Search Results

Search found 21142 results on 846 pages for 'bit manipulation'.

Page 793/846 | < Previous Page | 789 790 791 792 793 794 795 796 797 798 799 800  | Next Page >

• How do you combine "Revision Control" with "WorkFlow" for R?

  - by Tal Galili

  Hello all, I remember coming across R users writing that they use "Revision control" (e.g: "Source control"), and I am curious to know: How do you combine "Revision control" with your statistical analysis WorkFlow? Two (very) interesting discussions talk about how to deal with the WorkFlow. But neither of them refer to the revision control element: http://stackoverflow.com/questions/1266279/how-to-organize-large-r-programs http://stackoverflow.com/questions/1429907/workflow-for-statistical-analysis-and-report-writing A Long Update To The Question: Following some of the people's answers, and Dirk's question in the comment, I would like to direct my question a bit more. After reading the Wiki article about "revision control" (which I was previously not familiar with), it was clear to me that when using revision control, what one does is to build a development structure of his code. This structure either leads to a "final product" or to several branches. When building something like, let's say, a website. There is usually one end product you work towards (the website), with some prototypes along the way. But when doing a statistical analysis, the work (to my view) is different. Sometimes you know where you want to get to. But more often, you explore. Explore cleaning the dataset. Explore different methods for statistical analysis, and ask various questions of your data (and I am writing this, knowing how Frank Harrell, and other experience statisticians feels about Data dredging). That is way the WorkFlow question with statistical programming is (in my view) a serious and deep question, raising many issues, The simpler ones are technical: Which revision control software do you use (and why) ? Which IDE do you use(and why) ? The more interesting question are about work process: How do you structure your files? What do you keep as a separate file and what as a revision? or asking in a different way - What should be a "branch" and what should be a "sub project" in your code? For example: When starting to explore your data, should a plot be creating and then erased because it didn't lead any where (but kept as a revision) or should there be a backup file of that path? How you solve this tension was my initial curiosity. The second question is "what might I be missing?". What rules (of thumb) should one follow so to avoid common pitfalls doing statistical programming with version control? In my intuition, I feel that statistical programming is inherently different then software development (I am writing this without being a real expert in statistical programming, and even less so in software development). That's way I am unsure which of the lessons I have read here about version control would be applicable. Thanks a lot, Tal

  Read the article

• Is this implementation truely tail-recursive?

  - by CFP

  Hello everyone! I've come up with the following code to compute in a tail-recursive way the result of an expression such as 3 4 * 1 + cos 8 * (aka 8*cos(1+(3*4))) The code is in OCaml. I'm using a list refto emulate a stack. type token = Num of float | Fun of (float->float) | Op of (float->float->float);; let pop l = let top = (List.hd !l) in l := List.tl (!l); top;; let push x l = l := (x::!l);; let empty l = (l = []);; let pile = ref [];; let eval data = let stack = ref data in let rec _eval cont = match (pop stack) with | Num(n) -> cont n; | Fun(f) -> _eval (fun x -> cont (f x)); | Op(op) -> _eval (fun x -> cont (op x (_eval (fun y->y)))); in _eval (fun x->x) ;; eval [Fun(fun x -> x**2.); Op(fun x y -> x+.y); Num(1.); Num(3.)];; I've used continuations to ensure tail-recursion, but since my stack implements some sort of a tree, and therefore provides quite a bad interface to what should be handled as a disjoint union type, the call to my function to evaluate the left branch with an identity continuation somehow irks a little. Yet it's working perfectly, but I have the feeling than in calling the _eval (fun y->y) bit, there must be something wrong happening, since it doesn't seem that this call can replace the previous one in the stack structure... Am I misunderstanding something here? I mean, I understand that with only the first call to _eval there wouldn't be any problem optimizing the calls, but here it seems to me that evaluation the _eval (fun y->y) will require to be stacked up, and therefore will fill the stack, possibly leading to an overflow... Thanks!

  Read the article

• Check my anagram code from a job interview in the past.

  - by Michael Dorgan

  Had the following as an interview question a while ago and choked so bad on basic syntax that I failed to advance (once the adrenalin kicks in, coding goes out the window.) Given a list of string, return a list of sets of strings that are anagrams of the input set. i.e. "dog","god", "foo" should return {"dog","god"}. Afterward, I created the code on my own as a sanity check and it's been around now for a bit. I'd welcome input on it to see if I missed anything or if I could have done it much more efficiently. Take it as a chance to improve myself and learn other techniques: void Anagram::doWork(list input, list &output) { typedef list SortType; SortType sortedInput; // sort each string and pair it with the original for(list<string>::iterator i = input.begin(); i != input.end(); ++i) { string tempString(*i); std::sort(tempString.begin(), tempString.end()); sortedInput.push_back(make_pair(*i, tempString)); } // Now step through the new sorted list for(SortType::iterator i = sortedInput.begin(); i != sortedInput.end();) { set<string> newSet; // Assume (hope) we have a match and pre-add the first. newSet.insert(i->first); // Set the secondary iterator one past the outside to prevent // matching the original SortType::iterator j = i; ++j; while(j != sortedInput.end()) { if(i->second == j->second) { // If the string matches, add it to the set and remove it // so that future searches need not worry about it newSet.insert(j->first); j = sortedInput.erase(j); } else { // else, next element ++j; } } // If size is bigger than our original push, we have a match - save it to the output if(newSet.size() > 1) { output.push_back(newSet); } // erase this element and update the iterator i = sortedInput.erase(i); } }

  Read the article

• dynamic module creation

  - by intuited

  I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

  Read the article

• Android - cant read TXT files from SDcard on real mashine?

