Search Results

Search found 27233 results on 1090 pages for 'information quality'.

Page 1024/1090 | < Previous Page | 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031  | Next Page >

• Windows Question: RunOnce/Second Boot Issues [closed]

  - by Greg

  Moved to Super User: Windows Question: RunOnce/Second Boot Issues I am attempting to create a Windows XP SP3 image that will run my application on Second Boot. Here is the intended workflow. 1) Run Image Prep Utility (I wrote) on windows to add my runonce entries and clean a few things up. 2) Reboot to ghost, make image file. 3) Package into my ISO and distribute. 4) System will be imaged by user. 5) On first boot, I have about 5 things that run, one of which includes a driver updater (I wrote) for my own specific devices. 6) One of the entries inside of HKCU/../runonce is a reg file, which adds another key to HKLM/../runonce. This is how second boot is acquired. 7) As a result of the driver updater, user is prompted to reboot. 8) My application is then launched from HKLM/../runonce on second boot. This workflow works perfectly, except for a select few legacy systems that contain devices that cause the add hardware wizard to pop up. When the add hardware wizard pops up is when I begin to see problems. It's important to note, that if I manually inspect the registry after the add hardware wizard pops up, it appears as I would expect, with all the first boot scripts having run, and it's sitting in a state I would correctly expect it to be in for a second boot scenario. The problem comes when I click next on the add hardware wizard, it seems to re-run the single entry I've added, and re-executes the runonce scripts. (only one script now as it's already executed and cleared out the initial entries). This causes my application to open as if it were a second boot, only when next is clicked on the add hardware wizard. If I click cancel, and reboot, then it also works as expected. I don't care as much about other solutions, because I could design a system that doesn't fully rely on Microsoft's registry. I simply can't find any information as to WHY this is happening. I believe this is some type of Microsoft issue that's presenting itself as a result of an overstretched image that's expected to support too many legacy platforms, but any help that can be provided would be appreciated. Thanks,

  Read the article

• Python File Search Line And Return Specific Number of Lines after Match

  - by Simos Anderson

  I have a text file that has lines representing some data sets. The file itself is fairly long but it contains certain sections of the following format: Series_Name INFO Number of teams : n1 | Team | # | wins | | TeamName1 | x | y | . . . | TeamNamen1 | numn | numn | Some Irrelevant lines Series_Name2 INFO Number of teams : n1 | Team | # | wins | | TeamName1 | num1 | num2 | . where each section has a header that begins with the Series_Name. Each Series_Name is different. The line with the header also includes the number of teams in that series, n1. Following the header line is a set of lines that represents a table of data. For each series there are n1+1 rows in the table, where each row shows an individual team name and associated stats. I have been trying to implement a function that will allow the user to search for a Team name and then print out the line in the table associated with that team. However, certain team names show up under multiple series. To resolve this, I am currently trying to write my code so that the user can search for the header line with series name first and then print out just the following n1+1 lines that represent the data associated with the series. Here's what I have come up with so far: import re print fname = raw_input("Enter filename: ") seriesname = raw_input("Enter series: ") def findcounter(fname, seriesname): logfile = open(fname, "r") pat = 'INFO Number of teams :' for line in logfile: if seriesname in line: if pat in line: s=line pattern = re.compile(r"""(?P<name>.*?) #starting name \s*INFO #whitespace and success \s*Number\s*of\s*teams #whitespace and strings \s*\:\s*(?P<n1>.*)""",re.VERBOSE) match = pattern.match(s) name = match.group("name") n1 = int(match.group("n1")) print name + " has " + str(n1) + " teams" lcount = 0 for line in logfile: if line.startswith(name): if pat in line: while lcount <= n1: s.append(line) lcount += 1 return result The first part of my code works; it matches the header line that the person searches for, parses the line, and then prints out how many teams are in that series. Since the header line basically tells me how many lines are in the table, I thought that I could use that information to construct a loop that would continue printing each line until a set counter reached n1. But I've tried running it, and I realize that the way I've set it up so far isn't correct. So here's my question: How do you return a number of lines after a matched line when given the number of desired lines that follow the match? I'm new to programming, and I apologize if this question seems silly. I have been working on this quite diligently with no luck and would appreciate any help.

