Search Results

Search found 8953 results on 359 pages for 'human resources'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 104/359 | < Previous Page | 100 101 102 103 104 105 106 107 108 109 110 111  | Next Page >

  • How can i localize asp.net mvc application using a external assembly

    - by allrast
    i want to create a external dll to store my .resx files. i want to do this because i need to access this files from both presentation and business layers. I have created a external project that contains the default and the es-Es resx files. i have mark it as PublicResXFileCodeGenerator to be able to access it from another dll. on my view i have this test <%=localization.Common.title.ToString() % when i'm run the application i always get this error "Could not find any resources appropriate for the specified culture or the neutral culture. Make sure "localization.Common.resources" was correctly embedded or linked into assembly "localization" at compile time, or that all the satellite assemblies required are loadable and fully signed." i have read some this related to ddl signing... but i don't now if this is the problem.

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • best way to add route under resource in Laravel 4

    - by passingby
    I would like know if there is a better way to add additional route aside from the default of resource in Laravel 4. I have this code below which is no problem with regard to the functionality, it's just that it seems to be long: <?php Route::group(array('before' => 'auth'), function() { # API Route::group(array('prefix' => 'api'), function() { Route::resource('projects', 'ProjectsController'); Route::resource('projects.groups', 'GroupsController'); Route::post('/projects/{projects}/groups/{groups}/reorder', 'GroupsController@reorder'); }); }); If in Rails Rails.application.routes.draw do # API namespace :api, defaults: { format: 'json' } do scope module: :v1 do resources :projects do resources :groups do member do post :reorder end end end end end end

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • No resource found when using style Theme.Sherlock

    - by Vitaly Menchikovsky
    I am trying to use Sherlock. The steps That I did bring up the library of abc to my project while my project min sdk 2.2 and max api 15. the problem that I cant set up the style to use it. the error Error retrieving parent for item: No resource found that matches the given name '@style/ Theme.Sherlock'. my code of xml: <resources> <style name="AppTheme" parent="@style/Theme.Sherlock" /> </resources> the java that I use is 1.6. I am runing 4.0.3 avd. I know that you will give me a link for webs but didnt find any thing that can help. I am using eclipse and Sherlock 4.0.3.If you can give me the solution how to do it simple way with instructions. thanks.

    Read the article

  • WPF Create Rectangle Tags on Image from DataBinding

    - by Noah
    I'm trying to add image tags to a WPF image and I'm not having much luck. I'd like to do it through databinding if at all possible. Can I set a resource with a DataTemplate to take care of this? Here's what I've been playing with to no avail: <Image Margin="25,4,14,46" Name="MainImage" Stretch="Uniform" MouseDown="MainImage_MouseDown" Grid.Row="1" HorizontalAlignment="Left" VerticalAlignment="Top" Source="{Binding Path=FileName}" > <Image.Resources> <DataTemplate DataType="{x:Type capp:CAPMeta}"> <Label Content="{Binding Path=TagText}"> </Label> </DataTemplate> </Image.Resources> </Image> Thanks!

    Read the article

  • How to write "good" user interface text?

    - by Roddy
    Many applications are let down by the quality of the 'writing' in their user interfaces: typically, poor spelling, grammar, inconsistent tone, and worse yet, "humour" are the usual offenders. Are there good resources that can help developers to write UI messages that give a professional and positive impression to your customers, even when your code's going to hell in a handcart? Thanks, all — Some great resources here, so I will CW this question. I'm accepting Adam Sill's answer because it's the one that (as a developer of desktop apps) I found most pertinent.

    Read the article

  • Activity should be transparent, but has black background

    - by Uwe Krass
    I followed the instructions of writing a transparent layout. My res/values/style.xml looks like this: <resources> <style name="Theme" parent="android:Theme" /> <style name="Theme.Transparent"> <item name="android:windowBackground">@drawable/transparent_background</item> </style> <drawable name="transparent_background">#00000000</drawable> </resources> The activity snippet looks like this: <activity android:name=".Controlls" android:label="Controlls" android:theme="@style/Theme.Transparent"> When I start this activity from my root activity, the layout gets drawn correctly, but the background stays black.

    Read the article

  • Difference between these two ways of localizing a string in an aspx/ascx file?

    - by Brandon
    When I started localizing a website the first time, I just did the localization like this: <%= Resources.ResourceFile.ResourceName %> and it seems to work perfectly fine. However, the ReSharper 5.0 Beta does it like this: <asp:Localize Text="<%$ Resources: ResourceFile, ResourceName %>" runat="server"> Value </asp:Localize> Does it matter which way it gets done? If it doesn't matter, is there any way to make ReSharper do it the way I'm doing it? I kind of prefer it this way since it is less text in the aspx/ascx files.