  - by JustMe

  Hello! When I run the code bellow in the virtual android (1.5) it works well, TextSwitcher shows first 80 chars from each txt file from /sdcard/documents/ , but when I run it on my Samsung Galaxy i7500 (1.6) there are no contents in TextSwitcher, however in LogCat there are FileNames of txt files. My Code: public void getTxtFiles(){ //Scan /sdcard/documents and put .txt files in array File TxtFiles[] String path = Environment.getExternalStorageDirectory().toString()+"/documents/"; String files; File folder = new File(path); if(folder.exists()==false){if (!folder.mkdirs()) { Log.e("TAG", "Create dir in sdcard failed"); return; }} else{ File listOfFiles[] = folder.listFiles(); for (int i = 0; i < listOfFiles.length; i++) { if (listOfFiles[i].isFile()) { files = listOfFiles[i].getName(); if (files.endsWith(".txt") || files.endsWith(".TXT")) { if((files.length()-1)>i){resizeArray(TxtFiles, files.length()+10);} TxtFiles[i]=listOfFiles[i]; System.out.println(TxtFiles[i]); } } }} } private void updateCounter(int Pozicija) { if(Pozicija<0){Toast.makeText(getApplicationContext(), R.string.LastTxt, 5).show(); mCounter++;} else if(TxtFiles[mCounter]!=null){ TextToShow = getContents(TxtFiles[mCounter]); if(TextToShow.length()>80)TextToShow=TextToShow.substring(0, 80); mSwitcher.setText(TextToShow); System.out.println(Pozicija); } else mCounter--; } static public String getContents(File aFile) { //...checks on aFile are elided StringBuilder contents = new StringBuilder(); try { //use buffering, reading one line at a time //FileReader always assumes default encoding is OK! BufferedReader input = new BufferedReader(new FileReader(aFile)); try { String line = null; //not declared within while loop /* * readLine is a bit quirky : * it returns the content of a line MINUS the newline. * it returns null only for the END of the stream. * it returns an empty String if two newlines appear in a row. */ while (( line = input.readLine()) != null){ contents.append(line); contents.append(System.getProperty("line.separator")); } } finally { input.close(); } } catch (IOException ex){ ex.printStackTrace(); } return contents.toString(); } And I am able to write contents of those files though LogCat! Any ideas?

  Read the article

• Using Core Data Concurrently and Reliably

  - by John Topley

  I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

  Read the article

• Converting C source to C++

  - by Barry Kelly

  How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

  Read the article

• jQuery Validator's "required" not working when value is set at statup

  - by nandrew

  Hello, I have a problem with jQuery Validator. I want to use "required" property on a text input. It doesn't work when input has set value attribute by HTML code (tested on Firefox (3.5), and on IE 8 - on IE it works a bit better). Story: 1. Page loads; 2. value is cleared; 3. focus is changed. 4. Nothing happens but the error message should be displayed; 5. getting back to the field and typing some characters. 6. changing focus; 7. getting back to the field; 8. clearing the field. 9. Error is displayed even before leaving the field. The HTML code: <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml" > <head> <script src="Web/Scripts/jquery-1.3.2.min.js" type="text/javascript"></script> <script src="Web/Scripts/jquery.validate.js" type="text/javascript"></script> </head> <body> <form id="form1"> <input type="text" id="name1" name="name1" value="test" /><br /> <input type="text" /> </form> <script type="text/javascript"> $(document).ready(function() { var validator = $("form").validate({ rules: { name1: { required: true, minlength: 2 } }, messages: { name1: "bad name" }, }); }); </script> </body> </html>

  Read the article

• Need help simplifying my php table

  - by user342391

  I am relatively new to php and have a feeling that I am going the long way round when displaying data from mysql. I have a table a I want to show a few fields from my database. How would I achieve this without having to echo every bit of the table??? Here is the code: <?php $query1 = mysql_send("SELECT firstname, lastname, email, user, country FROM customers WHERE id='".$_COOKIE['custid']."'"); while ($row = mysql_fetch_array($query1)) { echo ' <table id="account_table" style="width:550px; border:none; "> <tr> <td width="155">Contact Name</td>'; echo '<td width="335">'; echo $row['firstname'] ; echo '&nbsp;'; echo $row['lastname']; echo '</td> </tr> <tr> <td>Email Address</td> <td>'; echo $row['email']; echo ' </td> </tr> <tr> <td>Username</td> <td>' ; echo $row['user']; echo '</td> </tr> <tr> <td>Country</td> <td>'; echo $row['country']; echo '</td> </tr> <tr> <td>Time Zone</td> <td>GMT+1</td> </tr> <tr> <td>Activated</td> <td>16 Dec 2009</td> </tr> </table>'; } ?>

