Search Results

Search found 19060 results on 763 pages for 'enterprise document autom'.

Page 673/763 | < Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >

  • opening a new page and passing a parameter to it with Javascript

    - by recipriversexclusion
    I have a JS function that processes XML I GET from a server to dynamically create a table as below // Generate table of services by parsing the returned XML service list. function convertServiceXmlDataToTable(xml) { var tbodyElem = document.getElementById("myTbody"); var trElem, tdElem; var j = 0; $(xml).find("Service").each(function() { trElem = tbodyElem.insertRow(tbodyElem.rows.length); trElem.className = "tr" + (j % 2); // first column -> service ID var serviceID = $(this).attr("service__id"); tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col0"; tdElem.innerHTML = serviceID; // second column -> service name tdElem = trElem.insertCell(trElem.cells.length); tdElem.className = "col1"; tdElem.innerHTML = "<a href=javascript:showServiceInfo(" + serviceID + ")>" + $(this).find("name").text() + "</a>"; j++; }); // each service } where showServiceInfo retrieves more detailed information about each service from the server based on the serviceID and displays it in the same page as the services table. So far so good. But, it turns out that I have to display the detailed service information in another page rather than the same page as the table. I have creates a generic service_info.html with an empty layout template, but I don't understand how to pass serviceID to this new page so that it gets customized with the detailed service info. How can I do this? Or, is there a better way to handle these situations? Thanks!

    Read the article

  • Add an event to HTML elements with a specific class.

    - by Juan C. Rois
    Hello everybody, I'm working on a modal window, and I want to make the function as reusable as possible. Said that, I want to set a few anchor tags with a class equals to "modal", and when a particular anchor tag is clicked, get its Id and pass it to a function that will execute another function based on the Id that was passed. This is what I have so far: // this gets an array with all the elements that have a class equals to "modal" var anchorTrigger = document.getElementsByClassName('modal'); Then I tried to set the addEventListener for each item in the array by doing this: var anchorTotal = anchorTrigger.length; for(var i = 0; i < anchorTotal ; i++){ anchorTrigger.addEventListener('click', fireModal, false); } and then run the last function "fireModal" that will open the modal, like so: function fireModal(){ //some more code here ... } My problem is that in the "for" loop, I get an error saying that anchorTrigger.addEvent ... is not a function. I can tell that the error might be related to the fact that I'm trying to set up the "addEventListener" to an array as oppose to individual elements, but I don't know what I'm supposed to do. Any help would be greatly appreciated.

    Read the article

  • How to make HTML layout whitespace-agnostic?

    - by ssg
    If you have consecutive inline-blocks white-space becomes significant. It adds some level of space between elements. What's the "correct" way of avoiding whitespace effect to HTML layout if you want those blocks to look stuck to each other? Example: <span>a</span> <span>b</span> This renders differently than: <span>a</span><span>b</span> because of the space inbetween. I want whitespace-effect to go away without compromising HTML source code layout. I want my HTML templates to stay clean and well-indented. I think these options are ugly: 1) Tweaking text-indent, margin, padding etc. (Because it would be dependent on font-size, default white-space width etc) 2) Putting everything on a single line, next to each other. 3) Zero font-size. That would require overriding font-size in blocks, which would otherwise be inherited. 4) Possible document-wide solutions. I want the solution to stay local for a certain block of HTML. Any ideas, any obvious points which I'm missing?

    Read the article

  • Latex multicols. Can I group content so it won't split over cols and/or suggest colbreaks?

    - by valadil
    Hi. I'm trying to learn LaTeX. I've been googling this one for a couple days, but I don't speak enough LaTeX to be able to search for it effectively and what documentation I have found is either too simple or goes way over my head (http://www.uoregon.edu/~dspivak/files/multicol.pdf) I have a document using the multicol package. (I'm actually using multicols* so that the first col fills before the second begins instead of trying to balance them, but I don't think that's relevant here.) The columns output nicely, but I want to be able to indicate that some content won't be broken up into different columns. For instance, aaaaaaaa bbbbbbb aaaaaaaa bbbbbbb aaaaaaaa ccccccc bbbbbbbb ccccccc That poor attempt at ascii art columns is what's happening. I'd like to indicate that the b block is a whole unit that shouldn't be broken up into different columns. Since it doesn't fit under the a block, the entirety of the b block should be moved to the second column. Should b be wrapped in something? Is there a block/float/section/box/minipage/paragraph structure I can use? Something specific to multicol? Alternatively is there a way that I can suggest a columnbreak? I'm thinking of something like \- that suggests a hyphenated line break if its convenient, but this would go between blocks. Thanks!