    Read the article

  • iPhone webapp: my ressources don't get cached

    - by Savageman
    Hello, First of all, I'd like to say I'm not using any off-line feature from HTML5. I have a web-application which runs on the iPhone. When viewing it from safari, everything works quite well. But when I launch the application from the home screen (to remove the navigation bar), it can be really slow. I checked the logs in Apache and it appears that Safari does a good work to cache the resources (css / js / images), with Apache answering "304 Not Modified" when needed. However, when the web app run as a "real" application (navigation bar hidden), those resources doesn't get cached and Apache the content has to be transferred over and over again (response code 200 Ok + content), resulting in a significantly slower page load. How can I prevent this behavior? Do I need to always run my webapp inside Safari, even when it's launched from the home screen? Thank you!

    Read the article

  • Rails 3 routes and using GET to create clean URLs?

    - by Hard-Boiled Wonderland
    I am a little confused with the routes in Rails 3 as I am just starting to learn the language. I have a form generated here: <%= form_tag towns_path, :method => "get" do %> <%= label_tag :name, "Search for:" %> <%= text_field_tag :name, params[:name] %> <%= submit_tag "Search" %> <% end %> Then in my routes: get "towns/autocomplete_town_name" get "home/autocomplete_town_name" match 'towns' => 'towns#index' match 'towns/:name' => 'towns#index' resources :towns, :module => "town" resources :businesses, :module => "business" root :to => "home#index" So why when submitting the form do I get the URL: /towns?utf8=?&name=townname&commit=Search So the question is how do I make that url into a clean url like: /towns/townname Thanks, Andrew

    Read the article

  • how to model a many to many relationship

    - by Maulin
    Here is the scenario, Articles have many Comments Users can write many Comments for many Articles The comments table contains both user_id article_id as foreign keys My models are set up like so class User < ActiveRecord::Base has_many :comments has_many :articles, :through => :comments class Article < ActiveRecord::Base has_many :comments has_many :users, :through => :comments class Comment < ActiveRecord::Base belongs_to :users belongs_to :articles My routes.rb has the following code map.resources :articles, :has_many => :comments map.resources :users, :has_many => :comments which produces the following routes new_article_comment edit_article_comment new_user_comment edit_user_comment etc... This is not what I want (atleast not what I think I want), since comments must always be related to users and article, how can I get a route like so new_user_article_comment edit_user_article_comment Then I could just do new_user_article_comment_path([@user, @article]) to create a new comment

    Read the article

  • ListView is Widget(View) or Layout(Viewgroup)?

    - by Manoj Maurya
    Hi All, I need your help to explore few topics in Android. My understanding is Widget is View and Layout is ViewGroups in Android. I described the problems as below- Please go through the below links- developer.android.com/guide/topics/ui/custom-components.html- (add http:// in the beginning) developer.android.com/resources/tutorials/views/index.html - (add http:// in the beginning) In the first link ListView is included as Widget and in the Second link ListView has been shown as Layout. So, is ListView is Widget(View) or Layout(Viewgroup)? Same is the case for Spinner in Andriod developer.android.com/resources/tutorials/views/hello-spinner.html- (add http:// in the beginning) (Link- says Spinner is Widget(View)) developer.android.com/guide/topics/ui/layout-objects.html- (add http:// in the beginning) says Spinner is Layout(ViewGroup) So, Spinner is View or ViewGroup? Please update me with your views?

    Read the article

  • Multi language CMS?

    - by Adam
    Is there any CMS such as expression engine or wordpress that allows a user to click a button and convert all the text to another language (it would have to be human generated otherwise it has too many mistakes probably). I'd like to know if there are any good solutions out there that work for real world use, in like business company websites.

    Read the article

  • What is the best way to learn VB/VBA?

    - by Noah
    I have wanted to learn VB and VBA for a long time. My school offers a coarse, but it doesn't fit with the rest of my schedule. It will be my first programing language. I was considering using the textbook my school uses (An introduction to programing using visual basic 2008, but I wold get the 2010 version), but I was wondering if there were better resources I could use. I mainly want to lean to learn VBA so I cam create macros and other tools for MS Word. Please understand that this is the fist time I will be programming and I am teaching myself (with the books/online resources).

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

  • Beginner, learning as I go - how to get C#/SQLite db set up and ready for testing?

    - by ChrisC
    I've messed with Access a little bit in the past, had one class on OO theory, and one class on console c++ apps. Now, as a hobby project, I'm undertaking to write an actual app, which will be a database app using System.Data.SQLite and C#. I have the db's table structure planned. I have System.Data.SQLite installed and connected to VS Pro. I entered my tables and columns in VS, but that's where I'm stuck. I really don't know how to finish the db set up so I can start creating queries and testing the db structure. Can someone give me guidance to online resources that will help me learn how to get the db properly set up so I can proceed with testing it? I'm hoping for online resources specific to beginners using C# and System.Data.SQLite, but I'll use the closest I can get. Thanks.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 100 101 102 103 104 105 106 107 108 109 110 111  | Next Page >