tag site.user.pic.profile_pic.url(:small) %> <%=image_tag site.user.profile_pic.url(:small) %> etc. But that is obviously wrong. My error directs me to the Questions#show action so I am imagining that I need to define something in there but not sure what. Is is possible to call the pic given the current associations, placement of the call, and if so what Controller additions do I need to make, and what line of code will call the pic? UPDATE: Here is the QuestionsController#show code: def show @question = Question.find(params[:id]) @sites = @question.sites.all(:select => "sites.*, SUM(likes.like) as like_total", :joins => "LEFT JOIN likes AS likes ON likes.site_id = sites.id", :group => "sites.id", :order => "like_total DESC") respond_to do |format| format.html # show.html.erb format.xml { render :xml => @question } end end

    Read the article

  • objective C convert NSString to unsigned

    - by user1501354
    I have changed my question. I want to convert an NSString to an unsigned int. Why? Because I want to do parallel payment in PayPal. Below I have given my coding in which I want to convert the NSString to an unsigned int. My query is: //optional, set shippingEnabled to TRUE if you want to display shipping //options to the user, default: TRUE [PayPal getPayPalInst].shippingEnabled = TRUE; //optional, set dynamicAmountUpdateEnabled to TRUE if you want to compute //shipping and tax based on the user's address choice, default: FALSE [PayPal getPayPalInst].dynamicAmountUpdateEnabled = TRUE; //optional, choose who pays the fee, default: FEEPAYER_EACHRECEIVER [PayPal getPayPalInst].feePayer = FEEPAYER_EACHRECEIVER; //for a payment with multiple recipients, use a PayPalAdvancedPayment object PayPalAdvancedPayment *payment = [[PayPalAdvancedPayment alloc] init]; payment.paymentCurrency = @"USD"; // A payment note applied to all recipients. payment.memo = @"A Note applied to all recipients"; //receiverPaymentDetails is a list of PPReceiverPaymentDetails objects payment.receiverPaymentDetails = [NSMutableArray array]; NSArray *emailArray = [NSArray arrayWithObjects:@"[email protected]",@"[email protected]", nil]; for (int i = 1; i <= 2; i++) { PayPalReceiverPaymentDetails *details = [[PayPalReceiverPaymentDetails alloc] init]; // Customize the payment notes for one of the three recipient. if (i == 2) { details.description = [NSString stringWithFormat:@"Component %d", i]; } details.recipient = [NSString stringWithFormat:@"%@",[emailArray objectAtIndex:i-1]]; unsigned order; if (i==1) { order = [[feeArray objectAtIndex:0] unsignedIntValue]; } if (i==2) { order = [[amountArray objectAtIndex:0] unsignedIntValue]; } //subtotal of all items for this recipient, without tax and shipping details.subTotal = [NSDecimalNumber decimalNumberWithMantissa:order exponent:-4 isNegative:FALSE]; //invoiceData is a PayPalInvoiceData object which contains tax, shipping, and a list of PayPalInvoiceItem objects details.invoiceData = [[PayPalInvoiceData alloc] init]; //invoiceItems is a list of PayPalInvoiceItem objects //NOTE: sum of totalPrice for all items must equal details.subTotal //NOTE: example only shows a single item, but you can have more than one details.invoiceData.invoiceItems = [NSMutableArray array]; PayPalInvoiceItem *item = [[PayPalInvoiceItem alloc] init]; item.totalPrice = details.subTotal; [details.invoiceData.invoiceItems addObject:item]; [payment.receiverPaymentDetails addObject:details]; } [[PayPal getPayPalInst] advancedCheckoutWithPayment:payment]; Can anybody tell me how to do this conversion? Thanks and regards in advance.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • ZF-Autoloader not working in UnitTests on Ubuntu