    Read the article

  • How do I get NHibernate to work with .NET Framework 2.0?

    - by Daniel Dolz
    I can not make NHibernate 2.1 work in machines without framework 3.X (basically, windows 2000 SP4, although it happens with XP too). NHibernate doc do not mention this. Maybe you can help? I NEED to make NHibernate 2.1 work in Windows 2000 PCs, do you think this can be done? PD: DataBase is SQL 2000/2005. Error is: NHibernate.MappingException: Could not compile the mapping document: Datos.NH_VEN_ComprobanteBF.hbm.xml ---> NHibernate.HibernateException: Could not instantiate dialect class NHibernate.Dialect.MsSql2000Dialect ---> System.Reflection.TargetInvocationException: Se produjo una excepción en el destino de la invocación. ---> System.TypeInitializationException: Se produjo una excepción en el inicializador de tipo de 'NHibernate.NHibernateUtil'. ---> System.TypeLoadException: No se puede cargar el tipo 'System.DateTimeOffset' del ensamblado'mscorlib, Version=2.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089'. en NHibernate.Type.DateTimeOffsetType.get_ReturnedClass() en NHibernate.NHibernateUtil..cctor() --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect..ctor() en NHibernate.Dialect.MsSql2000Dialect..ctor() --- Fin del seguimiento de la pila de la excepción interna --- en System.RuntimeTypeHandle.CreateInstance(RuntimeType type, Boolean publicOnly, Boolean noCheck, Boolean& canBeCached, RuntimeMethodHandle& ctor, Boolean& bNeedSecurityCheck) en System.RuntimeType.CreateInstanceSlow(Boolean publicOnly, Boolean fillCache) en System.RuntimeType.CreateInstanceImpl(Boolean publicOnly, Boolean skipVisibilityChecks, Boolean fillCache) en System.Activator.CreateInstance(Type type, Boolean nonPublic) en NHibernate.Bytecode.ActivatorObjectsFactory.CreateInstance(Type type) en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Dialect.Dialect.InstantiateDialect(String dialectName) en NHibernate.Dialect.Dialect.GetDialect(IDictionary`2 props) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) --- Fin del seguimiento de la pila de la excepción interna --- en NHibernate.Cfg.Configuration.LogAndThrow(Exception exception) en NHibernate.Cfg.Configuration.AddValidatedDocument(NamedXmlDocument doc) en NHibernate.Cfg.Configuration.ProcessMappingsQueue() and continues...

    Read the article

  • Solr/Lucene Scorer

    - by TFor
    We are currently working on a proof-of-concept for a client using Solr and have been able to configure all the features they want except the scoring. Problem is that they want scores that make results fall in buckets: Bucket 1: exact match on category (score = 4) Bucket 2: exact match on name (score = 3) Bucket 3: partial match on category (score = 2) Bucket 4: partial match on name (score = 1) First thing we did was develop a custom similarity class that would return the correct score depending on the field and an exact or partial match. The only problem now is that when a document matches on both the category and name the scores are added together. Example: searching for "restaurant" returns documents in the category restaurant that also have the word restaurant in their name and thus get a score of 5 (4+1) but they should only get 4. I assume for this to work we would need to develop a custom Scorer class but we have no clue on how to incorporate this in Solr. Another option is to create a custom SortField implementation similar to the RandomSortField already present in Solr. Maybe there is even a simpler solution that we don't know about. All suggestions welcome!

    Read the article

  • Which pdf elements could cause crashes?