  Read the article

• Web SITE publishing, dynamic compilation, smoke & mirrors

  - by tbehunin

  When you publish a web SITE in Visual Studio, in the dialog box that follows, you are given an option to "Allow this precompiled site to be updatable". According to MSDN, checking this option "specifies that all program code is compiled into assemblies, but that .aspx files (including single-file ASP.NET Web pages) are copied as-is to the target folder". With this option checked, you can update existing .aspx files as well as add new ones without any issue. When a page, that has either been updated or newly created, is requested, the page gets dynamically compiled at run-time and is then processed and returned to the user. If, on the other hand, you didn't check that checkbox during the publish phase, the .aspx files get compiled, along with the code-behind and App_Code files in separate assemblies. The .aspx files are then completely overwritten with a line of text that says: This is a marker file generated by the precompilation tool, and should not be deleted! You obviously can't edit an existing page in this scenario. If you were to ADD a new .aspx file to this site, you would get a .Net run-time error saying that the file hasn't been precompiled. With that background, my questions are these: Something must be able to determine that this website was published to be updatable (allow dynamic compilation) or not. If it was published as updatable, it must also be able to determine whether a file was changed or added, so it can do a dynamic compile. Who makes those determinations? IIS? ASP.NET worker process? HOW does it make those determinations? If I had the same website published in both of those scenarios, could I make a visual determination that one is updatable and the other is not? Is there some bit I can look at in the assemblies using Reflector to make that determination myself? In addition to answering those questions, what also might be helpful would be information on the process flow from when a resource is requested to when it starts being processed, not necessarily the ASP.NET Page Lifecycle, but what happens BEFORE ASP.Net worker process starts processing the page and firing off events. The dynamic compilation appears to be smoke and mirrors. Can someone demystify this for me?

  Read the article

• HTTP Post requests using HttpClient take 2 seconds, why?

  - by pableu

  Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

  Read the article

• How do I handle the Maybe result of at in Control.Lens.Indexed without a Monoid instance

  - by Matthias Hörmann

  I recently discovered the lens package on Hackage and have been trying to make use of it now in a small test project that might turn into a MUD/MUSH server one very distant day if I keep working on it. Here is a minimized version of my code illustrating the problem I am facing right now with the at lenses used to access Key/Value containers (Data.Map.Strict in my case) {-# LANGUAGE OverloadedStrings, GeneralizedNewtypeDeriving, TemplateHaskell #-} module World where import Control.Applicative ((<$>),(<*>), pure) import Control.Lens import Data.Map.Strict (Map) import qualified Data.Map.Strict as DM import Data.Maybe import Data.UUID import Data.Text (Text) import qualified Data.Text as T import System.Random (Random, randomIO) newtype RoomId = RoomId UUID deriving (Eq, Ord, Show, Read, Random) newtype PlayerId = PlayerId UUID deriving (Eq, Ord, Show, Read, Random) data Room = Room { _roomId :: RoomId , _roomName :: Text , _roomDescription :: Text , _roomPlayers :: [PlayerId] } deriving (Eq, Ord, Show, Read) makeLenses ''Room data Player = Player { _playerId :: PlayerId , _playerDisplayName :: Text , _playerLocation :: RoomId } deriving (Eq, Ord, Show, Read) makeLenses ''Player data World = World { _worldRooms :: Map RoomId Room , _worldPlayers :: Map PlayerId Player } deriving (Eq, Ord, Show, Read) makeLenses ''World mkWorld :: IO World mkWorld = do r1 <- Room <$> randomIO <*> (pure "The Singularity") <*> (pure "You are standing in the only place in the whole world") <*> (pure []) p1 <- Player <$> randomIO <*> (pure "testplayer1") <*> (pure $ r1^.roomId) let rooms = at (r1^.roomId) ?~ (set roomPlayers [p1^.playerId] r1) $ DM.empty players = at (p1^.playerId) ?~ p1 $ DM.empty in do return $ World rooms players viewPlayerLocation :: World -> PlayerId -> RoomId viewPlayerLocation world playerId= view (worldPlayers.at playerId.traverse.playerLocation) world Since rooms, players and similar objects are referenced all over the code I store them in my World state type as maps of Ids (newtyped UUIDs) to their data objects. To retrieve those with lenses I need to handle the Maybe returned by the at lens (in case the key is not in the map this is Nothing) somehow. In my last line I tried to do this via traverse which does typecheck as long as the final result is an instance of Monoid but this is not generally the case. Right here it is not because playerLocation returns a RoomId which has no Monoid instance. No instance for (Data.Monoid.Monoid RoomId) arising from a use of `traverse' Possible fix: add an instance declaration for (Data.Monoid.Monoid RoomId) In the first argument of `(.)', namely `traverse' In the second argument of `(.)', namely `traverse . playerLocation' In the second argument of `(.)', namely `at playerId . traverse . playerLocation' Since the Monoid is required by traverse only because traverse generalizes to containers of sizes greater than one I was now wondering if there is a better way to handle this that does not require semantically nonsensical Monoid instances on all types possibly contained in one my objects I want to store in the map. Or maybe I misunderstood the issue here completely and I need to use a completely different bit of the rather large lens package?

  Read the article

• Hibernate Communications Link Failure in Restlet-Hibernate Based Java application powered by MySQL

  - by Vatsala

  Let me describe my question - I have a Java application - Hibernate as the DB interfacing layer over MySQL. I get the communications link failure error in my application. The occurence of this error is a very specific case. I get this error , When I leave mysql server unattended for more than approximately 6 hours (i.e. when there are no queries issued to MySQL for more than approximately 6 hours). I am pasting a top 'exception' level description below, and adding a pastebin link for a detailed stacktrace description. javax.persistence.PersistenceException: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: org.hibernate.exception.JDBCConnectionException: Cannot open connection - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: com.mysql.jdbc.exceptions.jdbc4.CommunicationsException: Communications link failure - The last packet successfully received from the server was 1,274,868,181,212 milliseconds ago. The last packet sent successfully to the server was 0 milliseconds ago. - Caused by: java.net.ConnectException: Connection refused: connect the link to the pastebin for further investigation - http://pastebin.com/4KujAmgD What I understand from these exception statements is that MySQL is refusing to take in any connections after a period of idle/nil activity. I have been reading up a bit about this via google search, and came to know that one of the possible ways to overcome this is to set values for c3p0 properties as c3p0 comes bundled with Hibernate. Specifically, I read from here http://www.mchange.com/projects/c3p0/index.html that setting two properties idleConnectionTestPeriod and preferredTestQuery will solve this for me. But these values dont seem to have had an effect. Is this the correct approach to fixing this? If not, what is the right way to get over this? The following are related Communications Link Failure questions at stackoverflow.com, but I've not found a satisfactory answer in their answers. http://stackoverflow.com/questions/2121829/java-db-communications-link-failure http://stackoverflow.com/questions/298988/how-to-handle-communication-link-failure Note 1 - i dont get this error when I am using my application continuosly. Note 2 - I use JPA with Hibernate and hence my hibernate.dialect,etc hibernate properties reside within the persistence.xml in the META-INF folder (does that prevent the c3p0 properties from working?)