    - by Sam
    i got a problem regarding Unit-testing a Zend-Framework application under Ubuntu 12.04. The project-structure is a default zend application whereas the models are defined as the following ./application ./models ./DbTable ./ProjectStatus.php (Application_Model_DbTable_ProjectStatus) ./Mappers ./ProjectStatus.php (Application_Model_Mapper_ProjectStatus) ./ProjectStatus.php (Application_Model_ProjectStatus) The Problem here is with the Zend-specific autoloading. The naming convention here appears that the folder Mappers loads all classes with _Mapper but not _Mappers. This is some internal Zend behavior which is fine so far. On my windows machine the phpunit runs without any Problems, trying to initiate all those classes. On my Ubuntu machine however with jenkins running on it, phpunit fails to find the appropriate classes giving me the following error Fatal error: Class 'Application_Model_Mapper_ProjectStatus' not found in /var/lib/jenkins/jobs/PAM/workspace/tests/application/models/Mapper/ProjectStatusTest.php on line 39 The error appears to really be that the Zend-Autoloader doesn't load from the ubuntu machine, but i can't figure out how or why this works. The question remains of why this is. I think i've double checked every point of contact with the zend autoloading stuff, but i just can't figure this out. I'll paste the - from my point of view relevant snippets - and hope someone of you has any insight to this. Jenkins Snippet for PHPUnit <target name="phpunit" description="Run unit tests with PHPUnit"> <exec executable="phpunit" failonerror="true"> <arg line="--configuration '${basedir}/tests/phpunit.xml' --coverage-clover '${basedir}/build/logs/clover.xml' --coverage-html '${basedir}/build/coverage/.' --log-junit '${basedir}/build/logs/junit.xml'" /> </exec> </target> ./tests/phpunit.xml <phpunit bootstrap="./bootstrap.php"> ... this shouldn't be of relevance ... </phpunit> ./tests/bootstrap.php <?php // Define path to application directory defined('APPLICATION_PATH') || define('APPLICATION_PATH', realpath(dirname(__FILE__) . '/../application')); // Define application environment defined('APPLICATION_ENV') || define('APPLICATION_ENV', (getenv('APPLICATION_ENV') ? getenv('APPLICATION_ENV') : 'testing')); // Ensure library/ is on include_path set_include_path(implode(PATH_SEPARATOR, array( realpath(APPLICATION_PATH . '/../library'), get_include_path(), ))); require_once 'Zend/Loader/Autoloader.php'; Zend_Loader_Autoloader::getInstance(); Any help will be appreciated.

    Read the article

  • Trouble using South with Django and Heroku

    - by Dan
    I had an existing Django project that I've just added South to. I ran syncdb locally. I ran manage.py schemamigration app_name locally I ran manage.py migrate app_name --fake locally I commit and pushed to heroku master I ran syncdb on heroku I ran manage.py schemamigration app_name on heroku I ran manage.py migrate app_name on heroku I then receive this: $ heroku run python notecard/manage.py migrate notecards Running python notecard/manage.py migrate notecards attached to terminal... up, run.1 Running migrations for notecards: - Migrating forwards to 0005_initial. > notecards:0003_initial Traceback (most recent call last): File "notecard/manage.py", line 14, in <module> execute_manager(settings) File "/app/lib/python2.7/site-packages/django/core/management/__init__.py", line 438, in execute_manager utility.execute() File "/app/lib/python2.7/site-packages/django/core/management/__init__.py", line 379, in execute self.fetch_command(subcommand).run_from_argv(self.argv) File "/app/lib/python2.7/site-packages/django/core/management/base.py", line 191, in run_from_argv self.execute(*args, **options.__dict__) File "/app/lib/python2.7/site-packages/django/core/management/base.py", line 220, in execute output = self.handle(*args, **options) File "/app/lib/python2.7/site-packages/south/management/commands/migrate.py", line 105, in handle ignore_ghosts = ignore_ghosts, File "/app/lib/python2.7/site-packages/south/migration/__init__.py", line 191, in migrate_app success = migrator.migrate_many(target, workplan, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 221, in migrate_many result = migrator.__class__.migrate_many(migrator, target, migrations, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 292, in migrate_many result = self.migrate(migration, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 125, in migrate result = self.run(migration) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 99, in run return self.run_migration(migration) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 81, in run_migration migration_function() File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 57, in <lambda> return (lambda: direction(orm)) File "/app/notecard/notecards/migrations/0003_initial.py", line 15, in forwards ('user', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['auth.User'])), File "/app/lib/python2.7/site-packages/south/db/generic.py", line 226, in create_table ', '.join([col for col in columns if col]), File "/app/lib/python2.7/site-packages/south/db/generic.py", line 150, in execute cursor.execute(sql, params) File "/app/lib/python2.7/site-packages/django/db/backends/util.py", line 34, in execute return self.cursor.execute(sql, params) File "/app/lib/python2.7/site-packages/django/db/backends/postgresql_psycopg2/base.py", line 44, in execute return self.cursor.execute(query, args) django.db.utils.DatabaseError: relation "notecards_semester" already exists I have 3 models. Section, Semester, and Notecards. I've added one field to the Notecards model and I cannot get it added on Heroku. Thank you.