    - by Felixyz
    This is a very general question but it's based on a specific problem. I've created a pdf reader app for the iPad and it works fine except for certain pdf pages which always crash the app. We now found out that the very same pages cause Safari to crash as well, so as I had started to suspect the problem is somewhere in Apple's pdf rendering code. From what I have been able to see, the crashing pages cause the rendering libraries to start allocating memory like mad until the app is killed. I have nothing else to help me pinpoint what triggers this process. It doesn't necessarily happen with the largest documents, or the ones with the most shapes. In fact, we haven't found any parameter that helps us predict which pages will crash and which not. Now we just discovered that running the pages through a consumer program that lets you merge docs gets rid of the problem, but I haven't been able to detect which attribute or element it is that is the key. Changing documents by hand is also not an option for us in the long run. We need to run an automated process on our server. I'm hoping someone with deeper knowledge about the pdf file format would be able to point me in a reasonable direction to look for document features that could cause this kind of behavior. All I've found so far is something about JBIG2 images, and I don't think we have any of those.

    Read the article

  • Browser freezes when try to call a JS function along with submission of a form.

    - by Waseem
    I have form in my view like following 1 <div> 2 <% form_tag facebook_user_path do %> 3 <label>Use my photo and name from facebook?</label><br /> 4 <%= check_box_tag 'use_name_and_photo', 'yes', true %> 5 <img src="<%= @user.pic %>" /><% @user.name %> 6 7 <%= submit_tag "Finish", :id => "use_name_and_photo_submit" %> 8 <% end %> 9 </div> I have attached some JS handlers using Jquery to this form. 1 var fb = { 2 extendedPermissions: function () { 3 $("#use_name_and_photo_submit").click(function (event) { 4 FB.Connect.showPermissionDialog("email,read_stream,publish_stream", function (perms) { 5 if (!perms) { 6 alert("You have to grant facebook extended permissions to further browse the application."); 7 } else { 8 $("form").submit(function () { 9 $.post($(this).attr("action"), $(this).serialize(), null, "script"); 10 }); 11 } 12 }); 13 event.preventDefault(); 14 return false; 15 }); 16 } 17 }; 18 19 $(document).ready(function () { 20 fb.extendedPermissions(); 21 }); What I want is that when the user clicks on the "Finish" button, he is prompted for the facebook permissions dialogue and when he gives the permissions, the form is submitted to FacebookUsersController. Right now when I click the "Finish" button, facebook permissions dialogue is initiated but before I am prompted for the actual permission submission window, the browser freezes. Just like I have pressed Esc during the process. In fact status bar of the browser says "Stopped". Any help is highly appreciated.

    Read the article

  • IE "Microsoft JScript runtime error: Object expected"

    - by Stephen Borg
    Hi there, I have problems with regards to javascript only when using IE. The error I am getting is "Microsoft JScript runtime error: Object expected" and I have no idea why. It is then jumping into the JQuery 1.4.2 file, without giving me a proper error message. All I am doing is simply reading on page load the raw URL, and getting a query string named Search. Using that in an AJAX call to return products and put then into a DIV. No biggies, but somehow IE is managing to blow my page up :-( Any ideas? Code as follows : <script type="text/javascript"> $(document).ready(function (e) { $('.boxLoader').show(); function getParameterByName(name) { name = name.replace(/[\[]/, "\\\[").replace(/[\]]/, "\\\]"); var regexS = "[\\?&]" + name + "=([^&#]*)"; var regex = new RegExp(regexS); var results = regex.exec(window.location.href); if (results == null) return ""; else return decodeURIComponent(results[1].replace(/\+/g, " ")); } var Search; Search = getParameterByName("search"); $('#searchCriteria').text(Search); $.get("/Handlers/processProducts.aspx", { SearchCriteria: Search }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); $('#searchBox').live("click", function () { $.get("/Handlers/processProducts.aspx", { SearchCriteria: $('#searchCriteria').val() }, function (data) { $('#innercontent').html(data); $('#innercontent').fadeIn(200); $('.boxLoader').fadeOut(200); }); }); }); </script>

    Read the article

  • Anchor as a Submit button

    - by griegs
    I have an MVC 2 application that has the following on it; <% using( Html.BeginForm("Results","Quote", FormMethod.Post, new { name="Results" })){ %> <% Html.RenderPartial("Needs", Model.needs); %> <div class="But green" style=""> <a href="." onclick="javascript:document.Results.submit();">Go</a> </div> <input type="submit" /> <%} %> Pressing the Submit button or the anchor both post back to the right ActionResult. However, when in the controller I return View(stuff..) only the Submit button will come back to the page. When the call finishes from pressing the anchor, I go to an error page informing me that the resource cannot be found. I suspect it has something to do with href="." but am unsure what to set it to.

