Search Results

Search found 3864 results on 155 pages for 'split'.

Page 104/155 | < Previous Page | 100 101 102 103 104 105 106 107 108 109 110 111  | Next Page >

  • How to download the xml file from server and use it inside application ?

    - by Praween k
    Hi Commonware, As you provided the solution .Actually my application requirement is exactly matches as you told i.e first download it from server and then display the file and it should also be updated as per the server file is updated within running period.Can u please provide me the application code for this .This will be very much helpful.I need it Urgently!!!!!!! [If it blows up, you will either need to split it into multiple files (each with a subset of your data), or not package it with the application, instead downloading it from a server on first run of your appl.] Thanks in advance. Praween

    Read the article

  • Strange python error

    - by Werner
    Hi, I am trying to write a python program that calculates a histogram, given a list of numbers like: 1 3 2 3 4 5 3.2 4 2 2 so the input parameters are the filename and the number of intervals. The program code is: #!/usr/bin/env python import os, sys, re, string, array, math import numpy Lista = [] db = sys.argv[1] db_file = open(db,"r") ic=0 nintervals= int(sys.argv[2]) while 1: line = db_file.readline() if not line: break ll=string.split(line) #print ll[6] Lista.insert(ic,float(ll[0])) ic=ic+1 lmin=min(Lista) print "min= ",lmin lmax=max(Lista) print "max= ",lmax width=666.666 width=(lmax-lmin)/nintervals print "width= ",width nelements=len(Lista) print "nelements= ",nelements print " " Histogram = numpy.zeros(shape=(nintervals)) for item in Lista: #print item int_number = 1 + int((item-lmin)/width) print " " print "item,lmin= ",item,lmin print "(item-lmin)/width= ",(item-lmin)," / ",width," ====== ",(float(item)-float(lmin))/float(width) print "int((item-lmin)/width)= ",int((item-lmin)/width) print item , " belongs to interval ", int_number, " which is from ", lmin+width*(int_number-1), " to ",lmin+width*int_number Histogram[int_number] = Histogram[int_number] + 1 4 but somehow I am completely lost, I get strange errors, can anybody help¿ Thanks

    Read the article

  • Converting a company from SVN to Hg?

    - by Michael
    We're a heavy user of SVN here. While the advantages of GIT over SVN made us want to change, the advantages of Hg over SVN mean it's now time to change and we need to start doing so very soon. I'm not so worried on the client side, but here are my questions. There are some excellent books on setting file metaproperties, properly organizing projects, etc on SVN. What is that book(s) for Hg? Is there a way to convert an SVN repository (that you've used) and can report how well it went? We don't want to lose years of commit logs if possible. When you DO convert, how did you split up the old code? Did you commit trunk as one project, and tags/forks as another? If you used SVN for legacy work, did you check in updates to SVN or something else?

    Read the article

  • Distributing requests to Selenium Grid RC's?

    - by intervigil
    I've got a situation here where I have a central selenium grid hub, and several RC's running on my gogrid account. When I access it to run tests, it basically queues all the incoming test requests and executes them serially on only one of the RC's, instead of spreading them out to use available RC's. The tests come from multiple projects, so I'm not looking to parallelize the tests themselves, just to split the requests that come from multiple projects across the multiple RC's. From everything I've read, it seems like selenium grid should be doing this already, yet I only see one RC used to run every single test. Is there something I'm missing?

    Read the article

  • How to run a module

    - by Jimmy
    I have a module file containing the following functions: def replace(filename): match = re.sub(r'[^\s^\w]risk', 'risk', filename) return match def count_words(newstring): from collections import defaultdict word_dict=defaultdict(int) for line in newstring: words=line.lower().split() for word in words: word_dict[word]+=1 for word in word_dict: if'risk'==word: return word, word_dict[word] when I do this in IDLE: >>> mylist = open('C:\\Users\\ahn_133\\Desktop\\Python Project\\test10.txt').read() >>> newstrings=replace(mylist) ### This works fine. >>> newone=count_words(newstrings) ### This leads to the following error. I get the following error: Traceback (most recent call last): File "<pyshell#134>", line 1, in <module> newPH = replace(newPassage) File "C:\Users\ahn_133\Desktop\Python Project\text_modules.py", line 56, in replace match = re.sub(r'[^\s^\w]risk', 'risk', filename) File "C:\Python27\lib\re.py", line 151, in sub return _compile(pattern, flags).sub(repl, string, count) TypeError: expected string or buffer Is there anyway to run both functions without saving newstrings into a file, opening it using readlines(), and then running count_words function?