    Read the article

  • [c++] upload image to imageshack

    - by cinek1lol
    Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

    Read the article

  • DB Design Pattern - Many to many classification / categorised tagging.

    - by Robin Day
    I have an existing database design that stores Job Vacancies. The "Vacancy" table has a number of fixed fields across all clients, such as "Title", "Description", "Salary range". There is an EAV design for "Custom" fields that the Clients can setup themselves, such as, "Manager Name", "Working Hours". The field names are stored in a "ClientText" table and the data stored in a "VacancyClientText" table with VacancyId, ClientTextId and Value. Lastly there is a many to many EAV design for custom tagging / categorising the vacancies with things such as Locations/Offices the vacancy is in, a list of skills required. This is stored as a "ClientCategory" table listing the types of tag, "Locations, Skills", a "ClientCategoryItem" table listing the valid values for each Category, e.g., "London,Paris,New York,Rome", "C#,VB,PHP,Python". Finally there is a "VacancyClientCategoryItem" table with VacancyId and ClientCategoryItemId for each of the selected items for the vacancy. There are no limits to the number of custom fields or custom categories that the client can add. I am now designing a new system that is very similar to the existing system, however, I have the ability to restrict the number of custom fields a Client can have and it's being built from scratch so I have no legacy issues to deal with. For the Custom Fields my solution is simple, I have 5 additional columns on the Vacancy Table called CustomField1-5. This removes one of the EAV designs. It is with the tagging / categorising design that I am struggling. If I limit a client to having 5 categories / types of tag. Should I create 5 tables listing the possible values "CustomCategoryItems1-5" and then an additional 5 many to many tables "VacancyCustomCategoryItem1-5" This would result in 10 tables performing the same storage as the three tables in the existing system. Also, should (heaven forbid) the requirements change in that I need 6 custom categories rather than 5 then this will result in a lot of code change. Therefore, can anyone suggest any DB Design Patterns that would be more suitable to storing such data. I'm happy to stick with the EAV approach, however, the existing system has come across all the usual performance issues and complex queries associated with such a design. Any advice / suggestions are much appreciated. The DBMS system used is SQL Server 2005, however, 2008 is an option if required for any particular pattern.

    Read the article

  • Working with friends. Poor career choice?

    - by a_person
    Hi all, Hope you can help me solve somewhat of a moral dilemma. Some time ago, after just a few years of living in U.S. and having to take any job I could get my hands on a friend of mine submitted recommended me for an open position at the company that he was working for. I could have not been happier. I do not have a degree of any sort, however, by being passionate about CS and with constant drive for self education I've became a somewhat of a strong generalist. Every place I worked for recognized me for that quality and used me on various projects where set of technology in hand had no overlap with set of knowledge of the team members. Rapidly I've advanced to Sr. Programmer position and the trend of me following a friend from one place to another have started and continued on for a few years. My friend's goal always been to become an IT Director, mine is to become the best programmer I can be. To my knowledge I've accommodated his goals as much as I could by taking a back seat, and letting him take the lead. Fast forward to today. He's a manager, and I am on his team. I am unhappy and I in considerable amount of suffering. I am not being utilized to my potential, it's almost exact opposite, I am being micromanaged to an unhealthy extent, my decisions, and suggestions are constantly met with negative connotation. Last week I had to hear about how my friend is a better programmer than I am. My ego was ecstatic about this one /s. In addition to that working in the field of BI have exhausted itself for most parts. The only pleasure of my work is being derived from making everything as dynamic and parameter driven as possible. This is the only area where a friend of mine does not feel competent enough to actually micromanage. Because of my situation I feel a fair amount of guilt and ever growing resentment. I need your advice, maybe you've dealt with this expression of ego before, needs of self vs the needs of your friend. Is working with a friend a poor choice? Thank you for reading in.