    Read the article

  • JQuery tablesorter - Second click on column header doesn't resort

    - by Jonathan
    I'm using tablesorter in on a table I added to a view in django's admin (although I'm not sure this is relevant). I'm extending the html's header: {% block extrahead %} <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.js"></script> <script type="text/javascript" src="http://mysite.com/media/tablesorter/jquery.tablesorter.js"></script> <script type="text/javascript"> $(document).ready(function() { $("#myTable").tablesorter(); } ); </script> {% endblock %} When I click on a column header, it sorts the table using this column in descending order - that's ok. When I click the same column header a second time - it does not reorder to ascending order. What's wrong with it? the table's html looks like: <table id="myTable" border="1"> <thead> <tr> <th>column_name_1</th> <th>column_name_2</th> <th>column_name_3</th> </tr> </thead> <tbody> {% for item in extra.items %} <tr> <td>{{ item.0|safe }} </td> <td>{{ item.1|safe }} </td> <td>{{ item.2|safe }} </td> </tr> {% endfor %} </tbody> </table>

    Read the article

  • Indexing and Searching Over Word Level Annotation Layers in Lucene

    - by dmcer
    I have a data set with multiple layers of annotation over the underlying text, such as part-of-tags, chunks from a shallow parser, name entities, and others from various natural language processing (NLP) tools. For a sentence like The man went to the store, the annotations might look like: Word POS Chunk NER ==== === ===== ======== The DT NP Person man NN NP Person went VBD VP - to TO PP - the DT NP Location store NN NP Location I'd like to index a bunch of documents with annotations like these using Lucene and then perform searches across the different layers. An example of a simple query would be to retrieve all documents where Washington is tagged as a person. While I'm not absolutely committed to the notation, syntactically end-users might enter the query as follows: Query: Word=Washington,NER=Person I'd also like to do more complex queries involving the sequential order of annotations across different layers, e.g. find all the documents where there's a word tagged person followed by the words arrived at followed by a word tagged location. Such a query might look like: Query: "NER=Person Word=arrived Word=at NER=Location" What's a good way to go about approaching this with Lucene? Is there anyway to index and search over document fields that contain structured tokens?

    Read the article

  • Can someone tell me why this JavaScript code isn't lining up an array in order?

    - by DarkLightA
    Live code: http://jsfiddle.net/fCUZC/ //INPUT ARRAY: var input = [28,32,21,11,8,2,14,32,64]; //VARIABLE DECLARATION. a = highest number so far, b = position of that number entireLoop: for (var i = 1; i<=input.length; i++) { if(input[i] > input[i-1]) { for(var o = i; o>=0; o--) { if(input[i-1] > input[o]) { input.splice(i,0,input[o]); input.splice((o+1),1); continue entireLoop; } else if(input[o] > input[0]) { input.splice(0,0,input[o]); input.splice((o+1),1); continue entireLoop; } } } } document.write(input); I'm trying to order the array from largest to smallest, but there's a 32 stuck somewhere. I know there's the sort method, but I'm a newbie and want to try this for myself.