  Read the article

• deallocated memory in tableview: message sent to deallocated instance

  - by Kirn

  I tried looking up other issues but couldn't find anything to match so here goes: I'm trying to display text in the table view so I use this bit of code: // StockData is an object I created and it pulls information from Yahoo APIs based on // a stock ticker stored in NSString *heading NSArray* tickerValues = [heading componentsSeparatedByString:@" "]; StockData *chosenStock = [[StockData alloc] initWithContents:[tickerValues objectAtIndex:0]]; [chosenStock getData]; // Set up the cell... NSDictionary *tempDict = [chosenStock values]; NSArray *tempArr = [tempDict allValues]; cell.textLabel.text = [tempArr objectAtIndex:indexPath.row]; return cell; This is all under cellForRowAtIndexPath When I try to release the chosenStock object though I get this error: [CFDictionary release]: message sent to deallocated instance 0x434d3d0 Ive tried using NSZombieEnabled and Build and Analyze to detect problems but no luck thus far. Ive even gone so far as to comment bits and pieces of the code with NSLog but no luck. I'll post the code for StockData below this. As far as I can figure something is getting deallocated before I do the release but I'm not sure how. The only place I've got release in my code is under dealloc method call. Here's the StockData code: // StockData contains all stock information pulled in through Yahoo! to be displayed @implementation StockData @synthesize ticker, values; - (id) initWithContents: (NSString *)newName { if(self = [super init]){ ticker = newName; } return self; } - (void) getData { NSURL *url = [NSURL URLWithString: [NSString stringWithFormat:@"http://download.finance.yahoo.com/d/quotes.csv?s=%@&f=%@&e=.csv", ticker, @"chgvj1"]]; NSError *error; NSURLResponse *response; NSURLRequest *request = [NSURLRequest requestWithURL:url]; NSData *stockData = [NSURLConnection sendSynchronousRequest:request returningResponse:&response error:&error]; if(stockData) { NSString *tempStr = [[NSString alloc] initWithData:stockData encoding:NSASCIIStringEncoding]; NSArray *receivedValuesArr = [tempStr componentsSeparatedByString:@","]; [tempStr release]; values = [NSDictionary dictionaryWithObjects:receivedValuesArr forKeys:[@"change, high, low, volume, market" componentsSeparatedByString:@", "]]; } else { NSLog(@"Connection failed: %@", error); } } - (void)dealloc { [ticker release]; [values release]; [super dealloc]; NSLog(@"Release took place fine"); } @end

  Read the article

• GCC problem with raw double type comparisons

  - by Monomer

  I have the following bit of code, however when compiling it with GCC 4.4 with various optimization flags I get some unexpected results when its run. #include <iostream> int main() { const unsigned int cnt = 10; double lst[cnt] = { 0.0 }; const double v[4] = { 131.313, 737.373, 979.797, 731.137 }; for(unsigned int i = 0; i < cnt; ++i) { lst[i] = v[i % 4] * i; } for(unsigned int i = 0; i < cnt; ++i) { double d = v[i % 4] * i; if(lst[i] != d) { std::cout << "error @ : " << i << std::endl; return 1; } } return 0; } when compiled with: "g++ -pedantic -Wall -Werror -O1 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O2 -o test test.cpp" I get the following output: "error @ : 3" when compiled with: "g++ -pedantic -Wall -Werror -O3 -o test test.cpp" I get no errors when compiled with: "g++ -pedantic -Wall -Werror -o test test.cpp" I get no errors I do not believe this to be an issue related to rounding, or epsilon difference in the comparison. I've tried this with Intel v10 and MSVC 9.0 and they all seem to work as expected. I believe this should be nothing more than a bitwise compare. If I replace the if-statement with the following: if (static_cast<long long int>(lst[i]) != static_cast<long long int>(d)), and add "-Wno-long-long" I get no errors in any of the optimization modes when run. If I add std::cout << d << std::endl; before the "return 1", I get no errors in any of the optimization modes when run. Is this a bug in my code, or is there something wrong with GCC and the way it handles the double type?

  Read the article

• Does this incorporate JavaScript closures?