    Read the article

  • R: Plotting a graph with different colors of points based on advanced criteria

    - by balconydoor
    What I would like to do is a plot (using ggplot), where the x axis represent years which have a different colour for the last three years in the plot than the rest. The last three years should also meet a certain criteria and based on this the last three years can either be red or green. The criteria is that the mean of the last three years should be less (making it green) or more (making it red) than the 66%-percentile of the remaining years. So far I have made two different functions calculating the last three year mean: LYM3 <- function (x) { LYM3 <- tail(x,3) mean(LYM3$Data,na.rm=T) } And the 66%-percentile for the remaining: perc66 <- function(x) { percentile <- head(x,-3) quantile(percentile$Data, .66, names=F,na.rm=T) } Here are two sets of data that can be used in the calculations (plots), the first which is an example from my real data where LYM3(df1) < perc66(df1) and the second is just made up data where LYM3 perc66. df1<- data.frame(Year=c(1979:2010), Data=c(347261.87, 145071.29, 110181.93, 183016.71, 210995.67, 205207.33, 103291.78, 247182.10, 152894.45, 170771.50, 206534.55, 287770.86, 223832.43, 297542.86, 267343.54, 475485.47, 224575.08, 147607.81, 171732.38, 126818.10, 165801.08, 136921.58, 136947.63, 83428.05, 144295.87, 68566.23, 59943.05, 49909.08, 52149.11, 117627.75, 132127.79, 130463.80)) df2 <- data.frame(Year=c(1979:2010), Data=c(sample(50,29,replace=T),75,75,75)) Here’s my code for my plot so far: plot <- ggplot(df1, aes(x=Year, y=Data)) + theme_bw() + geom_point(size=3, aes(colour=ifelse(df1$Year<2008, "black",ifelse(LYM3(df1) < perc66(df1),"green","red")))) + geom_line() + scale_x_continuous(breaks=c(1980,1985,1990,1995,2000,2005,2010), limits=c(1978,2011)) plot As you notice it doesn’t really do what I want it to do. The only thing it does seem to do is that it turns the years before 2008 into one level and those after into another one and base the point colour off these two levels. Since I don’t want this year to be stationary either, I made another tiny function: fun3 <- function(x) { df <- subset(x, Year==(max(Year)-2)) df$Year } So the previous code would have the same effect as: geom_point(size=3, aes(colour=ifelse(df1$Year<fun3(df1), "black","red"))) But it still does not care about my colours. Why does it make the years into levels? And how come an ifelse function doesn’t work within another one in this case? How would it be possible to the arguments to do what I like? I realise this might be a bit messy, asking for a lot at the same time, but I hope my description is pretty clear. It would be helpful if someone could at least point me in the right direction. I tried to put the code for the plot into a function as well so I wouldn’t have to change the data frame at all functions within the plot, but I can’t get it to work. Thank you!

    Read the article

  • NHibernate Many-to-Many Mapping not working

    - by ClutchDude
    I have a Nhibernate mapping file for a simple user/role mapping. Here are the mapping files: Users.hbm.xml <?xml version="1.0" encoding="utf-8" ?> <hibernate-mapping xmlns="urn:nhibernate-mapping-2.2" assembly="Sample.Persistence" namespace="Sample.Persistence.Model"> <class name="User" table="Users"> <id name="UserKey"> <generator class="identity"/> </id> <property name="UserName" column="UserName" type="String" /> <property name="Password" column="Password" type="Byte[]" /> <property name="FirstName" column="FirstName" type="String" /> <property name="LastName" column="LastName" type="String" /> <property name="Email" column="Email" type="String" /> <property name="Active" column="Active" type="Boolean" /> <property name="Locked" column="Locked" type="Boolean" /> <property name="LoginFailures" column="LoginFailures" type="int" /> <property name="LockoutDate" column="LockoutDate" type="DateTime" generated="insert" /> <property name="Expired" column="Expired" type="Boolean" generated="insert"/> <set name="Roles" table="UsersRolesBridge" lazy="false"> <key column="UserKey" /> <many-to-many class="Role" not-found="exception" column="RoleKey" /> </set> </class> </hibernate-mapping> Role.hbm.xml <?xml version="1.0" encoding="utf-8" ?> <hibernate-mapping xmlns="urn:nhibernate-mapping-2.2" assembly="Sample.Persistence" namespace="Sample.Persistence.Model"> <class name="Role" table="Roles"> <id name="RoleKey"> <generator class="identity"/> </id> <property name="Name" column="Name" type="String" /> <set name="Users" inverse="true" atable="UsersRolesBridge" lazy="false" > <key column="RoleKey" /> <many-to-many class="User" column="UserKey" /> </set> </class> </hibernate-mapping> I am able to retrieve roles for each user via NHibernate but when I go to save a new object, the roles are not saved in the Bridge table. The user is created and insert with no issues. I've checked that the Role collection, a field on the user, is being populated with the proper rolekey before the Session.Save() is called. There is no exception thrown as well.