    Read the article

  • ASP.NET - Webservice not being called from javascript

    - by Robert
    Ok I'm stumped on this one. I've got a ASMX web service up and running. I can browse to it (~/Webservice.asmx) and see the .NET generated page and test it out.. and it works fine. I've got a page with a Script Manager with the webservice registered... and i can call it in javascript (Webservice.Method(...)) just fine. However, I want to use this Webservice as part of a jQuery Autocomplete box. So I have use the url...? and the Webservice is never being called. Here's the code. [WebService(Namespace = "http://tempuri.org/")] [WebServiceBinding(ConformsTo = WsiProfiles.BasicProfile1_1)] // To allow this Web Service to be called from script, using ASP.NET AJAX, uncomment the following line. [System.Web.Script.Services.ScriptService] public class User : System.Web.Services.WebService { public User () { //Uncomment the following line if using designed components //InitializeComponent(); } [WebMethod] public string Autocomplete(string q) { StringBuilder sb = new StringBuilder(); //doStuff return sb.ToString(); } web.config <system.web> <webServices> <protocols> <add name="HttpGet"/> <add name="HttpPost"/> </protocols> </webServices> And the HTML $(document).ready(function() { User.Autocomplete("rr", function(data) { alert(data); });//this works ("#<%=txtUserNbr.ClientID %>").autocomplete("/User.asmx/Autocomplete"); //doesn't work $.ajax({ url: "/User.asmx/Autocomplete", success: function() { alert(data); }, error: function(e) { alert(e); } }); //just to test... calls "error" function });

    Read the article

  • Add xml-stylesheet and get standalone = yes.

    - by tumba25
    The code at the bottom is what I have. I removed the creation of all tags. At the top in the xml file I get.<?xml version="1.0" encoding="UTF-8" standalone="no"?> Note that standalone is no, even thou I have it set to yes. The first question: How do I get standalone = yes? I would like to add <?xml-stylesheet type="text/xsl" href="my.stylesheet.xsl"?> at line two in the xml file. Second question: How do I do that? Some useful links? Anything? DocumentBuilderFactory dbfac = DocumentBuilderFactory.newInstance(); DocumentBuilder docBuilder = dbfac.newDocumentBuilder(); Document doc = docBuilder.newDocument(); <cut> TransformerFactory transfac = TransformerFactory.newInstance(); transfac.setAttribute("indent-number", new Integer(2)); Transformer trans = transfac.newTransformer(); trans.setOutputProperty(OutputKeys.OMIT_XML_DECLARATION, "no"); trans.setOutputProperty(OutputKeys.STANDALONE, "yes"); trans.setOutputProperty(OutputKeys.INDENT, "yes"); trans.setOutputProperty(OutputKeys.CDATA_SECTION_ELEMENTS, "name"); FileOutputStream fout = new FileOutputStream(filepath); BufferedOutputStream bout= new BufferedOutputStream(fout); trans.transform(new DOMSource(doc), new StreamResult(new OutputStreamWriter(bout, "utf-8")));

    Read the article

  • Generate custom RSS/Atom feed with SyndicationFeedFormatter made from XML

    - by Sentax
    I have followed this article and implemented my service and I can open the web browser and see the test data being published. I would like to create a custom formatted response, as for my needs this will not be published to the internet and it's an isolated feed that other devices on the local network could read to get the data I'm publishing. I'd like to create an XML document and publish it instead of using the SyndicationItem that is being used in the article to display title, author, description, etc. Would like to create something simple to be published: <MyData> <ID>33883</ID> <Title>The Name</Title> <Artist>The Artist</Artist> </MyData> I know how to create that in an XMLWriter, but how to publish in a SyndicationFeedFormatter that is the return type for the function in the article? I have seen the XmlSyndicationContent class but haven't seen any practical examples that would accomplish what I want to do.

    Read the article

  • Jquery Returning values to original

    - by Cam
    So my script works perfectly, but here is the issue, I have buttons (Sprite action here) that are 40px height, but the top 20 only shows perfectly. When you click the button ie img the bottom 20px show perfecto! but... Issue, i included in my script a way to return all others to there default (only one should be selected) now, how can I fix this issue that I seem unable to correct as I can select multiple of them ** USERS can switch ** The last part of the script that is the issue. Thanks $(document).ready(function() { $('.form_sub').hide(); $('.theader').addClass('active'); $('.theader_t').click(function() { $('.form_header').show(); $('.form_sub').hide(); $('.theader').addClass('active'); $('.sub_theader').removeClass('active'); }); $('.sub_theader_t').click(function() { $('.form_header').hide(); $('.form_sub').show(); $('.theader').removeClass('active'); $('.sub_theader').addClass('active'); }); $('.top_head_img').click(function() { $(this).css({ position: 'relative', bottom: '20px' }).siblings().css( 'bottom', '0' ); }); }); <ul class="top_head"> <li> <a href="javascript:void(0)" onClick="selectPic5('top');"><img src="custom/images/top2.jpg" alt="Left" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('center');"><img src="custom/images/mid2.jpg" alt="Center" border="0" class="top_head_img"/></a> </li> <li> <a href="javascript:void(0)" onClick="selectPic5('bottom');"><img src="custom/images/bot2.jpg" alt="Right" border="0" class="top_head_img"/></a> </li> </ul>