    Read the article

  • Targeting row when responding with js rails

    - by berto77
    I have an application where a user can vote on reviews. They can vote up or down. Now when there's a listing of reviews, I have a problem targeting the review the user voted on. I'm using a respon_to block in my rails controller and responding with js. So for instance, I have a vote_up method, and a vote_up.js.erb template. in that template, I have the following: var id = $('article.comment').attr('id').split('_')[1]; alert("id: " + id); $('.votecomment_' + id).find('.score').html("<%= @review2.vote_total %>"); I'm just alerting the id. The problem is that the id always returns the value of the first review found on the page. How can I pass the context aka this, to javascript, so I can figure out which review to target?

    Read the article

  • Why are Objective-C instance variables declared in an interface?

    - by Chase
    I'm just getting into Objective-C (Java is my primary OO language). Defining an object's instance variables in the interface instead of the class seems strange. I'm used to an interface being a public API definition with nothing besides method signatures (not counting constants here). Is there some reason that state is defined in an interface (even if it is private) and behaviour is defined in a class. It just seems odd that since objects are state+behavior that the definition would be split into two separate places. Is it a design benefit is some way? A pain in the rear issue that you are just forced to deal with in Objective-C? A non-issue, just different? Any background on why it's done this way? Or can you put object state in a class and I just haven't hit that part in my book yet?

    Read the article

  • Best way to get photoshop to optimise 35 related pictures for fast transmission

    - by thenerd
    I have 35 pictures taken from a stationary camera aimed at a lightbox in which an object is placed, rotated at 10 degrees in each picture. If I cycle through the pictures quickly, the image looks like it is rotating. If I wished to 'rotate' the object in a browser but wanted to transmit as little data as possible for this, I thought it might be a good idea to split the picture into 36 pictures, where 1 picture is any background the images have in common, and 35 pictures minus the background, just showing the things that have changed. Do you think this approach will work? Is there a better route? How would I achieve this in photoshop?

    Read the article

  • GWT: how to have different styles for splitters in different SplitLayoutPanels?

    - by user26270
    I know you can change the styles of the splitters with the defaults styles listed in the docs: .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-HDragger { horizontal dragger } .gwt-SplitLayoutPanel .gwt-SplitLayoutPanel-VDragger { vertical dragger } and we've done that in earlier development. However, now I'm developing new stuff and would like to use a different style for the splitters in a new SplitLayoutPanel. Unfortunately, we haven't or can't split the app into different modules, which might make this easier. I tried creating a new style and applying it to my new SplitLayoutPanel, but it didn't appear to have any effect on the splitters. I thought there might be a method to get a handle on the splitters in order to apply the new style to only them, but I didn't find any such method.

    Read the article

  • problem in extracting the data from text file

    - by parijat24
    hello , i am new to python , and I want to extract the data from this format FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124 to this format FBpp0143497 5 151 Arrestin_N 1.1e-23 FBpp0143497 183 323 Arrestin_C 6e-16 I have written code in hope that it works but it does not work , please help! file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') rec = file.read() for line in rec : field = line.split("\t") print field print field[:] print '>',field[0] print field[1], field[2], field[6], field[12] the hmmtext file is FBpp0143497 5 151 5 157 PF00339.22 Arrestin_N Domain 1 135 149 83.4 1.1e-23 1 CL0135 FBpp0143497 183 323 183 324 PF02752.15 Arrestin_C Domain 1 137 138 58.5 6e-16 1 CL0135 FBpp0131987 60 280 51 280 PF00089.19 Trypsin Domain 14 219 219 127.7 3.7e-37 1 CL0124

    Read the article

  • Reduce text length to fit cell width in a smart manner

    - by Andrei Ciobanu
    Hello, I am in project where we are building a simple web calendar using Java EE technologies. We define a table where every row is an employee, and every column represents an hour interval. The table width and column widths are adjustable. In every cell we have a text retrieved from a database, indicating what the employee is doing / should do in that time interval. The problem is that sometimes the text in cells is getting bigger than the actual cell. My task is to make the text more "readable" by reducing it's length in a "smart way" so that it can fit in the cell more "gracefully". For example if initially in a cell I have: "Writing documents", after the resize I should retrieve: "Wrtng. dcmnts" or "Writ. docum." so that the text can fit well. Is there a smart way to do it ? Or removing vocals / split the string in two is enough ?