    Read the article

  • Good design of mapping Java Domain objects to Tables (using Hibernate)

    - by M. McKenzie
    Hey guys, I have a question that is more in the realm of design, than implementation. I'm also happy for anyone to point out resources for the answer and I'll gladly, research for myself. Highly simplified Java and SQL: Say I have a business domain POJO called 'Picture' with three attributes. class Picture int idPicture String fileName long size Say I have another business domain POJO called "Item" with 3 attributes Class Item int idItem String itemName ArrayList itemPictures These would be a normal simple relationship. You could say that 'Picture' object, will never exist outside an 'Item' object. Assume a picture belongs only to a specific item, but that an item can have multiple pictures Now - using good database design (3rd Normal Form), we know that we should put items and pictures in their own tables. Here is what I assume would be correct. table Item int idItem (primary key) String itemName table Picture int idPicture (primary key) varchar(45) fileName long size int idItem (foreign key) Here is my question: If you are making Hibernate mapping files for these objects. In the data design, your Picture table needs a column to refer to the Item, so that a foreign key relation can be maintained. However,in your business domain objects - your Picture does not hold a reference/attribute to the idItem - and does not need to know it. A java Picture instance is always instantiated inside an Item instance. If you want to know the Item that the Picture belongs to you are already in the correct scope. Call myItem.getIdItem() and myItem.getItemPictures(),and you have the two pieces of information you need. I know that Hibernate tools have a generator that can auto make your POJO's from looking at your database. My problem stems from the fact that I planned out the data design for this experiment/project first. Then when I went to make the domain java objects, I realized that good design dictated that the objects hold other objects in a nested way. This is obviously different from the way that a database schema is - where all objects(tables) are flat and hold no other complex types within them. What is a good way to reconcile this? Would you: (A) Make the hibernate mapping files so that Picture.hbm.xml has a mapping to the POJO parent's idItem Field (if it's even possible) (B) Add an int attribute in the Picture class to refer to the idItem and set it at instantiation, thus simplifying the hbm.xml mapping file by having all table fields as local attributes in the class (C) Fix the database design because it is wrong, dork. I'd truly appreciate any feedback

    Read the article

  • Trouble passing a string as a SQLite ExecSQL command

    - by Hackbrew
    I keep getting the ERROR: near "PassWord": syntax error when trying to execute the ExecSQL() statement. The command looks good in the output of the text file. In fact, I copied & pasted the command directly into SQLite Database Browser and the commend executed properly. Here's the code that's producing the error: procedure TForm1.Button1Click(Sender: TObject); var i, iFieldSize: integer; sFieldName, sFieldType, sFieldList, sExecSQL: String; names: TStringList; f1: Textfile; begin //Open Source table - Table1 has 8 fields but has only two different field types ftString and Boolean Table1.TableName:= 'PWFile'; Table1.Open; //FDConnection1.ExecSQL('drop table PWFile'); sFieldList := ''; names := TStringList.Create; for i := 0 to Table1.FieldCount - 1 do begin sFieldName := Table1.FieldDefList.FieldDefs[i].Name; sFieldType := GetEnumName(TypeInfo(TFieldType),ord(Table1.FieldDefList.FieldDefs[i].DataType)); iFieldSize := Table1.FieldDefList.FieldDefs[i].Size; if sFieldType = 'ftString' then sFieldType := 'NVARCHAR' + '(' + IntToStr(iFieldSize) + ')'; if sFieldType = 'ftBoolean' then sFieldType := 'INTEGER'; names.Add(sFieldName + ' ' + sFieldType); if sFieldList = '' then sFieldList := sFieldName + ' ' + sFieldType else sFieldList := sFieldList + ', ' + sFieldName + ' ' + sFieldType; end; ListBox1.Items.Add(sFieldList); sExecSQL := 'create table IF NOT EXISTS PWFile (' + sFieldList + ')'; // 08/18/2014 - Entered this to log the SQLite FDConnection1.ExecSQL Command to a file AssignFile(f1, 'C:\Users\Test User\Documents\SQLite_Command.txt'); Rewrite(f1); Writeln(f1, sExecSQL); { insert code here that would require a Flush before closing the file } Flush(f1); { ensures that the text was actually written to file } CloseFile(f1); FDConnection1.ExecSQL(sFieldList); Table1.Close; end; Here's the actual command that gets executed: create table IF NOT EXISTS PWFile (PassWord NVARCHAR(10), PassName NVARCHAR(10), Dept NVARCHAR(10), Active NVARCHAR(1), Admin INTEGER, Shred INTEGER, Reports INTEGER, Maintain INTEGER)

