Search Results

Search found 12267 results on 491 pages for 'memory'.

Page 464/491 | < Previous Page | 460 461 462 463 464 465 466 467 468 469 470 471  | Next Page >

  • Differences between matrix implementation in C

    - by tempy
    I created two 2D arrays (matrix) in C in two different ways. I don't understand the difference between the way they're represented in the memory, and the reason why I can't refer to them in the same way: scanf("%d", &intMatrix1[i][j]); //can't refer as &intMatrix1[(i * lines)+j]) scanf("%d", &intMatrix2[(i * lines)+j]); //can't refer as &intMatrix2[i][j]) What is the difference between the ways these two arrays are implemented and why do I have to refer to them differently? How do I refer to an element in each of the arrays in the same way (?????? in my printMatrix function)? int main() { int **intMatrix1; int *intMatrix2; int i, j, lines, columns; lines = 3; columns = 2; /************************* intMatrix1 ****************************/ intMatrix1 = (int **)malloc(lines * sizeof(int *)); for (i = 0; i < lines; ++i) intMatrix1[i] = (int *)malloc(columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix1[%d][%d]\t", i, j); scanf("%d", &intMatrix1[i][j]); } } /************************* intMatrix2 ****************************/ intMatrix2 = (int *)malloc(lines * columns * sizeof(int)); for (i = 0; i < lines; ++i) { for (j = 0; j < columns; ++j) { printf("Type a number for intMatrix2[%d][%d]\t", i, j); scanf("%d", &intMatrix2[(i * lines)+j]); } } /************** printing intMatrix1 & intMatrix2 ****************/ printf("intMatrix1:\n\n"); printMatrix(*intMatrix1, lines, columns); printf("intMatrix2:\n\n"); printMatrix(intMatrix2, lines, columns); } /************************* printMatrix ****************************/ void printMatrix(int *ptArray, int h, int w) { int i, j; printf("Printing matrix...\n\n\n"); for (i = 0; i < h; ++i) for (j = 0; j < w; ++j) printf("array[%d][%d] ==============> %d\n, i, j, ??????); }

    Read the article

  • Saving data in custom class via AppDelegate

    - by redspike
    I can't seem to save data to a custom instance object in my AppDelegate. My custom class is very simple and is as follows: Person.h ... @interface Person : NSObject { int _age; } - (void) setAge: (int) age; - (int) age; @end Person.m #import "Person.h" @implementation Person - (void) setAge:(int) age { _age = age; } - (int) age { return _age; } @end I then create an instance of Person in the AppDelegate class: AppDelegate.h @class Person; @interface AccuTaxAppDelegate : NSObject <UIApplicationDelegate> { ... Person *person; } ... @property (nonatomic, retain) Person *person; @end AppDelegate.m ... #import "Person.h" @implementation AccuTaxAppDelegate ... @synthesize person; - (void)applicationDidFinishLaunching:(UIApplication *)application { // Override point for customization after app launch [window addSubview:[navigationController view]]; [window makeKeyAndVisible]; } - (void)applicationWillTerminate:(UIApplication *)application { // Save data if appropriate } #pragma mark - #pragma mark Memory management - (void)dealloc { [navigationController release]; [window release]; [person release]; [super dealloc]; } @end Finally, in my ViewController code I grab a handle on AppDelegate and then grab the person instance, but when I try to save the age it doesn't seem to work: MyViewController ... - (void)textFieldDidEndEditing:(UITextField *)textField { NSString *textAge = [textField text]; int age = [textAge intValue]; NSLog(@"Age from text field::%i", age); AppDelegate *appDelegate = (AppDelegate *)[UIApplication sharedApplication].delegate; Person *myPerson = (Person *)[appDelegate person]; NSLog(@"Age before setting: %i", [myPerson age]); [myPerson setAge:age]; NSLog(@"Age after setting: %i", [myPerson age]); [textAge release]; } ... The output of the above NSLogs are: [Session started at 2010-05-04 18:29:22 +0100.] 2010-05-04 18:29:28.260 AccuTax[16235:207] Age in text field:25 2010-05-04 18:29:28.262 AccuTax[16235:207] Age before setting: 0 2010-05-04 18:29:28.263 AccuTax[16235:207] Age after setting: 0 Any ideas why 'age' isn't being stored? I'm relatively new to Obj-C so please forgive me if I'm missing something very simple!