  Read the article

• xml appending issue - in ie, chrome browsers

  - by 3gwebtrain

  Hi, i am using this coding for my xml information to append in to html. As well it works fine. but in the ie7,ie8 as well chrome browser it's not propelry. This code work9ing well with firefox,opera, safari.. i unable to find, what is the mistake i made this.. any one help me please? $(function(){ var thisPage; var parentPage; $('ul.left-navi li a').each(function(){ $('ul.left-navi li a').removeClass('current'); var pathname = (window.location.pathname.match(/[^\/]+$/)[0]); var currentPage = $(this).attr('href'); var pathArr = new Array(); pathArr = pathname.split("."); var file = pathArr[pathArr.length - 2]; thisPage = file; if(currentPage==pathname){ $(this).addClass("active"); } }) $.get('career-utility.xml',function(myData){ var receivedData = myData; var myXml = $(myData).find(thisPage); parentPage = thisPage; var overviewTitle = myXml.find('overview').attr('title'); var description = myXml.find('discription').text(); var mainsublinkTitle = myXml.find('mainsublink').attr('title'); var thisTitle = myXml.find("intro").attr('title'); var thisIntro = myXml.find("introinfo").text(); $('<h3>'+overviewTitle+'</h3>').appendTo('.overViewInfo'); $('<p>'+description+'</p>').appendTo('.overViewInfo'); var sublinks = myXml.find('mainsublink').children('sublink'); $('#intro h3').append(thisTitle); $('#intro').append(thisIntro); sublinks.each(function(numsub){ var newSubLink = $(this); var sublinkPage = $(this).attr('pageto'); var linkInfo = $(this).text(); $('ul.career-link').append('<li><a href="'+sublinkPage+'">'+linkInfo+'</a></li>'); }) // alert('thisTitle : '+thisTitle+'thisIntro :'+thisIntro); $(myXml).find('listgroup').each(function(index){ var count = index; var listGroup = $(this); var listGroupTitle = $(this).attr('title'); var shortNote = $(this).attr('shortnote'); var subLink = $(this).find('sublist'); var firstList = $(this).find('list'); $('.grouplist').append('<div class="list-group"><h3>'+listGroupTitle+'</h3><ul class="level-one level' + count + '"></ul></div>'); firstList.each(function(listnum) { $(this).wrapInner('<li>') .find('sublistgroup').wrapInner('<ul>').children().unwrap() .find('sublist').wrapInner('<li>').children().unwrap(); // Append content of 'list' node $('ul.level'+count).append($(this).children()); }); }); }); })

  Read the article

• Android Google Analytics

  - by ibenot

  I'm trying to use Google Analytics in my Android application with Google Configuration Add .jar in my project Insert this in AndroidManifest Add this in my java file public class MainActivity extends Activity { GoogleAnalyticsTracker tracker; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); tracker = GoogleAnalyticsTracker.getInstance(); tracker.startNewSession("My-UA–XXXXXXXX", this); setContentView(R.layout.main); Button createEventButton = (Button)findViewById(R.id.NewEventButton); createEventButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { tracker.trackEvent( "Clicks", // Category "Button", // Action "clicked", // Label 77); // Value } }); setContentView(R.layout.main); Button createPageButton = (Button)findViewById(R.id.NewPageButton); createPageButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { // Add a Custom Variable to this pageview, with name of "Medium" and value "MobileApp" and // scope of session-level. tracker.setCustomVar(1, "Navigation Type", "Button click", 2); // Track a page view. This is probably the best way to track which parts of your application // are being used. // E.g. // tracker.trackPageView("/help"); to track someone looking at the help screen. // tracker.trackPageView("/level2"); to track someone reaching level 2 in a game. // tracker.trackPageView("/uploadScreen"); to track someone using an upload screen. tracker.trackPageView("/testApplicationHomeScreen"); } }); Button quitButton = (Button)findViewById(R.id.QuitButton); quitButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { finish(); } }); Button dispatchButton = (Button)findViewById(R.id.DispatchButton); dispatchButton.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { // Manually start a dispatch, not needed if the tracker was started with a dispatch // interval. tracker.dispatch(); } }); } @Override protected void onDestroy() { super.onDestroy(); // Stop the tracker when it is no longer needed. tracker.stopSession(); } } == And it's ok, no error, compiling and executing but i have created my ua account yesterday (more 24h) and i have nothing in my google analytics panel. My Question : is there an error in my code or i want to wait again ? Live trafic works for Android application (like tradicional website) ??? I have no information about Live trafic (when i play my app, i would like to show the number of person using my application) and Saved trafic (with viewed pages, time) Thank you for your replies and excuse my poor english :) bye

  Read the article

• WPF: How to properly override the methods when creating custom control

  - by EV

  Hi, I am creating a custom control Toolbox that is derived from ItemsControl. This toolbox is supposed to be filled with icons coming from the database. The definition looks like this: public class Toolbox : ItemsControl { protected override DependencyObject GetContainerForItemOverride() { return new ToolboxItem(); } protected override bool IsItemItsOwnContainerOverride(object item) { return (item is ToolboxItem); } } Toolboxitem is derived from ContentControl. public class ToolboxItem : ContentControl { static ToolboxItem() { FrameworkElement.DefaultStyleKeyProperty.OverrideMetadata(typeof(ToolboxItem), new FrameworkPropertyMetadata(typeof(ToolboxItem))); } } Since the number of icons stored in a database is not known I want to use the data template: <DataTemplate x:Key="ToolBoxTemplate"> <StackPanel> <Image Source="{Binding Path=url}" /> </StackPanel> </DataTemplate> Then I want the Toolbox to use the template. <Toolbox x:Name="NewLibrary" ItemsSource="{Binding}" ItemTemplate="ToolBoxtemplate"> </Toolbox> I'm using ADO.NET entity framework to connect to a database. The code behind: SystemicsAnalystDBEntities db = new SystemicsAnalystDBEntities(); private void Window_Loaded(object sender, RoutedEventArgs e) { NewLibrary.ItemsSource = from c in db.Components select c; } However, there is a problem. When the code is executed, it displays the object from the database (as the ItemSource property is set to the object from the database) and not the images. It does not use the template. When I use the static images source it works in the right way I found out that I need to override the PrepareContainerForItemOverride method.But I don't know how to add the template to it. Thanks a lot for any comments. Additional Information Here is the ControlTemplate for ToolboxItem: <ControlTemplate TargetType="{x:Type s:ToolboxItem}"> <Grid> <Rectangle Name="Border" StrokeThickness="1" StrokeDashArray="2" Fill="Transparent" SnapsToDevicePixels="true" /> <ContentPresenter Content="{TemplateBinding ContentControl.Content}" Margin="{TemplateBinding Padding}" SnapsToDevicePixels="{TemplateBinding UIElement.SnapsToDevicePixels}" /> </Grid> <ControlTemplate.Triggers> <Trigger Property="IsMouseOver" Value="true"> <Setter TargetName="Border" Property="Stroke" Value="Gray" /> </Trigger> </ControlTemplate.Triggers> </ControlTemplate>