    Read the article

  • Is there limit of "join" or the "where" or length of SQL query ?

    - by Chetan sharma
    Actually i was trying to get data from elgg database based on multiple joins. It generated very big query with lots of JOIN statements and query never respond back. SELECT distinct e.* from test_entities e JOIN test_metadata m1 on e.guid = m1.entity_guid JOIN test_metastrings ms1 on ms1.id = m1.name_id JOIN test_metastrings mv1 on mv1.id = m1.value_id JOIN test_objects_entity obj on e.guid = obj.guid JOIN test_metadata m2 on e.guid = m2.entity_guid JOIN test_metastrings ms2 on ms2.id = m2.name_id JOIN test_metastrings mv2 on mv2.id = m2.value_id JOIN test_metadata m3 on e.guid = m3.entity_guid JOIN test_metastrings ms3 on ms3.id = m3.name_id JOIN test_metastrings mv3 on mv3.id = m3.value_id JOIN test_metadata m4 on e.guid = m4.entity_guid JOIN test_metastrings ms4 on ms4.id = m4.name_id JOIN test_metastrings mv4 on mv4.id = m4.value_id JOIN test_metadata m5 on e.guid = m5.entity_guid JOIN test_metastrings ms5 on ms5.id = m5.name_id JOIN test_metastrings mv5 on mv5.id = m5.value_id JOIN test_metadata m6 on e.guid = m6.entity_guid JOIN test_metastrings ms6 on ms6.id = m6.name_id JOIN test_metastrings mv6 on mv6.id = m6.value_id where ms1.string='expire_date' and mv1.string <= 1272565800 and ms2.string='homecity' and mv2.string LIKE "%dasf%" and ms3.string='schoolname' and mv3.string LIKE "%asdf%" and ms4.string='award_amount' and mv4.string <= 123 and ms5.string='no_of_awards' and mv5.string <= 7 and ms6.string='avg_rating' and mv6.string <= 2 and e.type = 'object' and e.subtype = 5 and e.site_guid = 1 and (obj.title like '%asdf%') OR (obj.description like '%asdf%') and ( (e.access_id = -2 AND e.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (e.access_id IN (2,1) OR (e.owner_guid = 5) OR ( e.access_id = 0 AND e.owner_guid = 5 ) ) and e.enabled='yes') and ( (m1.access_id = -2 AND m1.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m1.access_id IN (2,1) OR (m1.owner_guid = 5) OR ( m1.access_id = 0 AND m1.owner_guid = 5 ) ) and m1.enabled='yes') and ( (m2.access_id = -2 AND m2.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m2.access_id IN (2,1) OR (m2.owner_guid = 5) OR ( m2.access_id = 0 AND m2.owner_guid = 5 ) ) and m2.enabled='yes') and ( (m3.access_id = -2 AND m3.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m3.access_id IN (2,1) OR (m3.owner_guid = 5) OR ( m3.access_id = 0 AND m3.owner_guid = 5 ) ) and m3.enabled='yes') and ( (m4.access_id = -2 AND m4.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m4.access_id IN (2,1) OR (m4.owner_guid = 5) OR ( m4.access_id = 0 AND m4.owner_guid = 5 ) ) and m4.enabled='yes') and ( (m5.access_id = -2 AND m5.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m5.access_id IN (2,1) OR (m5.owner_guid = 5) OR ( m5.access_id = 0 AND m5.owner_guid = 5 ) ) and m5.enabled='yes') and ( (m6.access_id = -2 AND m6.owner_guid IN ( SELECT guid_one FROM test_entity_relationships WHERE relationship='friend' AND guid_two=5 )) OR (m6.access_id IN (2,1) OR (m6.owner_guid = 5) OR ( m6.access_id = 0 AND m6.owner_guid = 5 ) ) and m6.enabled='yes') order by obj.title limit 0, 10 this is the query that i am running.