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Few iPhone noob questions

    - by mshsayem
    Why should I declare local variables as 'static' inside a method? Like: static NSString *cellIdentifier = @"Cell"; Is it a performance advantage? (I know what 'static' does; in C context) What does this syntax mean?[someObj release], someObj = nil; Two statements? Why should I assign nil again? Is not 'release' enough? Should I do it for all objects I allocate/own? Or for just view objects? Why does everyone copy NSString, but retains other objects (in property declaration)? Yes, NSStrings can be changed, but other objects can be changed also, right? Then why 'copy' for just NSString, not for all? Is it just a defensive convention? Shouldn't I release constant NSString? Like here:NSString *CellIdentifier = @"Cell"; Why not? Does the compiler allocate/deallocate it for me? In some tutorial application I observed these (Built with IB): Properties(IBOutlet, with same ivar name): window, someLabel, someTextField, etc etc... In the dealloc method, although the window ivar was released, others were not. My question is: WHY? Shouldn't I release other ivars(labels, textField) as well? Why not? Say, I have 3 cascaded drop-down lists. I mean, based on what is selected on the first list, 2nd list is populated and based on what is selected on the second list, 3rd list is populated. What UI components can reflect this best? How is drop-down list presented in iPhone UI? Tableview with UIPicker? When should I update the 2nd, 3rd list? Or just three labels which have touch events? Can you give me some good example tutorials about Core-Data? (Not just simple data fetching and storing on 2/3 tables with 1/2 relationship) How can I know whether my app is leaking memory? Any tools?

    Read the article

  • Getting instance crashes on IntelliJ IDEA with scala plugin.

    - by egervari
    I am building a scala web project using scala test, lift, jpa, hibernate, mercurial plugin, etc. I am getting instant crashes, where the ide just bombs, the window shuts down, and it gives no error messages whatsoever when I am doing any amount of copy/pasting of code. This started happening once my project got to about 100 unit tests. This problem is incredibly annoying, because when the crash happens, 30-60 seconds of activity is not saved. Even IDEA will forget which files were last opened and will forget where the cursor was, which makes it really hard to continue where you left off after the crash. A lot can happen in 60 seconds! Now, I've given up, because it seems like all sorts of things cause the IntelliJ IDEA to crash over and over. For example, if I were to copy and paste this code, to write a similar test for another collection type, it would crash shortly after: it should "cascade save and delete status messages" in { val statusMessage = new StatusMessage("message") var user = userDao.find(1).get user.addToStatusMessages(statusMessage) userDao.save(user) statusMessage.isPersistent should be (true) userDao.delete(user) statusMessageDao.find(statusMessage.id) should equal (None) } There is nothing special about this piece of code. It's code that is working just fine. However, IDEA bombs shortly after I paste something like this. For example, I might change StatusMessage to the new class I want to test cascading on... and then have to import that class into the test... and BOOM... it crashed. On windows 7, the IDEA window literally just minimizes and crashes with no warning. The next time I startup IDEA, it has no memory of what happened. Now, I've had this problem before. I posted it way back on IDEA's YouTrack. I was told to invalidate my caches. That never fixed it then, and it's not fixing it now. Please help. This error is fairly random, but it's happening constantly now. I could program for hours and not see it before... and the fact that my work just gets destroyed and I can't remember what I did during the last minute causes me to swear at my monitor at a db level higher than my stereo can go.

    Read the article

  • IEnumerable<T> ToArray usage, is it a copy or a pointer?

    - by Daniel
    I am parsing an arbitrary length byte array that is going to be passed around to a few different layers of parsing. Each parser creates a Header and a Packet payload just like any ordinary encapsulation. And my problem lies in how the encapsulation holds its packet byte array payload. Say i have a 100 byte array, and it has 3 levels of encapsulation. 3 packet objects will be created and i want to set the payload of these packets to the corresponding position in the byte array of the packet. For example lets say the payload size is 20 for all levels, then imagine it has a public byte[] Payload on each object. However the problem is that this byte[] Payload is a copy of the original 100 bytes. So i'm going to end up with 160 bytes in memory instead of 100. If it were in c++ i could just easily use a pointer however i'm writing this in c#. So i created the following class: public class PayloadSegment<T> : IEnumerable<T> { public readonly T[] Array; public readonly int Offset; public readonly int Count; public PayloadSegment(T[] array, int offset, int count) { this.Array = array; this.Offset = offset; this.Count = count; } public T this[int index] { get { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else return Array[Offset + index]; } set { if (index < 0 || index >= this.Count) throw new IndexOutOfRangeException(); else Array[Offset + index] = value; } } public IEnumerator<T> GetEnumerator() { for (int i = Offset; i < Offset + Count; i++) yield return Array[i]; } System.Collections.IEnumerator System.Collections.IEnumerable.GetEnumerator() { IEnumerator<T> enumerator = this.GetEnumerator(); while (enumerator.MoveNext()) { yield return enumerator.Current; } } } This way i can simply reference a position inside the original byte array but use positional indexing. However if i do something like: PayloadSegment<byte> something = new PayloadSegment<byte>(someArray, 5, 10); byte[] somethingArray = something.ToArray(); Will the somethingArray be a copy of the bytes, or a reference to the original PayloadSegment which in turn is a reference to the original byte array? Sorry it was hard to word this lol _<