  Read the article

• how to refactor user-permission system?

  - by John

  Sorry for lengthy question. I can't tell if this should be a programming question or a project management question. Any advice will help. I inherited a reasonably large web project (1 year old) from a solo freelancer who architected it then abandoned it. The project was a mess, but I cleaned up what I could, and now the system is more maintainable. I need suggestions on how to extend the user-permission system. As it is now, the database has a t_user table with the column t_user.membership_type. Currently, there are 4 membership types with the following properties: 3 of the membership types are almost functionally the same, except for the different monthly fees each must pay 1 of the membership type is a "fake-user" type which has limited access ( different business logic also applies) With regards to the fake-user type, if you look in the system's business logic files, you will see a lot of hard-coded IF statements that do something like if (fake-user) { // do something } else { // a paid member of type 1,2 or 3 // proceed normally } My client asked me to add 3 more membership types to the system, each of them with unique features to be implemented this month, and substantive "to-be-determined" features next month. My first reaction is that I need to refactor the user-permission system. But it concerns me that I don't have enough information on the "to-be-determined" membership type features for next month. Refactoring the user-permission system will take a substantive amount of time. I don't want to refactor something and throw it out the following month. I get substantive feature requests on a monthly basis that come out of the blue. There is no project road map. I've asked my client to provide me with a roadmap of what they intend to do with the new membership types, but their answer is along the lines of "We just want to do [feature here] this month. We'll think of something new next month." So questions that come to mind are: 1) Is it dangerous for me to refactor the user permission system not knowing what membership type features exist beyond a month from now? 2) Should I refactor the user permission system regardless? Or just continue adding IF statements as needed in all my controller files? Or can you recommend a different approach to user permission systems? Maybe role-based ? 3) Should this project have a road map? For a 1 year old project like mine, how far into the future should this roadmap project? 4) Any general advice on the best way to add 3 new membership types?

  Read the article

• How can I group an array of rectangles into "Islands" of connected regions?

  - by Eric

  The problem I have an array of java.awt.Rectangles. For those who are not familiar with this class, the important piece of information is that they provide an .intersects(Rectangle b) function. I would like to write a function that takes this array of Rectangles, and breaks it up into groups of connected rectangles. Lets say for example, that these are my rectangles (constructor takes the arguments x, y, width,height): Rectangle[] rects = new Rectangle[] { new Rectangle(0, 0, 4, 2), //A new Rectangle(1, 1, 2, 4), //B new Rectangle(0, 4, 8, 2), //C new Rectangle(6, 0, 2, 2) //D } A quick drawing shows that A intersects B and B intersects C. D intersects nothing. A tediously drawn piece of ascii art does the job too: +-------+ +---+ ¦A+---+ ¦ ¦ D ¦ +-+---+-+ +---+ ¦ B ¦ +-+---+---------+ ¦ +---+ C ¦ +---------------+ Therefore, the output of my function should be: new Rectangle[][]{ new Rectangle[] {A,B,C}, new Rectangle[] {D} } The failed code This was my attempt at solving the problem: public List<Rectangle> getIntersections(ArrayList<Rectangle> list, Rectangle r) { List<Rectangle> intersections = new ArrayList<Rectangle>(); for(Rectangle rect : list) { if(r.intersects(rect)) { list.remove(rect); intersections.add(rect); intersections.addAll(getIntersections(list, rect)); } } return intersections; } public List<List<Rectangle>> mergeIntersectingRects(Rectangle... rectArray) { List<Rectangle> allRects = new ArrayList<Rectangle>(rectArray); List<List<Rectangle>> groups = new ArrayList<ArrayList<Rectangle>>(); for(Rectangle rect : allRects) { allRects.remove(rect); ArrayList<Rectangle> group = getIntersections(allRects, rect); group.add(rect); groups.add(group); } return groups; } Unfortunately, there seems to be an infinite recursion loop going on here. My uneducated guess would be that java does not like me doing this: for(Rectangle rect : allRects) { allRects.remove(rect); //... } Can anyone shed some light on the issue?

  Read the article

• Is this a legitimate implementation of a 'remember me' function for my web app?