    Read the article

  • How do I pass the value of the previous form element into an "onchange" javascript function?

    - by Jen
    Hello, I want to make some UI improvements to a page I am developing. Specifically, I need to add another drop down menu to allow the user to filter results. This is my current code: HTML file: <select name="test_id" onchange="showGrid(this.name, this.value, 'gettestgrid')"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> This is pseudo code for what I want to happen: <select name="test_id"> <option selected>Select a test--></option> <option value=1>Test 1</option> <option value=2>Test 2</option> <option value=3>Test 3</option> </select> <select name="statistics" onchange="showGrid(PREVIOUS.name, PREVIOUS.VALUE, THIS.value)"> <option selected>Select a data display --></option> <option value='gettestgrid'>Show averages by student</option> <option value='gethomeroomgrid'>Show averages by homeroom</option> <option value='getschoolgrid'>Show averages by school</option> </select> How do I access the previous field's name and value? Any help much appreciated, thx! Also, JS function for reference: function showGrid(name, value, phpfile) { xmlhttp=GetXmlHttpObject(); if (xmlhttp==null) { alert ("Browser does not support HTTP Request"); return; } var url=phpfile+".php"; url=url+"?"+name+"="+value; url=url+"&sid="+Math.random(); xmlhttp.onreadystatechange=stateChanged; xmlhttp.open("GET",url,true); xmlhttp.send(null); }

    Read the article

  • Releasing the keyboard stops shake events. Why?

    - by Moshe
    1) How do I make a UITextField resign the keyboard and hide it? The keyboard is in a dynamically created subview whose superview looks for shake events. Resigning first responder seems to break the shake event handler. 2) how do you make the view holding the keyboard transparent, like see through glass? I have seen this done before. This part has been taken care of thanks guys. As always, code samples are appreciated. I've added my own to help explain the problem. EDIT: Basically, - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event; gets called in my main view controller to handle shaking. When a user taps on the "edit" icon (a pen, in the bottom of the screen - not the traditional UINavigationBar edit button), the main view adds a subview to itself and animates it on to the screen using a custom animation. This subview contains a UINavigationController which holds a UITableView. The UITableView, when a cell is tapped on, loads a subview into itself. This second subview is the culprit. For some reason, a UITextField in this second subview is causing problems. When a user taps on the view, the main view will not respond to shakes unless the UITextField is active (in editing mode?). Additional info: My Motion Event Handler: - (void)motionBegan:(UIEventSubtype)motion withEvent:(UIEvent *)event { NSLog(@"%@", [event description]); SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"shake" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); [self genRandom:TRUE]; } The genRandom: Method: /* Generate random label and apply it */ -(void)genRandom:(BOOL)deviceWasShaken{ if(deviceWasShaken == TRUE){ decisionText.text = [NSString stringWithFormat: (@"%@", [shakeReplies objectAtIndex:(arc4random() % [shakeReplies count])])]; }else{ SystemSoundID SoundID; NSString *soundFile = [[NSBundle mainBundle] pathForResource:@"string" ofType:@"aif"]; AudioServicesCreateSystemSoundID((CFURLRef)[NSURL fileURLWithPath:soundFile], &SoundID); AudioServicesPlayAlertSound(SoundID); decisionText.text = [NSString stringWithFormat: (@"%@", [pokeReplies objectAtIndex:(arc4random() % [pokeReplies count])])]; } } shakeReplies and pokeReplies are both NSArrays of strings. One is used for when a certain part of the screen is poked and one is for when the device is shaken. The app will randomly choose a string from the NSArray and display onscreen. For those of you who work graphically, here is a diagram of the view hierarchy: Root View -> UINavigationController -> UITableView -> Edit View -> Problem UITextfield