    Read the article

  • writing XML with Xerces 3.0.1 and C++ on windows

    - by Jon
    Hi, i have the following function i wrote to create an XML file using Xerces 3.0.1, if i call this function with a filePath of "foo.xml" or "../foo.xml" it works great, but if i pass in "c:/foo.xml" then i get an exception on this line XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); can someone explain why my code works for relative paths, but not absolute paths please? many thanks. const int ABSOLUTE_PATH_FILENAME_PREFIX_SIZE = 9; void OutputXML(xercesc::DOMDocument* pmyDOMDocument, std::string filePath) { //Return the first registered implementation that has the desired features. In this case, we are after a DOM implementation that has the LS feature... or Load/Save. DOMImplementation *implementation = DOMImplementationRegistry::getDOMImplementation(L"LS"); // Create a DOMLSSerializer which is used to serialize a DOM tree into an XML document. DOMLSSerializer *serializer = ((DOMImplementationLS*)implementation)->createLSSerializer(); // Make the output more human readable by inserting line feeds. if (serializer->getDomConfig()->canSetParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true)) serializer->getDomConfig()->setParameter(XMLUni::fgDOMWRTFormatPrettyPrint, true); // The end-of-line sequence of characters to be used in the XML being written out. serializer->setNewLine(XMLString::transcode("\r\n")); // Convert the path into Xerces compatible XMLCh*. XMLCh *tempFilePath = XMLString::transcode(filePath.c_str()); // Calculate the length of the string. const int pathLen = XMLString::stringLen(tempFilePath); // Allocate memory for a Xerces string sufficent to hold the path. XMLCh *targetPath = (XMLCh*)XMLPlatformUtils::fgMemoryManager->allocate((pathLen + ABSOLUTE_PATH_FILENAME_PREFIX_SIZE) * sizeof(XMLCh)); // Fixes a platform dependent absolute path filename to standard URI form. XMLString::fixURI(tempFilePath, targetPath); // Specify the target for the XML output. XMLFormatTarget *formatTarget = new LocalFileFormatTarget(targetPath); //XMLFormatTarget *myFormTarget = new StdOutFormatTarget(); // Create a new empty output destination object. DOMLSOutput *output = ((DOMImplementationLS*)implementation)->createLSOutput(); // Set the stream to our target. output->setByteStream(formatTarget); // Write the serialized output to the destination. serializer->write(pmyDOMDocument, output); // Cleanup. serializer->release(); XMLString::release(&tempFilePath); delete formatTarget; output->release(); }

    Read the article

  • Multi-tier applications using L2S, WCF and Base Class

    - by Gena Verdel
    Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

  • How do I create a thread-safe write-once read-many value in Java?

    - by Software Monkey
    This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