  - by user246114

  Hi, I'm trying to add a "remember me" feature to my web app to let a user stay logged in between browser restarts. I think I got the bulk of it. I'm using google app engine for the backend which lets me use java servlets. Here is some pseudo-code to demo: public class MyServlet { public void handleRequest() { if (getThreadLocalRequest().getSession().getAttribute("user") != null) { // User already has session running for them. } else { // No session, but check if they chose 'remember me' during // their initial login, if so we can have them 'auto log in' // now. Cookie[] cookies = getThreadLocalRequest().getCookies(); if (cookies.find("rememberMePlz").exists()) { // The value of this cookie is the cookie id, which is a // unique string that is in no way based upon the user's // name/email/id, and is hard to randomly generate. String cookieid = cookies.find("rememberMePlz").value(); // Get the user object associated with this cookie id from // the data store, would probably be a two-step process like: // // select * from cookies where cookieid = 'cookieid'; // select * from users where userid = 'userid fetched from above select'; User user = DataStore.getUserByCookieId(cookieid); if (user != null) { // Start session for them. getThreadLocalRequest().getSession() .setAttribute("user", user); } else { // Either couldn't find a matching cookie with the // supplied id, or maybe we expired the cookie on // our side or blocked it. } } } } } // On first login, if user wanted us to remember them, we'd generate // an instance of this object for them in the data store. We send the // cookieid value down to the client and they persist it on their side // in the "rememberMePlz" cookie. public class CookieLong { private String mCookieId; private String mUserId; private long mExpirationDate; } Alright, this all makes sense. The only frightening thing is what happens if someone finds out the value of the cookie? A malicious individual could set that cookie in their browser and access my site, and essentially be logged in as the user associated with it! On the same note, I guess this is why the cookie ids must be difficult to randomly generate, because a malicious user doesn't have to steal someone's cookie - they could just randomly assign cookie values and start logging in as whichever user happens to be associated with that cookie, if any, right? Scary stuff, I feel like I should at least include the username in the client cookie such that when it presents itself to the server, I won't auto-login unless the username+cookieid match in the DataStore. Any comments would be great, I'm new to this and trying to figure out a best practice. I'm not writing a site which contains any sensitive personal information, but I'd like to minimize any potential for abuse all the same, Thanks

  Read the article

• Problem passing variables in php form.

  - by Joshxtothe4

  I have the following php form. I am trying to make it so that when the form is loaded, the values will be assigned the appropriate check- variable. This variable will contain either "checked or "". If it contains checked, the way it is displayed with the html should cause the relevant checkbox to be checked. As it is, the variables do not seem to be being passed. When I echo out $deleted or $notice from within the submitinfo branch, they are blank. Furthermore, nothing is being inserted into the database, and I am not getting any database error. How can I check this? <?php if (isset($_GET["cmd"])) $cmd = $_GET["cmd"]; else if (isset($_POST["cmd"])) $cmd = $_POST["cmd"]; else die("Invalid URL"); if (isset($_GET["pk"])) { $pk = $_GET["pk"]; } if (isset($_POST["deleted"])) { $deleted = $_POST["deleted"]; } if (isset($_POST["notice"])) { $notice = $_POST["notice"]; } $con = mysqli_connect("localhost","user","password", "db"); if (!$con) { echo "Can't connect to MySQL Server. Errorcode: %s\n". mysqli_connect_error(); exit; } $con->set_charset("utf8"); $getformdata = $con->query("select * from STATUS where ARTICLE_NO = '$pk'"); $checkDeleted = ""; $checkNotice = ""; while ($row = mysqli_fetch_assoc($getformdata)) { $checkDeleted = $row['deleted']; $checkNotice = $row['notice']; } if($cmd=="submitinfo") { $statusQuery = "INSERT INTO STATUS VALUES (?, ?)"; if ($statusInfo = $con->prepare($statusQuery)) { $statusInfo->bind_param("ss", $deleted, $notice); $statusInfo->execute(); $statusInfo->close(); echo "true"; } else { echo "false"; } print_r($con->error); } if($cmd=="EditStatusData") { echo "<form name=\"statusForm\" action=\"test.php\" method=\"post\" enctype=\"multipart/form-data\"> <h1>Editing information for auction: ".$pk."</h1> Löschung Ebay: <input type=\"checkbox\" name=\"deleted\" value=\"checked\" ".$checkDeleted." /> <br /> Abmahnung: <input type=\"checkbox\" name=\"notice\" value=\"checked\" ".$checkNotice." /> <br /> <input type=\"hidden\" name=\"cmd\" value=\"submitinfo\" /> <input name=\"Submit\" type=\"submit\" value=\"submit\" /> </form>"; } else { print_r($con->error); }

  Read the article

• Do You Really Know Your Programming Languages?

  - by Kristopher Johnson

  I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

  Read the article

• A NSMutableArray is destroying my life!