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

  • JSP to Bean to Java class Validation

    - by littlevahn
    I have a rather simple form in JSP that looks like this: <form action="response.jsp" method="POST"> <label>First Name:</label><input type="text" name="firstName" /><br> <label>Last Name:</label><input type="text" name="lastName" /><br> <label>Email:</label><input type="text" name="email" /><br> <label>Re-enter Email:</label><input type="text" name="emailRe" /><br> <label>Address:</label><input type="text" name="address" /><br> <label>Address 2:</label><input type="text" name="address2" /><br> <label>City:</label><input type="text" name="city" /><br> <label>Country:</label> <select name="country"> <option value="0">--Country--</option> <option value="1">United States</option> <option value="2">Canada</option> <option value="3">Mexico</option> </select><br> <label>Phone:</label><input type="text" name="phone" /><br> <label>Alt Phone:</label><input type="text" name="phoneAlt" /><br> <input type="submit" value="submit" /> </form> But when I try and access the value of the select box in my Java class I get null. Ive tried reading it in as a String and an Array of strings neither though seems to be grabbing the right value. The response.jsp looks like this: <%@ page language="java" %> <%@ page import="java.util.*" %> <%@page contentType="text/html" pageEncoding="UTF-8"%> <%! %> <jsp:useBean id="formHandler" class="validation.RegHandler" scope="request"> <jsp:setProperty name="formHandler" property="*" /> </jsp:useBean> <% if (formHandler.validate()) { %> <jsp:forward page="success.jsp"/> <% } else { %> <jsp:forward page="retryReg.jsp"/> <% } %> I already have Java script validation in place but I wanted to make sure I covered validation and checking for non-JS users. The RegHandler just uses the name field to refer to the value in the form. Any Idea how I could access the select box's value?

    Read the article

  • meteor mongodb _id changing after insert (and UUID property as well)

    - by lommaj
    I have meteor method that does an insert. Im using Regulate.js for form validation. I set the game_id field to Meteor.uuid() to create a unique value that I also route to /game_show/:game_id using iron router. As you can see I'm logging the details of the game, this works fine. (image link to log below) Meteor.methods({ create_game_form : function(data){ Regulate.create_game_form.validate(data, function (error, data) { if (error) { console.log('Server side validation failed.'); } else { console.log('Server side validation passed!'); // Save data to database or whatever... //console.log(data[0].value); var new_game = { game_id: Meteor.uuid(), name : data[0].value, game_type: data[1].value, creator_user_id: Meteor.userId(), user_name: Meteor.user().profile.name, created: new Date() }; console.log("NEW GAME BEFORE INSERT: ", new_game); GamesData.insert(new_game, function(error, new_id){ console.log("GAMES NEW MONGO ID: ", new_id) var game_data = GamesData.findOne({_id: new_id}); console.log('NEW GAME AFTER INSERT: ', game_data); Session.set('CURRENT_GAME', game_data); }); } }); } }); All of the data coming out of the console.log at this point works fine After this method call the client routes to /game_show/:game_id Meteor.call('create_game_form', data, function(error){ if(error){ return alert(error.reason); } //console.log("post insert data for routing variable " ,data); var created_game = Session.get('CURRENT_GAME'); console.log("Session Game ", created_game); Router.go('game_show', {game_id: created_game.game_id}); }); On this view, I try to load the document with the game_id I just inserted Template.game_start.helpers({ game_info: function(){ console.log(this.game_id); var game_data = GamesData.find({game_id: this.game_id}); console.log("trying to load via UUID ", game_data); return game_data; } }); sorry cant upload images... :-( https://www.evernote.com/shard/s21/sh/c07e8047-de93-4d08-9dc7-dae51668bdec/a8baf89a09e55f8902549e79f136fd45 As you can see from the image of the console log below, everything matches the id logged before insert the id logged in the insert callback using findOne() the id passed in the url However the mongo ID and the UUID I inserted ARE NOT THERE, the only document in there has all the other fields matching except those two! Not sure what im doing wrong. Thanks!

    Read the article

< Previous Page | 657 658 659 660 661 662 663 664 665 666 667 668  | Next Page >