Search Results

Search found 8162 results on 327 pages for 'module packaging'.

Page 100/327 | < Previous Page | 96 97 98 99 100 101 102 103 104 105 106 107  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • How to restrict code from developers

    - by Kelvin
    My company is planning in hiring outsourcers to work for us, but concerned to give whole existing code to outside world. What is the proper way to deal with security of sharing code in such cases? Is it possible to restrict part of code for developers? So each of them could work on their project without having access to whole repository. P.S. The code we have is very integrated, and its hard to extract "one module", each module can use files from different locations. Thanks in advance

    Read the article

  • C++ DLL Export: Decorated/Mangled names

    - by Bob
    Created basic C++ DLL and exported names using Module Definition file (MyDLL.def). After compilation I check the exported function names using dumpbin.exe I expect to see: SomeFunction but I see this instead: SomeFunction = SomeFunction@@@23mangledstuff#@@@@ Why? The exported function appears undecorated (especially compared to not using the Module Def file), but what's up with the other stuff? If I use dumpbin.exe against a DLL from any commercial application, you get the clean: SomeFunction and nothing else......

    Read the article

  • Opencart SEO URL

    - by user2483877
    My question is, I have installed the SEO component successfully, and its working well but; On homepage, the Latest Products module shows the url like http://www.domain.com/product-21.html On category page, the product shows the url like http://www.domain.com/category/product-21.html I want to put the category URL in the latest products module so it will be the same as on category page. Does anybody have any ideas about this?

    Read the article

  • Drupal 7: Create a taxonomy term for each node and use the node title as the term name

    - by Spre3
    Is there anyway of doing this by using rules or by some custom code? I did try using rules but I can't find a way of adding a new term and set the name as the node title because the [node:title] token is not avilable. I know this is possible using the NAT module but the way this module changes the taxonomy terms hierarchy if you add a term reference field that uses the same taxonomy vocabulary which ruins the whole purpose of what I am trying to do.

    Read the article

  • Some problem with postgres_psycopg2

    - by aatifh
    Last night I upgraded my machine to Ubuntu 10.04 from 9.10. It seems to have cluttered my python module. Whenever I run python manage.py I get this error: ImportError: No module named postgresql_psycopg2.base Can any one throw any light on this?

    Read the article

  • Python: saving and loading a class definition

    - by Peterstone
    Hi! I am interested in saving and load objects using the pickle module as you can read in a question I asked before: Python: Errors saving and loading objects with pickle module Someone commment: 1, In an other way: the error is raise because pickle wanted to load an instance of the class Fruits and search for the class definition where it was defined, but it didn't find it so it raise the error Now I want to save and load a class definition in order to solve the problem I describe in the question mentioned before. Thank you so much!

    Read the article

  • mysql_connect randomly hangs up

    - by sergdev
    I install php 5 (more precisely 5.3.1) as apache module. After this one of my application becomes randomly hang up on mysql_connect - sometimes works, sometimes no, sometimes reload of page helps. How can this be fixed? I use Windows Vista, Apache/2.2.14 (Win32) PHP/5.3.1 with php module, MySql 5.0.67-community-nt.

    Read the article

  • How can I read a file's contents directly with Perl's Net::FTP?

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file. But I want the file contents instead of the file. I know that using the read method we can read the file contents. But how do I call the read function and how do I get the file contents?

    Read the article

  • Tips for making administration of Drupal site easier

    - by Busk
    I'm creating a Drupal site for a client, and I'd like to make administrating the site as easy as possible for them. Examples of what they'd want to do with the site is: Add/Edit/Remove content which will be displayed on various pages Manage a forum - Just the basic Drupal Forum module Add / Ban Users Respond to comments left using the webforum I see there is an Admin module, that looks pretty promising. But I was wondering if anyone has any other helpful tips. Thanks

    Read the article

  • What is the "proper" method for determining if a swf is running within an AIR application?

    - by Michael Prescott
    I've got a Flex Web project and a Flex AIR project that use a common code-base. The common code defines several run-time loaded Flex Modules. I want the Flex Modules to behave differently depending on whether the running base application is WEB or AIR. What is the proper method for determining from the module code whether the module is running in a WEB or AIR application? (I found that Security.sandboxType.toString() returns "application", but I haven't found anything better in the documentation, yet.)

    Read the article

  • Behaviour difference Dim oDialog1 as Dialog1 = New Dialog1 VS Dim oDialog1 as Dialog1 = Dialog1

    - by user472722
    VB.Net 2005 I have a now closed Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = New Dialog1. VB.Net 2008 I have a still open Dialog1. To get information from the Dialog1 from within a module I need to use Dim oDialog1 as Dialog1 = Dialog1. VB.Net 2005 does not compile using Dim oDialog1 as Dialog1 = Dialog1 and insists on NEW What is going on and why do I need the different initialisation syntax?

    Read the article

  • How to read the file

    - by muruga
    I want to get the file from one host to another host. We can get the file using the NET::FTP module. In that module we can use the get method to get the file.But I want the file content instead of the file. I know that using the read method we can read the file content. But how to call the read function and how to get the file content. Please help me.

    Read the article

  • viewing files in python?

    - by Galilsnap
    I am creating a sort of "Command line" in Python. I already added a few functions, such as changing login/password, executing, etc., But is it possible to browse files in the directory that the main file is in with a command/module, or will I have to make the module myself and use the import command? Same thing with changing directories to view, too.

    Read the article

  • Where should I put common utility functions for Perl .t tests?

    - by zedoo
    I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but across different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

< Previous Page | 96 97 98 99 100 101 102 103 104 105 106 107  | Next Page >