  - by camilo

  EDITED to show the relevant part of the code Hi. There's a strange problem with an NSMutableArray which I'm just not understanding... Explaining: I have a NSMutableArray, defined as a property (nonatomic, retain), synthesized, and initialized with 29 elements. realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; After the initialization, I can insert elements as I wish and everything seems to be working fine. While I'm running the application, however, if I insert a new element in the array, I can print the array in the function where I inserted the element, and everything seems ok. However, when I select a row in the table, and I need to read that array, my application crashes. In fact, it cannot even print the array anymore. Is there any "magical and logical trick" everybody should know when using a NSMutableArray that a beginner like myself can be missing? Thanks a lot. I declare my array as realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; I insert objects in my array with [realSectionNames addObject:[category categoryFirstLetter]]; although I know i can also insert it with [realSectionNames insertObject:[category categoryFirstLetter] atIndex:i]; where the "i" is the first non-occupied position. After the insertion, I reload the data of my tableView. Printing the array before or after reloading the data shows it has the desired information. After that, selecting a row at the table makes the application crash. This realSectionNames is used in several UITableViewDelegate functions, but for the case it doesn't matter. What truly matters is that printing the array in the beginning of the didSelectRowAtIndexPath function crashes everything (and of course, doesn't print anything). I'm pretty sure it's in that line, for printing anything he line before works (example): NSLog(@"Anything"); NSLog(@"%@", realSectionNames); gives the output: 2010-03-24 15:16:04.146 myApplicationExperience[3527:207] Anything [Session started at 2010-03-24 15:16:04 +0000.] GNU gdb 6.3.50-20050815 (Apple version gdb-967) (Tue Jul 14 02:11:58 UTC 2009) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "i386-apple-darwin".sharedlibrary apply-load-rules all Attaching to process 3527. Still not understanding what kind of stupidity I've done this time... maybe it's not too late to follow the career of brain surgeon?

  Read the article

• How do you create a MANIFEST.MF that's available when you're testing and running from a jar in produ

  - by warvair

  I've spent far too much time trying to figure this out. This should be the simplest thing and everyone who distributes Java applications in jars must have to deal with it. I just want to know the proper way to add versioning to my Java app so that I can access the version information when I'm testing, e.g. debugging in Eclipse and running from a jar. Here's what I have in my build.xml: <target name="jar" depends = "compile"> <property name="version.num" value="1.0.0"/> <buildnumber file="build.num"/> <tstamp> <format property="TODAY" pattern="yyyy-MM-dd HH:mm:ss" /> </tstamp> <manifest file="${build}/META-INF/MANIFEST.MF"> <attribute name="Built-By" value="${user.name}" /> <attribute name="Built-Date" value="${TODAY}" /> <attribute name="Implementation-Title" value="MyApp" /> <attribute name="Implementation-Vendor" value="MyCompany" /> <attribute name="Implementation-Version" value="${version.num}-b${build.number}"/> </manifest> <jar destfile="${build}/myapp.jar" basedir="${build}" excludes="*.jar" /> </target> This creates /META-INF/MANIFEST.MF and I can read the values when I'm debugging in Eclipse thusly: public MyClass() { try { InputStream stream = getClass().getResourceAsStream("/META-INF/MANIFEST.MF"); Manifest manifest = new Manifest(stream); Attributes attributes = manifest.getMainAttributes(); String implementationTitle = attributes.getValue("Implementation-Title"); String implementationVersion = attributes.getValue("Implementation-Version"); String builtDate = attributes.getValue("Built-Date"); String builtBy = attributes.getValue("Built-By"); } catch (IOException e) { logger.error("Couldn't read manifest."); } } But, when I create the jar file, it loads the manifest of another jar (presumably the first jar loaded by the application - in my case, activation.jar). Also, the following code doesn't work either although all the proper values are in the manifest file. Package thisPackage = getClass().getPackage(); String implementationVersion = thisPackage.getImplementationVersion(); Any ideas?

  Read the article

• Unsure how to design JavaScript / jQuery functionality which uses XML to create HTML objects

  - by Jack Roscoe

  Hi, I'm using JavScript and jQuery to read an XML document and subsequently use the information from the XML to create HTML objects. The main 'C' nodes in the XML document all have a type attribute, and depending on the type I want to run a function which will create a new html object using the other attributes assigned to that particular 'C' node node. Currently, I have a for loop which extracts each 'C' node from the XML and also it's attributes (e.g. width, height, x, y). Also inside the for loop, I have an if statement which checks the 'type' attribute of the current 'C' node being processed, and depending on the type it will run a different function which will then create a new HTML object with the attributes which have been drawn from the XML. The problem is that there may be more than one 'C' node of the same type, so for example when I'm creating the function that will run when a 'C' node of 'type=1' is detected, I cannot use the 'var p = document.createElement('p')' because if a 'C' node of the same type comes up later in the loop it will clash and override that element with that variable that has just been created. I'm not really sure how to approach this? Here is my entire script. If you need me to elaborate on any parts please ask, I'm sure it's not written in the nicest possible way: var arrayIds = new Array(); $(document).ready(function(){ $.ajax({ type: "GET", url: "question.xml", dataType: "xml", success: function(xml) { $(xml).find("C").each(function(){ arrayIds.push($(this).attr('ID')); }); var svgTag = document.createElement('SVG'); // Create question type objects function ctyp3(x,y,width,height,baC) { alert('test'); var r = document.createElement('rect'); r.x = x; r.y = y; r.width = width; r.height = height; r.fillcolor = baC; svgTag.appendChild(r); } // Extract question data from XML var questions = []; for (j=0; j<arrayIds.length; j++) { $(xml).find("C[ID='" + arrayIds[j] + "']").each(function(){ // pass values questions[j] = { typ: $(this).attr('typ'), width: $(this).find("I").attr('wid'), height: $(this).find("I").attr('hei'), x: $(this).find("I").attr('x'), y: $(this).find("I").attr('x'), baC: $(this).find("I").attr('baC'), boC: $(this).find("I").attr('boC'), boW: $(this).find("I").attr('boW') } alert($(this).attr('typ')); if ($(this).attr('typ') == '3') { ctyp3(x,y,width,height,baC); // alert('pass'); } else { // Add here // alert('fail'); } }); } } }); });