    Read the article

  • Using XmlDiffPatch when writing to stream

    - by Mark Smith
    I am trying to use xmldiffpatch when comparing two Xmls(one from a stream, the other from a file) and writing the diff patch to a stream. The first method is to write my xml to a memory stream. The second method loads an xml from a file and creates a stream for the patched file to be written into. The third method actually compares the two files and writes the third. The xmldiff.Compare(originalFile, finalFile, dgw); method takes (XmlReader, XmlReader, XmlWriter). I'm always getting that both files are identical, even though they are not, so I know that I am missing something. Any help is appreciated! public MemoryStream FirstXml() { string[] names = { "John", "Mohammed", "Marc", "Tamara", "joy" }; MemoryStream ms = new MemoryStream(); XmlTextWriter xtw= new XmlTextWriter(ms, Encoding.UTF8); xtw.WriteStartDocument(); xtw.WriteStartElement("root"); foreach (string s in names) { xtw.WriteStartElement(s); xtw.WriteEndElement(); } xtw.WriteEndElement(); xtw.WriteEndDocument(); return ms; } public Stream SecondXml() { XmlReader finalFile =XmlReader.Create(@"c:\......\something.xml"); MemoryStream ms = FirstXml(); XmlReader originalFile = XmlReader.Create(ms); MemoryStream ms2 = new MemoryStream(); XmlTextWriter dgw = new XmlTextWriter(ms2, Encoding.UTF8); GenerateDiffGram(originalFile, finalFile, dgw); return ms2; } public void GenerateDiffGram(XmlReader originalFile, XmlReader finalFile, XmlWriter dgw) { XmlDiff xmldiff = new XmlDiff(); bool bIdentical = xmldiff.Compare(originalFile, finalFile, dgw); dgw.Close(); StreamReader sr = new StreamReader(SecondXml()); string xmlOutput = sr.ReadToEnd(); if(xmlOutput.Contains("</xd:xmldiff>")) {Console.WriteLine("Xml files are not identical"); Console.Read();} else {Console.WriteLine("Xml files are identical");Console.Read();} }

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • How to solve High Load average issue in Linux systems?

    - by RoCkStUnNeRs
    The following is the different load with cpu time in different time limit . The below output has parsed from the top command. TIME LOAD US SY NICE ID WA HI SI ST 12:02:27 208.28 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:23:22 195.48 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:34:55 199.15 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 13:41:50 203.66 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st 13:42:58 278.63 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st Following is the additional Information of the system? cat /proc/cpuinfo processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 0 cpu cores : 4 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4658.69 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 1 cpu cores : 4 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 2 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 2 cpu cores : 4 apicid : 2 initial apicid : 2 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 3 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 3 cpu cores : 4 apicid : 3 initial apicid : 3 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4654.99 clflush size : 64 power management: Memory: total used free shared buffers cached Mem: 2 1 1 0 0 0 Swap: 5 0 5 let me know why the system is getting abnormally this much high load?

    Read the article

  • getting Cannot identify image file when trying to create thumbnail in django

    - by Mo J. Mughrabi
    Am trying to create a thumbnail in django, am trying to build a custom class specifically to be used for generating thumbnails. As following from StringIO import StringIO from PIL import Image class Thumbnail(object): source = '' size = (50, 50) output = '' def __init__(self): pass @staticmethod def load(src): self = Thumbnail() self.source = src return self def generate(self, size=(50, 50)): if not isinstance(size, tuple): raise Exception('Thumbnail class: The size parameter must be an instance of a tuple.') self.size = size # resize properties box = self.size factor = 1 fit = True image = Image.open(self.source) # Convert to RGB if necessary if image.mode not in ('L', 'RGB'): image = image.convert('RGB') while image.size[0]/factor > 2*box[0] and image.size[1]*2/factor > 2*box[1]: factor *=2 if factor > 1: image.thumbnail((image.size[0]/factor, image.size[1]/factor), Image.NEAREST) #calculate the cropping box and get the cropped part if fit: x1 = y1 = 0 x2, y2 = image.size wRatio = 1.0 * x2/box[0] hRatio = 1.0 * y2/box[1] if hRatio > wRatio: y1 = int(y2/2-box[1]*wRatio/2) y2 = int(y2/2+box[1]*wRatio/2) else: x1 = int(x2/2-box[0]*hRatio/2) x2 = int(x2/2+box[0]*hRatio/2) image = image.crop((x1,y1,x2,y2)) #Resize the image with best quality algorithm ANTI-ALIAS image.thumbnail(box, Image.ANTIALIAS) # save image to memory temp_handle = StringIO() image.save(temp_handle, 'png') temp_handle.seek(0) self.output = temp_handle return self def get_output(self): return self.output.read() the purpose of the class is so i can use it inside different locations to generate thumbnails on the fly. The class works perfectly, I've tested it directly under a view.. I've implemented the thumbnail class inside the save method of the forms to resize the original images on saving. in my design, I have two fields for thumbnails. I was able to generate one thumbnail, if I try to generate two it crashes and I've been stuck for hours not sure whats the problem. Here is my model class Image(models.Model): article = models.ForeignKey(Article) title = models.CharField(max_length=100, null=True, blank=True) src = models.ImageField(upload_to='publication/image/') r128 = models.ImageField(upload_to='publication/image/128/', blank=True, null=True) r200 = models.ImageField(upload_to='publication/image/200/', blank=True, null=True) uploaded_at = models.DateTimeField(auto_now=True) Here is my forms class ImageForm(models.ModelForm): """ """ class Meta: model = Image fields = ('src',) def save(self, commit=True): instance = super(ImageForm, self).save(commit=True) file = Thumbnail.load(instance.src) instance.r128 = SimpleUploadedFile( instance.src.name, file.generate((128, 128)).get_output(), content_type='image/png' ) instance.r200 = SimpleUploadedFile( instance.src.name, file.generate((200, 200)).get_output(), content_type='image/png' ) if commit: instance.save() return instance the strange part is, when i remove the line which contains instance.r200 in the form save. It works fine, and it does the thumbnail and stores it successfully. Once I add the second thumbnail it fails.. Any ideas what am doing wrong here? Thanks Update: I tried earlier doing the following but I still got the same error class ImageForm(models.ModelForm): """ """ class Meta: model = Image fields = ('src',) def save(self, commit=True): instance = super(ImageForm, self).save(commit=True) instance.r128 = SimpleUploadedFile( instance.src.name, Thumbnail.load(instance.src).generate((128, 128)).get_output(), content_type='image/png' ) instance.r200 = SimpleUploadedFile( instance.src.name, Thumbnail.load(instance.src).generate((200, 200)).get_output(), content_type='image/png' ) if commit: instance.save() return instance