    Read the article

  • Embedding XSL Stylesheet into XML

    - by user700996
    I have the following XML: <?xml version="1.0" encoding="ISO-8859-1"?> <?xml-stylesheet type="text/xsl" href="http://www.fakedomain.com/sally.xsl"?> And the following content in sally.xsl: <?xml version="1.0" encoding="ISO-8859-1"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <html> <body> <xsl:for-each select="documentcollection/document"> <p> <xsl:for-each select="rss/channel/item"> <xsl:value-of select="title"/><br /> <xsl:value-of select="description"/><br /> <xsl:value-of select="link"/><br /> </xsl:for-each> </p> </xsl:for-each> </body> </html> </xsl:template> </xsl:stylesheet> However, the browser displays the XML as though the XSL line is not present. Do you know why the browser is ignoring the XSL stylesheet? Is the style sheet wrong? Thanks

    Read the article

  • Problem uploading app to google app engine

    - by Oberon
    I'm having problems uploading an app to the google-app-engine from my work place. I believe the problem is related to proxy, because I do not see the same problem when following the same procedure from home. (I do not specify HTTP_PROXY from home). These are the commands I run: HTTP_PROXY=http://proxy.<thehostname>.com:8080 HTTP_PROXY=https://proxy.<thehostname>.com:8080 appcfg.py --insecure update myappfolder When running the commands I get prompted for email and password, as expected, but after that it immediately exits with this errormessage: Error 302: --- begin server output --- <HTML> <HEAD> <TITLE>Moved Temporarily</TITLE> </HEAD> <BODY BGCOLOR="#FFFFFF" TEXT="#000000"> <H1>Moved Temporarily</H1> The document has moved <A HREF="https://www.google.com/accounts/ClientLogin">here</A>. </BODY> </HTML> --- end server output --- Note: I added the --insecure option because else it gave a warning of missing ssl module. Any idea how to solve or workaround this problem?

    Read the article

  • Why don't copy this dokument attributes from the source xml file??

    - by siegfried storr
    Hi anyone, i'm working the first time with xslt and i really don't understand why this xsl don't copy attributes from the source xml. Perhaps someone can give me a hint?? <xsl:stylesheet version="2.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:output omit-xml-declaration="yes" indent="yes"/> <xsl:variable name="rpl" select="document('ParamInvoice.xml')"/> <xsl:template match="/"> <xsl:copy> <xsl:apply-templates select="* | @*"/> </xsl:copy> </xsl:template> <xsl:template match="*"> <xsl:variable name="vInvoiceElement" select="$rpl/StoraInvoice/*[name()=name(current())]"/> <xsl:copy> <xsl:if test="$vInvoiceElement/Attribute"> <xsl:call-template name="AttributeErzeugen"> <xsl:with-param name="pAttr" select="$vInvoiceElement/Attribute"/> </xsl:call-template> </xsl:if> <xsl:apply-templates/> </xsl:copy> </xsl:template> <xsl:template name="AttributeErzeugen"> <xsl:param name="pAttr"/> <xsl:for-each select="$pAttr"> <xsl:attribute name="{@name}"><xsl:value-of select="."/></xsl:attribute> </xsl:for-each> </xsl:template> </xsl:stylesheet>