  - by alex

  In trying to learn JavaScript closures, I've confused myself a bit. From what I've gathered over the web, a closure is... Declaring a function within another function, and that inner function has access to its parent function's variables, even after that parent function has returned. Here is a small sample of script from a recent project. It allows text in a div to be scrolled up and down by buttons. var pageScroll = (function() { var $page, $next, $prev, canScroll = true, textHeight, scrollHeight; var init = function() { $page = $('#secondary-page'); // reset text $page.scrollTop(0); textHeight = $page.outerHeight(); scrollHeight = $page.attr('scrollHeight'); if (textHeight === scrollHeight) { // not enough text to scroll return false; }; $page.after('<div id="page-controls"><button id="page-prev">prev</button><button id="page-next">next</button></div>'); $next = $('#page-next'); $prev = $('#page-prev'); $prev.hide(); $next.click(scrollDown); $prev.click(scrollUp); }; var scrollDown = function() { if ( ! canScroll) return; canScroll = false; var scrollTop = $page.scrollTop(); $prev.fadeIn(500); if (scrollTop == textHeight) { // can we scroll any lower? $next.fadeOut(500); } $page.animate({ scrollTop: '+=' + textHeight + 'px'}, 500, function() { canScroll = true; }); }; var scrollUp = function() { $next.fadeIn(500); $prev.fadeOut(500); $page.animate({ scrollTop: 0}, 500); }; $(document).ready(init); }()); Does this example use closures? I know it has functions within functions, but is there a case where the outer variables being preserved is being used? Am I using them without knowing it? Thanks Update Would this make a closure if I placed this beneath the $(document).ready(init); statement? return { scrollDown: scrollDown }; Could it then be, if I wanted to make the text scroll down from anywhere else in JavaScript, I could do pageScroll.scrollDown(); I'm going to have a play around on http://www.jsbin.com and report back

  Read the article

• Javascript - Canvas image never appears on first function run

  - by Matt

  I'm getting a bit of a weird issue, the image never shows the first time you run the game in your browser, after that you see it every time. If you close your browser and re open it and run the game again, the same issue occurs - you don't see the image the first time you run it. Here's the issue in action, just hit a wall and there's no image the first time on the end game screen. Any help would be appreciated. Regards, Matt function showGameOver() { ctx.clearRect(0, 0, canvas.width, canvas.height); ctx.fillStyle = "black"; ctx.font = "16px sans-serif"; ctx.fillText("Game Over!", ((canvas.width / 2) - (ctx.measureText("Game Over!").width / 2)), 50); ctx.font = "12px sans-serif"; ctx.fillText("Your Score Was: " + score, ((canvas.width / 2) - (ctx.measureText("Your Score Was: " + score).width / 2)), 70); myimage = new Image(); myimage.src = "xcLDp.gif"; var size = [119, 26], //set up size coord = [443, 200]; ctx.font = "12px sans-serif"; ctx.fillText("Restart", ((canvas.width / 2) - (ctx.measureText("Restart").width / 2)), 197); ctx.drawImage( //draw it on canvas myimage, coord[0], coord[1], size[0], size[1] ); $("canvas").click(function(e) { //when click.. if ( testIfOver(this, e, size, coord) ) { startGame(); //reload } }); $("canvas").mousemove(function(e) { //when mouse moving if ( testIfOver(this, e, size, coord) ) { $(this).css("cursor", "pointer"); //change the cursor } else { $(this).css("cursor", "default"); //change it back } }); function testIfOver(ele,ev,size,coord){ if ( ev.pageX > coord[0] + ele.offsetLeft && ev.pageX < coord[0] + size[0] + ele.offsetLeft && ev.pageY > coord[1] + ele.offsetTop && ev.pageY < coord[1] + size[1] + ele.offsetTop ) { return true; } return false; } }

  Read the article

• How to Convert arrays or SimpleXML-Objects into an XML-String

  - by streetparade

  I want to create a xml from a given string, i have a function but i didn't wrote it.It seems a bit cryptical too. Can please some one review it and give me some Ideas, how it could be written clearer for everybody? /** * Converts arrays or SimpleXML-Objects into an XML-String * @params mixed Accepts an array or xml string with data to Post * @params integer DO NOT PROVIDE. Internal Usage for recursion only */ private function mixedDataToXML($data, $level = 1) { if(!$data){ return FALSE; } if(is_array($data)) { $xml = ''; if ($level==1) { $xml .= '<?xml version="1.0" encoding="ISO-8859-1"?>'."\n"; } foreach ($data as $key => $value) { $key = strtolower($key); if (is_array($value)) { $multi_tags = false; foreach($value as $key2=>$value2) { if (is_array($value2)) { $xml .= str_repeat("\t",$level)."<$key>\n"; $xml .= $this->mixedDataToXML($value2, $level+1); $xml .= str_repeat("\t",$level)."</$key>\n"; $multi_tags = true; } else { if (trim($value2)!='') { if (htmlspecialchars($value2)!=$value2) { $xml .= str_repeat("\t",$level). "<$key><![CDATA[$value2]]>". "</$key>\n"; } else { $xml .= str_repeat("\t",$level). "<$key>$value2</$key>\n"; } } $multi_tags = true; } } if (!$multi_tags and count($value)>0) { $xml .= str_repeat("\t",$level)."<$key>\n"; $xml .= $this->mixedDataToXML($value, $level+1); $xml .= str_repeat("\t",$level)."</$key>\n"; } } else { if (trim($value)!='') { if (htmlspecialchars($value)!=$value) { $xml .= str_repeat("\t",$level)."<$key>". "<![CDATA[$value]]></$key>\n"; } else { $xml .= str_repeat("\t",$level). "<$key>$value</$key>\n"; } } } } return $xml; }else{ return (string)$data; } }

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Problems Enforcing Referential Integrity on SQL Server Tables