  Read the article

• Can't access annotation property of subclassed uibutton - editted

  - by Tzur Gazit

  Below is my original question. I kept investigating and found out that the type of the button I allocate is of type UIButton instead of the subclassed type CustomButton. the capture below is the allocation of the button and connection to target. I break immediately after the allocation and check the button type (po rightButton at the debugger console). It's turned out tht the type is UIButton instead of CustomButton. CustomButton* rightButton = [CustomButton buttonWithType:UIButtonTypeDetailDisclosure]; [rightButton addTarget:self action:@selector(showDetails:) forControlEvents:UIControlEventTouchUpInside]; I have a mapView to which I add annotations. The pin's callout have a button (rightCalloutAccessoryView). In order to be able to display various information when the button is pushed, i've subclassed uibutton and added a class called "Annotation". @interface CustomButton : UIButton { NSIndexPath *indexPath; Annotation *mAnnotation; } @property (nonatomic, retain) NSIndexPath *indexPath; @property (nonatomic, copy) Annotation *mAnnotation; - (id) setAnnotation2:(Annotation *)annotation; @end Here is "Annotation": @interface Annotation : NSObject <MKAnnotation> { CLLocationCoordinate2D coordinate; NSString *mPhotoID; NSString *mPhotoUrl; NSString *mPhotoName; NSString *mOwner; NSString *mAddress; } @property (nonatomic, assign) CLLocationCoordinate2D coordinate; @property (nonatomic, copy) NSString *mPhotoID; @property (nonatomic, copy) NSString *mPhotoUrl; @property (nonatomic, copy) NSString *mPhotoName; @property (nonatomic, copy) NSString *mOwner; @property (nonatomic, copy) NSString *mAddress; - (id) initWithCoordinates:(CLLocationCoordinate2D)coordinate; - (id) setPhotoId:(NSString *)id url:(NSString *)url owner:(NSString *)owner address:(NSString *)address andName:(NSString *)name; @end I want to set the annotation property of the uibutton at - (MKAnnotationView *)mapView:(MKMapView *)pMapView viewForAnnotation:(id )annotation, in order to refer to it at the button push handler (-(IBAction) showDetails:(id)sender). The problem is that I can't set the annotation property of the button. I get the following message at run time: 2010-04-27 08:15:11.781 HotLocations[487:207] *** -[UIButton setMAnnotation:]: unrecognized selector sent to instance 0x5063400 2010-04-27 08:15:11.781 HotLocations[487:207] *** Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[UIButton setMAnnotation:]: unrecognized selector sent to instance 0x5063400' 2010-04-27 08:15:11.781 HotLocations[487:207] Stack: ( 32080987, 2472563977, 32462907, 32032374, 31884994, 55885, 30695992, 30679095, 30662137, 30514190, 30553882, 30481385, 30479684, 30496027, 30588515, 63333386, 31865536, 31861832, 40171029, 40171226, 2846639 ) I appreciate the help. Tzur.

  Read the article

• SEO Help with Pages Indexed by Google

  - by Joe Majewski

  I'm working on optimizing my site for Google's search engine, and lately I've noticed that when doing a "site:www.joemajewski.com" query, I get results for pages that shouldn't be indexed at all. Let's take a look at this page, for example: http://www.joemajewski.com/wow/profile.php?id=3 I created my own CMS, and this is simply a breakdown of user id #3's statistics, which I noticed is indexed by Google, although it shouldn't be. I understand that it takes some time before Google's results reflect accurately on my site's content, but this has been improperly indexed for nearly six months now. Here are the precautions that I have taken: My robots.txt file has a line like this: Disallow: /wow/profile.php* When running the url through Google Webmaster Tools, it indicates that I did, indeed, correctly create the disallow command. It did state, however, that a page that doesn't get crawled may still get displayed in the search results if it's being linked to. Thus, I took one more precaution. In the source code I included the following meta data: <meta name="robots" content="noindex,follow" /> I am assuming that follow means to use the page when calculating PageRank, etc, and the noindex tells Google to not display the page in the search results. This page, profile.php, is used to take the $_GET['id'] and find the corresponding registered user. It displays a bit of information about that user, but is in no way relevant enough to warrant a display in the search results, so that is why I am trying to stop Google from indexing it. This is not the only page Google is indexing that I would like removed. I also have a WordPress blog, and there are many category pages, tag pages, and archive pages that I would like removed, and am doing the same procedures to attempt to remove them. Can someone explain how to get pages removed from Google's search results, and possibly some criteria that should help determine what types of pages that I don't want indexed. In terms of my WordPress blog, the only pages that I truly want indexed are my articles. Everything else I have tried to block, with little luck from Google. Can someone also explain why it's bad to have pages indexed that don't provide any new or relevant content, such as pages for WordPress tags or categories, which are clearly never going to receive traffic from Google. Thanks!