    Read the article

  • Opening a xul file in response to a toolbar extension button click

    - by Graham
    I'm currently building my first Firefox extension, and am having a little difficulty with one piece of functionality. I'd like to open a new browser tab in response to a button click on the toolbar. The new tab should contain the contents of a webpage, together with some extra buttons. At the moment I've created a separate xul file for the contents of the new tab: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <window id="myapp-report-window" title="Example 4.5.1" xmlns:html="http://www.w3.org/1999/xhtml" xmlns="http://www.mozilla.org/keymaster/gatekeeper/there.is.only.xul"> <script type="application/x-javascript" src="chrome://myapp/content/main.js" /> <toolbox> <toolbar id="nav-toolbar"> <toolbarbutton label="This-is-going-to-do-some-stuff"/> </toolbar> </toolbox> <iframe id="myapp-report-frame" flex="1"/> <script type="text/javascript"> function loadPage(url){ document.getElementById('myapp-report-frame').setAttribute('src',url); } </script> </window> This xul file is launched via this javascript, referenced from the main myapptoolbar.xul: gBrowser.selectedTab = gBrowser.addTab('chrome://myapp/content/report.xul'); var newTabBrowser = gBrowser.getBrowserForTab(gBrowser.selectedTab); newTabBrowser.addEventListener("load", function(){ loadPage('http://www.somedynamicallysetwebsite.com'); }, true); The problem that I'm having is that the loadPage function is not being found, so the src attribute of the iframe is never set. I'm sure it's some silly scoping problem, but I'm very new to firefox extensions (day 2!) so any help would be much appreciated. Thanks for looking! Graham

    Read the article

  • Returning an integer from a select box - JavaScript

    - by Ross
    Very simply, I want to be able to access the year from the select box as an integer. In my test, my alertbox is telling me the value is undefined. <form name="form1" method="post" action=""> <label>birth year <select name="birth year" id="dueYear"> <OPTION VALUE='' SELECTED>--Year--</OPTION> <OPTION VALUE='2011'>2011</OPTION> <OPTION VALUE='2010'>2010</OPTION> <OPTION VALUE='2009'>2009</OPTION></SELECT> </select> </label> </form> <script type="text/javascript"> var dueDateYear = parseInt(document.getElementById("dueYear")); </script> <button onclick="alert(dueDateYear)">Click Me!</button> All I want it to do, is tell me the year I have selected -- any help would be appreciated, I am a newbie :(

    Read the article

  • Testing approach for multi-threaded software

    - by Shane MacLaughlin
    I have a piece of mature geospatial software that has recently had areas rewritten to take better advantage of the multiple processors available in modern PCs. Specifically, display, GUI, spatial searching, and main processing have all been hived off to seperate threads. The software has a pretty sizeable GUI automation suite for functional regression, and another smaller one for performance regression. While all automated tests are passing, I'm not convinced that they provide nearly enough coverage in terms of finding bugs relating race conditions, deadlocks, and other nasties associated with multi-threading. What techniques would you use to see if such bugs exist? What techniques would you advocate for rooting them out, assuming there are some in there to root out? What I'm doing so far is running the GUI functional automation on the app running under a debugger, such that I can break out of deadlocks and catch crashes, and plan to make a bounds checker build and repeat the tests against that version. I've also carried out a static analysis of the source via PC-Lint with the hope of locating potential dead locks, but not had any worthwhile results. The application is C++, MFC, mulitple document/view, with a number of threads per doc. The locking mechanism I'm using is based on an object that includes a pointer to a CMutex, which is locked in the ctor and freed in the dtor. I use local variables of this object to lock various bits of code as required, and my mutex has a time out that fires my a warning if the timeout is reached. I avoid locking where possible, using resource copies where possible instead. What other tests would you carry out?

    Read the article

  • add dynamic field near his parent field?

    - by Kaps Hasija
    hi in my web page i am using Add Dynamic Field Functionality by using jquery. I am adding new div bu clicking on Existing div Like <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> by clicking on parent div i am creating new daynamic div <div class="divA">DivA2 </div> its coming end of the all div's like that <div class="divA">divA1 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> <div class="divA">DivA2 </div> But i need along with his parent div Like that <div class="divA">divA1 </div> <div class="divA">DivA2 </div> <div class="divB" >DivB1 </div> <div class="divC" />DivC1 </div> any idea Thanks. This is My Jquery Code newTextBoxDiv = $(document.createElement('div')) .attr("id", text).attr("class", 'test0 ' + text); newTextBoxDiv.html('<div style=" width:150px; class="DivA" float: left"> </div>'); } newTextBoxDiv.appendTo("#contents"); contents is id of main div

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

< Previous Page | 669 670 671 672 673 674 675 676 677 678 679 680  | Next Page >