  - by SidC

  Hello All, I have a SQL Server 2005 database comprised of Customer, Quote, QuoteDetail tables. I want/need to enforce referential integrity such that when an insert is made on quotedetail, the quote and customer tables are also affected. I have tried my best to set up primary/foreign keys on my tables but need some help. Here's the scripts for my tables as they stand now (please don't laugh): Customers: USE [Diel_inventory] GO /****** Object: Table [dbo].[Customers] Script Date: 05/08/2010 03:39:04 ******/ SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[Customers]( [pkCustID] [int] IDENTITY(1,1) NOT NULL, [CompanyName] [nvarchar](50) NULL, [Address] [nvarchar](50) NULL, [City] [nvarchar](50) NULL, [State] [nvarchar](2) NULL, [ZipCode] [nvarchar](5) NULL, [OfficePhone] [nvarchar](12) NULL, [OfficeFAX] [nvarchar](12) NULL, [Email] [nvarchar](50) NULL, [PrimaryContactName] [nvarchar](50) NULL, CONSTRAINT [PK_Customers] PRIMARY KEY CLUSTERED ([pkCustID] ASC)WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] Quotes: USE [Diel_inventory] GO /****** Object: Table [dbo].[Quotes] Script Date: 05/08/2010 03:30:46 ******/ SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[Quotes]( [pkQuoteID] [int] IDENTITY(1,1) NOT NULL, [fkCustomerID] [int] NOT NULL, [QuoteDate] [timestamp] NOT NULL, [NeedbyDate] [datetime] NULL, [QuoteAmt] [decimal](6, 2) NOT NULL, [QuoteApproved] [bit] NOT NULL, [fkOrderID] [int] NOT NULL, CONSTRAINT [PK_Bids] PRIMARY KEY CLUSTERED ( [pkQuoteID] ASC)WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] GO ALTER TABLE [dbo].[Quotes] WITH CHECK ADD CONSTRAINT [fkCustomerID] FOREIGN KEY([fkCustomerID]) REFERENCES [dbo].[Customers] ([pkCustID]) GO ALTER TABLE [dbo].[Quotes] CHECK CONSTRAINT [fkCustomerID] QuoteDetail: USE [Diel_inventory] GO /****** Object: Table [dbo].[QuoteDetail] Script Date: 05/08/2010 03:31:58 ******/ SET ANSI_NULLS ON GO SET QUOTED_IDENTIFIER ON GO CREATE TABLE [dbo].[QuoteDetail]( [ID] [int] IDENTITY(1,1) NOT NULL, [fkQuoteID] [int] NOT NULL, [fkCustomerID] [int] NOT NULL, [fkPartID] [int] NULL, [PartNumber1] [float] NOT NULL, [Qty1] [int] NOT NULL, [PartNumber2] [float] NULL, [Qty2] [int] NULL, [PartNumber3] [float] NULL, [Qty3] [int] NULL, [PartNumber4] [float] NULL, [Qty4] [int] NULL, [PartNumber5] [float] NULL, [Qty5] [int] NULL, [PartNumber6] [float] NULL, [Qty6] [int] NULL, [PartNumber7] [float] NULL, [Qty7] [int] NULL, [PartNumber8] [float] NULL, [Qty8] [int] NULL, [PartNumber9] [float] NULL, [Qty9] [int] NULL, [PartNumber10] [float] NULL, [Qty10] [int] NULL, [PartNumber11] [float] NULL, [Qty11] [int] NULL, [PartNumber12] [float] NULL, [Qty12] [int] NULL, [PartNumber13] [float] NULL, [Qty13] [int] NULL, [PartNumber14] [float] NULL, [Qty14] [int] NULL, [PartNumber15] [float] NULL, [Qty15] [int] NULL, [PartNumber16] [float] NULL, [Qty16] [int] NULL, [PartNumber17] [float] NULL, [Qty17] [int] NULL, [PartNumber18] [float] NULL, [Qty18] [int] NULL, [PartNumber19] [float] NULL, [Qty19] [int] NULL, [PartNumber20] [float] NULL, [Qty20] [int] NULL, CONSTRAINT [PK_QuoteDetail] PRIMARY KEY CLUSTERED ( [ID] ASC )WITH (PAD_INDEX = OFF, STATISTICS_NORECOMPUTE = OFF, IGNORE_DUP_KEY = OFF, ALLOW_ROW_LOCKS = ON, ALLOW_PAGE_LOCKS = ON) ON [PRIMARY] ) ON [PRIMARY] GO ALTER TABLE [dbo].[QuoteDetail] WITH CHECK ADD CONSTRAINT [FK_QuoteDetail_Customers] FOREIGN KEY ([fkCustomerID]) REFERENCES [dbo].[Customers] ([pkCustID]) GO ALTER TABLE [dbo].[QuoteDetail] CHECK CONSTRAINT [FK_QuoteDetail_Customers] GO ALTER TABLE [dbo].[QuoteDetail] WITH CHECK ADD CONSTRAINT [FK_QuoteDetail_PartList] FOREIGN KEY ([fkPartID]) REFERENCES [dbo].[PartList] ([RecID]) GO ALTER TABLE [dbo].[QuoteDetail] CHECK CONSTRAINT [FK_QuoteDetail_PartList] GO ALTER TABLE [dbo].[QuoteDetail] WITH CHECK ADD CONSTRAINT [FK_QuoteDetail_Quotes] FOREIGN KEY([fkQuoteID]) REFERENCES [dbo].[Quotes] ([pkQuoteID]) GO ALTER TABLE [dbo].[QuoteDetail] CHECK CONSTRAINT [FK_QuoteDetail_Quotes] Your advice/guidance on how to set these up so that customer ID in Customers is the same as in Quotes (referential integrity) and that CustomerID is inserted on Quotes and Customers when an insert is made to QuoteDetial would be much appreciated. Thanks, Sid