  Read the article

• Intent filter for browsing XML (specifically rss) in android

  - by Leif Andersen

  I have an activity that I want to run every time the user goes to an xml (specifically rss) page in the browser (at least assuming the user get's it from the list of apps that can support it). I currently already have the current intent filter: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> </intent-filter> </activity> Now as you can guess, this is an evil intent, as it wants to open whenever a page is requested via http. However, when I ad the line: <data android:mimeType="application/rss+xml"></data> to make it: <activity android:name=".activities.EpisodesListActivity" android:theme="@android:style/Theme.NoTitleBar"> <intent-filter> <category android:name="android.intent.category.BROWSABLE"></category> <category android:name="android.intent.category.DEFAULT"></category> <action android:name="android.intent.action.VIEW"></action> <data android:scheme="http"></data> <data android:mimeType="application/rss+xml"></data> </intent-filter> </activity> The application no longer claims to be able to run rss files. Also, if I change the line to: <data android:mimeType="application/xml"></data> It also won't work (for generic xml file even). So what intent filter do I need to make in order to claim that the activity supports rss. (Also, bonus points if you can tell me how I know what URL it was the user opened. So far, I've always sent that information from one activity to the other using extras). Thank you for your help

  Read the article

• jQuery: modify hidden form field value before submit

  - by Jason Miesionczek

  I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

  Read the article

• dynamic module creation

  - by intuited

  I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

  Read the article

• web service filling gridview awfully slow, as is paging/sorting

  - by nat

  Hi I am making a page which calls a web service to fill a gridview this is returning alot of data, and is horribly slow. i ran the svcutil.exe on the wsdl page and it generated me the class and config so i have a load of strongly typed objects coming back from each request to the many service functions. i am then using LINQ to loop around the objects grabbing the necessary information as i go, but for each row in the grid i need to loop around an object, and grab another list of objects (from the same request) and loop around each of them.. 1 to many parent object child one.. all of this then gets dropped into a custom datatable a row at a time.. hope that makes sense.... im not sure there is any way to speed up the initial load. but surely i should be able to page/sort alot faster than it is doing. as at the moment, it appears to be taking as long to page/sort as it is to load initially. i thought if when i first loaded i put the datasource of the grid in the session, that i could whip it out of the session to deal with paging/sorting and the like. basically it is doing the below protected void Page_Load(object sender, EventArgs e) { //init the datatable //grab the filter vars (if there are any) WebServiceObj WS = WSClient.Method(args); //fill the datatable (around and around we go) foreach (ParentObject po in WS.ReturnedObj) { var COs = from ChildObject c in WS.AnotherReturnedObj where c.whatever.equals(...) ...etc foreach(ChildObject c in COs){ myDataTable.Rows.Add(tlo.this, tlo.that, c.thisthing, c.thatthing, etc......); } } grdListing.DataSource = myDataTable; Session["dt"] = myDataTable; grdListing.DataBind(); } protected void Listing_PageIndexChanging(object sender, GridViewPageEventArgs e) { grdListing.PageIndex = e.NewPageIndex; grdListing.DataSource = Session["dt"] as DataTable; grdListing.DataBind(); } protected void Listing_Sorting(object sender, GridViewSortEventArgs e) { DataTable dt = Session["dt"] as DataTable; DataView dv = new DataView(dt); string sortDirection = " ASC"; if (e.SortDirection == SortDirection.Descending) sortDirection = " DESC"; dv.Sort = e.SortExpression + sortDirection; grdListing.DataSource = dv.ToTable(); grdListing.DataBind(); } am i doing this totally wrongly? or is the slowness just coming from the amount of data being bound in/return from the Web Service.. there are maybe 15 columns(ish) and a whole load of rows.. with more being added to the data the webservice is querying from all the time any suggestions / tips happily received thanks

  Read the article

• Can't access font resource in Silverlight class library

  - by Matt

  I have a reasonably large Silveright 3.0 project on the go, and I'm having issues accessing a couple of custom font resources from within one of the assemblies. I've got a working test solution where I have added a custom font as a resource, and can access it fine from XAML using: <TextBlock Text="Test" FontFamily="FontName.ttf#Font Name" /> The test solution consists of the TestProject.Application and the TestProject.Application.Web projects, with all the fun and games obviously in the TestProject.Application project However, when I try this in my main solution, the fonts refuse to show in the correct type face (instead showing in the default font). There's no difference in the way the font has been added to project between the test solution and the main solution, and the XAML is identical. However, there is a solution layout difference. In the main solution, as well as having a MainApp.Application and MainApp.Application.Web project, I also have a MainApp.Application.ViewModel project and a MainApp.Application.Views project, and the problem piece of XAML is the in the MainApp.Application.Views project (not the .Application project like the test solution). I've tried putting the font into either the .Application or .Application.Views project, tried changing the Build Action to Content, Embedded Resource etc, all to no avail. So, is there an issue accessing font resources from a child assembly that I don't know about, or has anyone successfully done this? My long term need will be to have the valid custom fonts being stored as resources in a separate .Application.FontLibrary assembly that will be on-demand downloaded and cached, and the XAML controls in the .Application.Views project will need to reference this FontLibrary assembly to get the valid fonts. I've also tried xcreating this separate font library assembly, and I can't seem to get the fonts from the second assembly. As some additional information, I've also tried the following font referencing approaches: <TextBlock Text="Test" FontFamily="/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;/FontName.ttf#Font Name" /> <TextBlock Text="Test" FontFamily="pack:application,,,/MainApp.Application.Views;component/FontName.ttf#Font Name" /> And a few similar variants with different assembly references/sub directories/random semi colons. And so far nothing works... anyone struck this (and preferably solved it)?