    Read the article

  • MS Access Crashed an now all Form objects and code modules are missing

    - by owlie
    I was adding a form to our Access 07 db. I copied an existing form to use as a template, renamed it, and saved it. I opened a different form to check something and Access crashed. When I reopened the database it says: "Access has detected that this database is in an inconsistent state, and will attempt to recover the database." etc. When it reopened - all forms and reports were missing. Saved queries remain. The error message states that object recovery failures will be noted in a Recovery Errors table - but this table wasn't created. The links to the be database remained intact. The database is split - I was experimenting with a form on a front-end copy which might have something to do with it. Any ideas what would cause this (I can see loosing recent work - but nixing all form objects?!) And is there any chance of recovery?

    Read the article

  • how to query sqlite for certain rows, i.e. dividing it into pages (perl DBI)

    - by user1380641
    sorry for my noob question, I'm currently writing a perl web application with sqlite database behind it. I would like to be able to show in my app query results which might get thousands of rows - these should be split in pages - routing should be like /webapp/N - where N is the page number. what is the correct way to query the sqlite db using DBI, in order to fetch only the relavent rows. for instance, if I show 25 rows per page so I want to query the db for 1-25 rows in the first page, 26-50 in the second page etc.... Thanks in advanced!

    Read the article

  • Problem in appending a string to a already filled string builder(at the beginning by using INSERT) a

    - by Newbie
    I have a string builder like StringBuilder sb = new StringBuilder("Value1"); sb.AppendLine("Value2"); Now I have a string say string str = "value 0"; I did sb.Insert(0,str); and then string[] strArr = sb.ToString().Trim().Replace("\r", string.Empty).Split('\n'); The result I am getting as (Array size of 2 where I should get 3) [0] value 0 Value1 [1] value2 But the desired output being [0] Value 0 [1] Value1 [2] Value2 Where I am going wrong? I am using C#3.0 Please help.. It 's urgent Thanks

    Read the article

  • How do I get artifacts from one Maven module included in the resources of another in my build?

    - by Hanno Fietz
    I have Maven modules that produce a Flex application as an SWF file. I want to include that file in a web application that is made with another Maven module from the same build. I'm wondering how and at which lifecycle phase I get Maven to grab the artifact from the other module and put it insode the appropriate folder of the webapp module. Would I use a separate assembly module? The web app is running on a Jetty server in an OSGi environment (using Pax), the server side of the web app uses Struts. The final artifact as I see it would be a WAR file including my Action etc classes, JSP templates, static contents such as CSS or JS, and the SWF movies. I might be better off with these split over some other setup, but right now, I wouldn't know which.

    Read the article

  • Dynamic "WHERE IN" on IQueryable (linq to SQL)

    - by user320235
    I have a LINQ to SQL query returning rows from a table into an IQueryable object. IQueryable<MyClass> items = from table in DBContext.MyTable select new MyClass { ID = table.ID, Col1 = table.Col1, Col2 = table.Col2 } I then want to perform a SQL "WHERE ... IN ...." query on the results. This works fine using the following. (return results with id's ID1 ID2 or ID3) sQuery = "ID1,ID2,ID3"; string[] aSearch = sQuery.Split(','); items = items.Where(i => aSearch.Contains(i.ID)); What I would like to be able to do, is perform the same operation, but not have to specify the i.ID part. So if I have the string of the field name I want to apply the "WHERE IN" clause to, how can I use this in the .Contains() method?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • best practice for Jquery plugin implementation and resource locations

    - by ptutt
    This is probably a very basic question, but I seem to have issues plugging in jquery plug-ins. The issue seems to be around the location of the script, css and images and ensuring the css has the correct url to the images. The standard plug-in has the following folder structure (eg : JPicker) js css images My project is asp.net mvc so I have the default: scripts images content So, I try to split the jquery plugin to the appropriate folders (not sure if this is the best way?). Then I try to correct the references to images (background urls) in the css. I believe the url is relative to the page that is implementing the css file, not the location of the css file itself. Anyway, when I try the above, the plugins don't seem to work. I believe the issue lies with the images not being found. The jquery code runs without errors, so I assume that's not the problem. Any help/advice much appreciated

    Read the article

  • What is the best way to partition large tables in SQL Server?