  Read the article

• OpenGL Shader Compile Error

  - by Tomas Cokis

  I'm having a bit of a problem with my code for compiling shaders, namely they both register as failed compiles and no log is received. This is the shader compiling code: /* Make the shader */ Uint size; GLchar* file; loadFileRaw(filePath, file, &size); const char * pFile = file; const GLint pSize = size; newCashe.shader = glCreateShader(shaderType); glShaderSource(newCashe.shader, 1, &pFile, &pSize); glCompileShader(newCashe.shader); GLint shaderCompiled; glGetShaderiv(newCashe.shader, GL_COMPILE_STATUS, &shaderCompiled); if(shaderCompiled == GL_FALSE) { ReportFiler->makeReport("ShaderCasher.cpp", "loadShader()", "Shader did not compile", "The shader " + filePath + " failed to compile, reporting the error - " + OpenGLServices::getShaderLog(newCashe.shader)); } And these are the support functions: bool loadFileRaw(string fileName, char* data, Uint* size) { if (fileName != "") { FILE *file = fopen(fileName.c_str(), "rt"); if (file != NULL) { fseek(file, 0, SEEK_END); *size = ftell(file); rewind(file); if (*size > 0) { data = (char*)malloc(sizeof(char) * (*size + 1)); *size = fread(data, sizeof(char), *size, file); data[*size] = '\0'; } fclose(file); } } return data; } string OpenGLServices::getShaderLog(GLuint obj) { int infologLength = 0; int charsWritten = 0; char *infoLog; glGetShaderiv(obj, GL_INFO_LOG_LENGTH,&infologLength); if (infologLength > 0) { infoLog = (char *)malloc(infologLength); glGetShaderInfoLog(obj, infologLength, &charsWritten, infoLog); string log = infoLog; free(infoLog); return log; } return "<Blank Log>"; } and the shaders I'm loading: void main(void) { gl_FragColor = vec4(1.0, 0.0, 0.0, 1.0); } void main(void) { gl_Position = ftransform(); } In short I get From: ShaderCasher.cpp, In: loadShader(), Subject: Shader did not compile Message: The shader Data/Shaders/Standard/standard.vs failed to compile, reporting the error - <Blank Log> for every shader I compile I've tried replacing the file reading with just a hard coded string but I get the same error so there must be something wrong with how I'm compiling them. I have run and compiled example programs with shaders, so I doubt my drivers are the issue, but in any case I'm on a Nvidia 8600m GT. Can anyone help?

  Read the article

• Cannot work for 2nd iteration because of writing delay.

  - by karikari

  My code's IF-THEN does not work for 2nd iteration. This is due to, the jar processing take some time to write it result inside the output.txt. Since the writing is a bit late, my code's 2nd iteration will always read the previous written value inside the output.txt in order to pass it to the IF-THEN. For example, in 1st iteration: output.txt -- 0.9888 twrite.txt -- msg: ok 2nd iteration: output.txt -- 0.5555 twrite.txt -- msg: ok //the IF-THEN still gives this result which is based on previous iteration. it should be msg: not ok . since it is < 0.7 I need help, how to solve this 'delay' problem? HRESULT CButtonDemoBHO::onDocumentComplete(IDispatch *pDisp, VARIANT *vUrl){ ATLTRACE("CButtonDemoBHO::onDocumentComplete %S\n", vUrl->bstrVal); WinHttpClient client(vUrl->bstrVal); client.SendHttpRequest(); wstring httpResponseHeader = client.GetHttpResponseHeader(); wstring httpResponse = client.GetHttpResponse(); writeToLog(httpResponse.c_str()); if (isMainFrame(pDisp)){ m_normalPageLoad=false; FILE *child = _popen("javaw -jar c:\\simmetrics.jar c:\\chtml.txt c:\\thtml.txt > c:\\output.txt", "r"); fclose(child); char readnumber[10]; float f = 0; FILE *file11 = fopen("c:\\output.txt","r"); char* p = fgets(readnumber,10,file11); std::istringstream iss(p); iss >> f; if (f > 0.7) { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: ok"; file12.close(); } else { wfstream file12 ("c:\\twrite.txt", ios_base::out); file12 << "Msg: not ok"; file12.close(); } iss.clear(); fclose(file11); return S_OK; } return S_OK; }

  Read the article

• Asp.net web service: Problems accessing without www

  - by MysterM

  I have a Asp.net web service running on www.domain.com/Service.svc that I connect to using jQuery from my asp.net website. Everything works perfect if the user access my website with www.domain.com. But if the user uses only domain.com I get error: There was no channel actively listening at 'http://domain.com/Service.svc/get?date=2010-10-09'. This is often caused by an incorrect address URI. Ensure that the address to which the message is sent matches an address on which a service is listening. In my web.config I use the serviceHostingEnvironment tag to get the service running on my webhost (it doesn't work otherwise). Maybe this is what causes the error? Here is my system.serviceModel in web.config (I had some problems setting up the web service so that's why my web.config might be a bit messy: <system.serviceModel> <behaviors> <endpointBehaviors> <behavior name="ServiceAspNetAjaxBehavior"> <enableWebScript /> </behavior> </endpointBehaviors> <serviceBehaviors> <behavior name="ServiceBehavior"> <serviceDebug includeExceptionDetailInFaults="true" /> </behavior> </serviceBehaviors> </behaviors> <serviceHostingEnvironment aspNetCompatibilityEnabled="true"> <baseAddressPrefixFilters> <add prefix="http://www.domain.com"/> </baseAddressPrefixFilters> </serviceHostingEnvironment> <services> <service behaviorConfiguration="ServiceBehavior" name="Service"> <endpoint address="" behaviorConfiguration="ServiceAspNetAjaxBehavior" binding="webHttpBinding" bindingConfiguration="ServiceBinding" contract="Service" /> </service> </services> <bindings> <webHttpBinding> <binding name="ServiceBinding" maxBufferPoolSize="1000000" maxReceivedMessageSize="1000000"> <readerQuotas maxDepth="1000000" maxStringContentLength="1000000" maxArrayLength="1000000" maxBytesPerRead="1000000" maxNameTableCharCount="1000000" /> </binding> </webHttpBinding> </bindings> </system.serviceModel> How can I make it possible for my users to access my webservice also when using only domain.com?