  Read the article

• Changing Data in ListView

  - by legr3c

  Hi In my app I use a ListView to display data from the database. The data changes sometimes, for example when the user applies new filters or changes the sorting method. I use AsyncTask to get the databsase cursor that points to the new data set because sometimes data needs to be loaded from the net which can take some time. What I do now looks something like this: private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); mCursorAdapter = new MyCustomCursorAdapter(MyActivity.this, mCursor); mListView.setAdapter(mCursorAdapter); } } } This works so far but I realize that creating a new CursorAdapter and calling setAdapter on my ListView each time isn't the correct way to do it. Also, after setAdapter the scroll position of the list is set back to the top. I found this post which describes how to do it properly. So now I want to do something like this: onCreate(){ // ... // create the CursorAdapter using null as the initial cursor MyCustomCursorAdapter cursorAdapter = new MyCustomCursorAdapter(this, null); mListView.setAdapter(cursorAdapter); // ... } private class updateTask extends AsyncTask<Void, Void, Void> { /* * runs on the UI thread before doInBackground */ @Override protected void onPreExecute(){ // prepare some stuff... } /* * runs in a separate thread * used for time-consuming loading operation */ @Override protected Void doInBackground() { //get new database cursor mCursor = mDbAdapter.getCursor(); return null; } /* * runs on the UI thread after doInBackground */ @Override protected void onPostExecute(Void result){ // this returns null! MyCustomCursorAdapter cursorAdapter = (MyCustomCursorAdapter)mListView.getAdapter(); Cursor oldCursor = cursorAdapter.getCursor(); if(oldCursor!=null){ MyActivity.this.stopManagingCursor(oldCursor); oldCursor.close(); } if(mCursor!=null){ MyActivity.this.startManagingCursor(mCursor); cursorAdapter.changeCursor(mCursor); } } } This however doesn't work for me because (MyCustomCursorAdapter)mListView.getAdapter(); always returns null. Why does this happen? What am I doing wrong? Edit: Some additional information: my adapter implements SectionIndexer. I don't really think that this has anything to do with my problem but it has caused me some troubles before so I thought I'd mention it.

  Read the article

• How do I write sql data into a textbox after a submit type event

  - by Matt

  Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Spring MVC, REST, and HATEOAS

  - by SingleShot

  I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

  Read the article

• Can't destroy record in many-to-many relationship

  - by Dmart

  I'm new to Rails, so I'm sure I've made a simple mistake. I've set up a many-to-many relationship between two models: User and Group. They're connected through the junction model GroupMember. Here are my models (removed irrelevant stuff): class User < ActiveRecord::Base has_many :group_members has_many :groups, :through => :group_members end class GroupMember < ActiveRecord::Base belongs_to :group belongs_to :user end class Group < ActiveRecord::Base has_many :group_members has_many :users, :through => :group_members end The table for GroupMembers contains additional information about the relationship, so I didn't use has_and_belongs_to_many (as per the Rails "Active Record Associations" guide). The problem I'm having is that I can't destroy a GroupMember. Here's the output from rails console: irb(main):006:0> m = GroupMember.new => #<GroupMember group_id: nil, user_id: nil, active: nil, created_at: nil, updated_at: nil> irb(main):007:0> m.group_id =1 => 1 irb(main):008:0> m.user_id = 16 => 16 irb(main):009:0> m.save => true irb(main):010:0> m.destroy NoMethodError: undefined method `eq' for nil:NilClass from /usr/local/lib/ruby/gems/1.8/gems/activesupport-3.0.4/lib/active_support/whiny_nil.rb:48:in `method_missing' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/persistence.rb:79:in `destroy' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/locking/optimistic.rb:110:in `destroy' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/callbacks.rb:260:in `destroy' from /usr/local/lib/ruby/gems/1.8/gems/activesupport-3.0.4/lib/active_support/callbacks.rb:413:in `_run_destroy_callbacks' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/callbacks.rb:260:in `destroy' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/transactions.rb:235:in `destroy' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/transactions.rb:292:in `with_transaction_returning_status' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/connection_adapters/abstract/database_statements.rb:139:in `transaction' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/transactions.rb:207:in `transaction' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/transactions.rb:290:in `with_transaction_returning_status' from /usr/local/lib/ruby/gems/1.8/gems/activerecord-3.0.4/lib/active_record/transactions.rb:235:in `destroy' from (irb):10 This is driving me crazy, so any help would be greatly appreciated.

  Read the article

< Previous Page | 1020 1021 1022 1023 1024 1025 1026 1027 1028 1029 1030 1031  | Next Page >