    - by RyanFetz
    In a recent project the "lead" developer designed a database schema where "larger" tables would be split across two seperate databases with a view on the main database which unioned the two seperate database-tables together. The main database is what the application was driven off of so these tables looked and felt like ordinary tables (except some quirkly things around updating). This seemed like a HUGE performance problem. We do see problems with performance around these tables but nothing to make him change his mind about his design. Just wondering what is the best way to do this, or if it is even worth doing?

    Read the article

  • How can I optimize this code?

    - by loop0
    Hi, I'm developing a logger daemon to squid to grab the logs on a mongodb database. But I'm experiencing too much cpu utilization. How can I optimize this code? from sys import stdin from pymongo import Connection connection = Connection() db = connection.squid logs = db.logs buffer = [] a = 'timestamp' b = 'resp_time' c = 'src_ip' d = 'cache_status' e = 'reply_size' f = 'req_method' g = 'req_url' h = 'username' i = 'dst_ip' j = 'mime_type' L = 'L' while True: l = stdin.readline() if l[0] == L: l = l[1:].split() buffer.append({ a: float(l[0]), b: int(l[1]), c: l[2], d: l[3], e: int(l[4]), f: l[5], g: l[6], h: l[7], i: l[8], j: l[9] } ) if len(buffer) == 1000: logs.insert(buffer) buffer = [] if not l: break connection.disconnect()

    Read the article

  • can list be converted into string

    - by PARIJAT
    Actually i have extracted some data from the file and want to write it in the file 2 but the program says 'sequence item 1: expected string, list found', I want to know how i can convert buffer[] ie string into sequence, so that it could be saved in file 2...I am new to the python please help* file = open('/ddfs/user/data/k/ktrip_01/hmm.txt','r') file2 = open('/ddfs/user/data/k/ktrip_01/hmm_write.txt','w') buffer = [] rec = file.readlines() for line in rec : field = line.split() print '>',field[0] term = field[0] buffer.append(term) print field[1], field[2], field[6], field[12] term1 = field [1] buffer.append(term1) term2 = field[2] buffer.append[term2] term3 = field[6] buffer.append[term3] term4 = field[12] buffer.append[term4] file2.write(buffer) file.close() file2.close()

    Read the article

  • Parse items from text file

    - by chris
    I have a text file that includes data inside {[]} tags. What would be the suggested way to parse that data so I can just use the data inside the tags? Example text file would look like this: 'this is a bunch of text that is not {[really]} useful in any {[way]}. I need to {[get]} some items {[from]} it.' I would like to end up with 'really', 'way', 'get', 'from' in a list. I guess I could use split to do it.. but seems like there might be a better way out there. I have seen a ton parsing libraries, is there one that would be perfect for what I want to do?

    Read the article

  • Show elipses where text will be truncated as per iTunes

    - by Burt
    I a building an application with a similar layout to iTunes i.e. it has a sidebar that doubles as a menu. Some of the text will exceed the boundary and rather that having it be truncated I would like to show ellipses (see line image below "Purchased on My iPh..."). How would I go about this in WPF? Suppose I made the boundary movable i.e. user can change the size of the panel (split panel in Windows Forms), how would I go about dynamically showing the ellipses/text? Thanks in advance, B

    Read the article

  • Have anyone ever create/manipulate a table application from the ground up/scratch?

    - by Darwin
    Have anyone ever create/manipulate a table application from the ground up/scratch? I want to create a table using flash AS 3. I like to have the features like to the MS Studio Web Developer option. The options are create a table, merge cells, split cell, resize columns, delete cell, delete row, delete column etc... I think this is going to be very complicated thing to do. I think the only way to do it is to build it from the ground up because I don’t think Flash has the library/component for it. I was able to create rows and columns by creating the # of rectangles listed it from the left to the right and move the next coordinate for the next row. Now the most challenging this is to manipulate it. This is the must have feature on my website and we don’t want use Javascript to create table on the server side to create the table.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 100 101 102 103 104 105 106 107 108 109 110 111  | Next Page >