    Read the article

  • Merge entries in XMLfile (SimpleXML in PHP)

    - by Cudos
    Hello. I have this in my XML file: <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> </options> </variant> </product> <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="White" /> </options> </variant> </product> I want to merge it into this (Note that I merge the options tag): <product name="iphone"> <variant name="iphone" product_number="12345" price="500" picture="iphone.jpg"> <description><![CDATA[iphone]]></description> <short_description><![CDATA[]]></short_description> <deliverytime><![CDATA[]]></deliverytime> <options> <option group="Color" option="Black" /> <option group="Color" option="White" /> </options> </variant> </product> Preferably I want to do it all in the memory since I will process it further afterwards.

    Read the article

  • Function returning MYSQL_ROW

    - by Gabe
    I'm working on a system using lots of MySQL queries and I'm running into some memory problems I'm pretty sure have to do with me not handling pointers right... Basically, I've got something like this: MYSQL_ROW function1() { string query="SELECT * FROM table limit 1;"; MYSQL_ROW return_row; mysql_init(&connection); // "connection" is a global variable if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&connection); else{ resp = mysql_store_result(&connection); //"resp" is also global if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error: " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And function2(): MYSQL_ROW function2(MYSQL_ROW row) { string query = "select * from table2 where code = '" + string(row[2]) + "'"; MYSQL_ROW retorno; mysql_init(&connection); if (mysql_real_connect(&connection,HOST,USER,PASS,DB,0,NULL,0)){ if (mysql_query(&connection,query.c_str())) cout << "Error: " << mysql_error(&conexao); else{ // My "debugging" shows me at this point `row[2]` is already fubar resp = mysql_store_result(&connection); if (resp) return_row = mysql_fetch_row(resp); mysql_free_result(resp); } mysql_close(&connection); }else{ cout << "connection failed\n"; if (mysql_errno(&connection)) cout << "Error : " << mysql_errno(&connection) << " " << mysql_error(&connection); } return return_row; } And main() is an infinite loop basically like this: int main( int argc, char* args[] ){ MYSQL_ROW row = NULL; while (1) { row = function1(); if(row != NULL) function2(row); } } (variable and function names have been generalized to protect the innocent) But after the 3rd or 4th call to function2, that only uses row for reading, row starts losing its value coming to a segfault error... Anyone's got any ideas why? I'm not sure the amount of global variables in this code is any good, but I didn't design it and only got until tomorrow to fix and finish it, so workarounds are welcome! Thanks!