  Read the article

• [c++] upload image to imageshack

  - by cinek1lol

  Hi! I would like to send pictures via a program written in C + +. - OK WinExec("C:\\curl\\curl.exe -H Expect: -F \"fileupload=@C:\\curl\\ok.jpg\" -F \"xml=yes\" -# \"http://www.imageshack.us/index.php\" -o data.txt -A \"Mozilla/5.0 (Windows; U; Windows NT 5.1; en-US; rv:1.8.1.1) Gecko/20061204 Firefox/2.0.0.1\" -e \"http://www.imageshack.us\"", NULL); It works, but I would like to send the pictures from pre-loaded carrier to a variable char (you know what I mean? First off, I load the pictures into a variable and then send the variable), cause now I have to specify the path of the picture on a disk. I wanted to write this program in c++ by using the curl library, not through exe. extension. I have also found such a program (which has been modified by me a bit) #include <stdio.h> #include <string.h> #include <iostream> #include <curl/curl.h> #include <curl/types.h> #include <curl/easy.h> int main(int argc, char *argv[]) { CURL *curl; CURLcode res; struct curl_httppost *formpost=NULL; struct curl_httppost *lastptr=NULL; struct curl_slist *headerlist=NULL; static const char buf[] = "Expect:"; curl_global_init(CURL_GLOBAL_ALL); /* Fill in the file upload field */ curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "send", CURLFORM_FILE, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "nowy.jpg", CURLFORM_COPYCONTENTS, "nowy.jpg", CURLFORM_END); curl_formadd(&formpost, &lastptr, CURLFORM_COPYNAME, "submit", CURLFORM_COPYCONTENTS, "send", CURLFORM_END); curl = curl_easy_init(); headerlist = curl_slist_append(headerlist, buf); if(curl) { curl_easy_setopt(curl, CURLOPT_URL, "http://www.imageshack.us/index.php"); if ( (argc == 2) && (!strcmp(argv[1], "xml=yes")) ) curl_easy_setopt(curl, CURLOPT_HTTPHEADER, headerlist); curl_easy_setopt(curl, CURLOPT_HTTPPOST, formpost); res = curl_easy_perform(curl); curl_easy_cleanup(curl); curl_formfree(formpost); curl_slist_free_all (headerlist); } system("pause"); return 0; }

  Read the article

• Trying to run multiple HTTP requests in parallel, but being limited by Windows (registry)

  - by Nailuj

  I'm developing an application (winforms C# .NET 4.0) where I access a lookup functionality from a 3rd party through a simple HTTP request. I call an url with a parameter, and in return I get a small string with the result of the lookup. Simple enough. The challenge is however, that I have to do lots of these lookups (a couple of thousands), and I would like to limit the time needed. Therefore I would like to run requests in parallel (say 10-20). I use a ThreadPool to do this, and the short version of my code looks like this: public void startAsyncLookup(Action<LookupResult> returnLookupResult) { this.returnLookupResult = returnLookupResult; foreach (string number in numbersToLookup) { ThreadPool.QueueUserWorkItem(lookupNumber, number); } } public void lookupNumber(Object threadContext) { string numberToLookup = (string)threadContext; string url = @"http://some.url.com/?number=" + numberToLookup; WebClient webClient = new WebClient(); Stream responseData = webClient.OpenRead(url); LookupResult lookupResult = parseLookupResult(responseData); returnLookupResult(lookupResult); } I fill up numbersToLookup (a List<String>) from another place, call startAsyncLookup and provide it with a call-back function returnLookupResult to return each result. This works, but I found that I'm not getting the throughput I want. Initially I thought it might be the 3rd party having a poor system on their end, but I excluded this by trying to run the same code from two different machines at the same time. Each of the two took as long as one did alone, so I could rule out that one. A colleague then tipped me that this might be a limitation in Windows. I googled a bit, and found amongst others this post saying that by default Windows limits the number of simultaneous request to the same web server to 4 for HTTP 1.0 and to 2 for HTTP 1.1 (for HTTP 1.1 this is actually according to the specification (RFC2068)). The same post referred to above also provided a way to increase these limits. By adding two registry values to [HKEY_CURRENT_USER\Software\Microsoft\Windows\CurrentVersion\Internet Settings] (MaxConnectionsPerServer and MaxConnectionsPer1_0Server), I could control this myself. So, I tried this (sat both to 20), restarted my computer, and tried to run my program again. Sadly though, it didn't seem to help any. I also kept an eye on the Resource Monitor (see screen shot) while running my batch lookup, and I noticed that my application (the one with the title blacked out) still only was using two TCP connections. So, the question is, why isn't this working? Is the post I linked to using the wrong registry values? Is this perhaps not possible to "hack" in Windows any longer (I'm on Windows 7)? Any ideas would be highly appreciated :) And just in case anyone should wonder, I have also tried with different settings for MaxThreads on ThreadPool (everyting from 10 to 100), and this didn't seem to affect my throughput at all, so the problem shouldn't be there either.

  Read the article

< Previous Page | 789 790 791 792 793 794 795 796 797 798 799 800  | Next Page >