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • [N]Hibernate: view-like fetching properties of associated class

    - by chiccodoro
    (Felt quite helpless in formulating an appropriate title...) In my C# app I display a list of "A" objects, along with some properties of their associated "B" objects and properties of B's associated "C" objects: A.Name B.Name B.SomeValue C.Name Foo Bar 123 HelloWorld Bar Hello 432 World ... To clarify: A has an FK to B, B has an FK to C. (Such as, e.g. BankAccount - Person - Company). I have tried two approaches to load these properties from the database (using NHibernate): A fast approach and a clean approach. My eventual question is how to do a fast & clean approach. Fast approach: Define a view in the database which joins A, B, C and provides all these fields. In the A class, define properties "BName", "BSomeValue", "CName" Define a hibernate mapping between A and the View, whereas the needed B and C properties are mapped with update="false" insert="false" and do actually stem from B and C tables, but Hibernate is not aware of that since it uses the view. This way, the listing only loads one object per "A" record, which is quite fast. If the code tries to access the actual associated property, "A.B", I issue another HQL query to get B, set the property and update the faked BName and BSomeValue properties as well. Clean approach: There is no view. Class A is mapped to table A, B to B, C to C. When loading the list of A, I do a double left-join-fetch to get B and C as well: from A a left join fetch a.B left join fetch a.B.C B.Name, B.SomeValue and C.Name are accessed through the eagerly loaded associations. The disadvantage of this approach is that it gets slower and takes more memory, since it needs to created and map 3 objects per "A" record: An A, B, and C object each. Fast and clean approach: I feel somehow uncomfortable using a database view that hides a join and treat that in NHibernate as if it was a table. So I would like to do something like: Have no views in the database. Declare properties "BName", "BSomeValue", "CName" in class "A". Define the mapping for A such that NHibernate fetches A and these properties together using a join SQL query as a database view would do. The mapping should still allow for defining lazy many-to-one associations for getting A.B.C My questions: Is this possible? Is it [un]artful? Is there a better way?

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • C - How to use both aio_read() and aio_write().

    - by Slav
    I implement game server where I need to both read and write. So I accept incoming connection and start reading from it using aio_read() but when I need to send something, I stop reading using aio_cancel() and then use aio_write(). Within write's callback I resume reading. So, I do read all the time but when I need to send something - I pause reading. It works for ~20% of time - in other case call to aio_cancel() fails with "Operation now in progress" - and I cannot cancel it (even within permanent while cycle). So, my added write operation never happens. How to use these functions well? What did I missed? EDIT: Used under Linux 2.6.35. Ubuntu 10 - 32 bit. Example code: void handle_read(union sigval sigev_value) { /* handle data or disconnection */ } void handle_write(union sigval sigev_value) { /* free writing buffer memory */ } void start() { const int acceptorSocket = socket(AF_INET, SOCK_STREAM, 0); struct sockaddr_in addr; memset(&addr, 0, sizeof(struct sockaddr_in)); addr.sin_family = AF_INET; addr.sin_addr.s_addr = INADDR_ANY; addr.sin_port = htons(port); bind(acceptorSocket, (struct sockaddr*)&addr, sizeof(struct sockaddr_in)); listen(acceptorSocket, SOMAXCONN); struct sockaddr_in address; socklen_t addressLen = sizeof(struct sockaddr_in); for(;;) { const int incomingSocket = accept(acceptorSocket, (struct sockaddr*)&address, &addressLen); if(incomingSocket == -1) { /* handle error ... */} else { //say socket to append outcoming messages at writing: const int currentFlags = fcntl(incomingSocket, F_GETFL, 0); if(currentFlags < 0) { /* handle error ... */ } if(fcntl(incomingSocket, F_SETFL, currentFlags | O_APPEND) == -1) { /* handle another error ... */ } //start reading: struct aiocb* readingAiocb = new struct aiocb; memset(readingAiocb, 0, sizeof(struct aiocb)); readingAiocb->aio_nbytes = MY_SOME_BUFFER_SIZE; readingAiocb->aio_fildes = socketDesc; readingAiocb->aio_buf = mySomeReadBuffer; readingAiocb->aio_sigevent.sigev_notify = SIGEV_THREAD; readingAiocb->aio_sigevent.sigev_value.sival_ptr = (void*)mySomeData; readingAiocb->aio_sigevent.sigev_notify_function = handle_read; if(aio_read(readingAiocb) != 0) { /* handle error ... */ } } } } //called at any time from server side: send(void* data, const size_t dataLength) { //... some thread-safety precautions not needed here ... const int cancellingResult = aio_cancel(socketDesc, readingAiocb); if(cancellingResult != AIO_CANCELED) { //this one happens ~80% of the time - embracing previous call to permanent while cycle does not help: if(cancellingResult == AIO_NOTCANCELED) { puts(strerror(aio_return(readingAiocb))); // "Operation now in progress" /* don't know what to do... */ } } //otherwise it's okay to send: else { aio_write(...); } }

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

< Previous Page | 460 461 462 463 464 465 466 467 468 469 470 471  | Next Page >