Search Results

Search found 3131 results on 126 pages for 'upper stage'.

Page 108/126 | < Previous Page | 104 105 106 107 108 109 110 111 112 113 114 115  | Next Page >

  • VSTS test deployment and invalid assembly culture

    - by Merlyn Morgan-Graham
    I have a DLL that I'm testing, which links to a DLL that has what I think is an invalid value for AssemblyCulture. The value is "Neutral" (notice the upper-case "N"), whereas the DLL I'm testing, and every other DLL in my project, has a value of "neutral" (because they specify AssemblyCulture("")). When I try to deploy the DLL that links to the problem DLL, I get this error in VSTS: Failed to queue test run '...': Culture is not supported. Parameter name: name Neutral is an invalid culture identifier. <Exception>System.Globalization.CultureNotFoundException: Culture is not supported. Parameter name: name Neutral is an invalid culture identifier. at System.Globalization.CultureInfo..ctor(String name, Boolean useUserOverride) at System.Globalization.CultureInfo..ctor(String name) at System.Reflection.RuntimeAssembly.GetReferencedAssemblies(RuntimeAssembly assembly) at System.Reflection.RuntimeAssembly.GetReferencedAssemblies() at Microsoft.VisualStudio.TestTools.Utility.AssemblyLoadWorker.ProcessChildren(Assembly assembly) at Microsoft.VisualStudio.TestTools.Utility.AssemblyLoadWorker.GetDependentAssemblies(String path) at Microsoft.VisualStudio.TestTools.Utility.AssemblyLoadWorker.GetDependentAssemblies(String path) at Microsoft.VisualStudio.TestTools.Utility.AssemblyLoadStrategy.GetDependentAssemblies(String path) at Microsoft.VisualStudio.TestTools.Utility.AssemblyHelper.GetDependentAssemblies(String path, DependentAssemblyOptions options, String configFile) at Microsoft.VisualStudio.TestTools.TestManagement.DeploymentManager.GetDependencies(String master, String configFile, TestRunConfiguration runConfig, DeploymentItemOrigin dependencyOrigin, List`1 dependencyDeploymentItems, Dictionary`2 missingDependentAssemblies) at Microsoft.VisualStudio.TestTools.TestManagement.DeploymentManager.DoDeployment(TestRun run, FileCopyService fileCopyService) at Microsoft.VisualStudio.TestTools.TestManagement.ControllerProxy.SetupTestRun(TestRun run, Boolean isNewTestRun, FileCopyService fileCopyService, DeploymentManager deploymentManager) at Microsoft.VisualStudio.TestTools.TestManagement.ControllerProxy.SetupRunAndListener(TestRun run, FileCopyService fileCopyService, DeploymentManager deploymentManager) at Microsoft.VisualStudio.TestTools.TestManagement.ControllerProxy.QueueTestRunWorker(Object state)</Exception> Even if I don't link to the DLL (in my VSTS wrapper test, or in the NUnit test), as soon as I add it in my GenericTest file (I'm wrapping NUnit tests), I get that exception. We don't have the source for the problem DLL, and it is also code signed, so I can't solve this by recompiling. Is there a way to skip deploying the dependencies of a DLL DeploymentItem, to fix or disable the culture check, or to work around this by convoluted means (maybe somehow embed the assembly)? Is there a way to override the value for the culture, short of hacking the DLL (and removing code signing so the hack works)? Maybe with an external manifest? Any correct solution must work without weird changes to production code. We can't deploy a hacked DLL, for example. It also must allow the DLL to be instrumented for code coverage. Additional note: I do get a linker warning when compiling the DLL under test that links to the problem DLL, but this hasn't broken anything but VSTS, and multiple versions have shipped.

    Read the article

  • z-index of DIV positioned on top of another div

    - by Elie
    I have two div containers which are structured as follows: <div class="outer-div"> <img src="images/point.png" class="img-a1"> <img src="images/point.png" class="img-a2"> Lots of text goes here. </div> <div class="outer-div"> <img src="images/point.png" class="img-a1"> <img src="images/point.png" class="img-b2"> Some more text goes here </div> The styles associated with this are as follows: .outer-div { position: absolute; top: 0px; left: 0px; width: 500px; } .img-a1 { float:left; z-index:-1; position:relative; margin-left: 250px; margin-bottom: 100px; } .img-b1 { float:right; z-index:-1; position:relative; margin-left: 250px; margin-bottom: 100px; } img-a2 { float:left; z-index:-1; position:relative; margin-left: 400px; margin-bottom: 200px; } img-b2 { float:right; z-index:-1; position:relative; margin-left: 400px; margin-bottom: 200px; } The result of this is to produce something like the following, where ... is the text from div-a and ||| is the text from div-b: .....||||| .....||||| .. || .. || However, since the second div is placed immediately above the first div, none of the text in the second div can be selected, although it can be seen since there is just empty space, and a 1x1 px image above it. Is there a way to get the text from the lower div to be selectable, without making the upper div unselectable?

    Read the article

  • Simple JQuery Validator addMethod not working

    - by tehaaron
    Updated question on the bottom I am trying to validate a super simple form. Eventually the username will be compared to a RegExp statement and the same will go for the password. However right now I am just trying to learn the Validator addMethod format. I currently have this script: JQuery.validator.addMethod( "legalName", function(value, element) { if (element.value == "bob") { return false; } else return true; }, "Use a valid username." ); $(document).ready(function() { $("#form1").validate({ rules: { username: { legalName: true } }, }); }); Which if I am not mistaken should return false and respond with "Use a valid username." if I were to put "bob" into the form. However, it is simply submitting it. I am linking to JQuery BEFORE Validator in the header like instructed. My uber simple form looks like this: <form id="form1" method="post" action=""> <div class="form-row"><span class="label">Username *</span><input type="text" name="username" /></div> <div class="form-row"><input class="submit" type="submit" value="Submit"></div> </form> Finally how would I go about restructing the addMethod function to return true if and false at the else stage while keeping the message alert for a false return? (ignore this last part if you don't understand what I was trying to say :) ) Thanks in advance. Thank to everyone who pointed out my JQuery - jQuery typo. New Ideally, I am trying to turn this into a simple login form (username/password). It is for demonstration only so it wont have a database attached or anything, just some simple js validations. I am looking to make the username validate for <48 characters, only english letters and numbers, no special characters. I thought a whitelist would be easiest so I had something like this: ^[a-zA-Z0-9]*${1,48} but I am not sure if that is proper JS RegExp (it varies from Ruby RegExp if I am not mistaken?...Usually I use rubular.com). Password will be similar but require some upper/lowercase and numbers. I believe I need to make another $.validator.addMethod for legalPassword that will look very similar.

    Read the article

  • N2 CMS SlidingCurtain control is not visible

    - by Carl Raymond
    I just set up a new N2 site by starting with the MVC 2 Web Application template in Visual Studio, then following the directions in N2 CMS Developer Documentation in the section Integrating with Existing ASP.NET MVC Application. I have the basic site running now, but with one problem: the sliding curtain widget that holds the administrative controls is not visible in the upper right corner (when logged in, of course). I can make it visible the hard way by using Firebug to locate it in the DOM, and then disabling a couple of the CSS positioning elements. Once I do that, it seems to work normally. After I open it that way, I can click the various controls, or close it up (and I see the animation). But then it's off screen again. My master page has the sliding curtain just inside the <body> tag: <body> <n2:SlidingCurtain runat="server"> <n2:ControlPanel runat="server" /> </n2:SlidingCurtain> ... The site.css file generated in the base MVC site doesn't seem to do any positioning that would affect this. Firebug shows that right after by <body> tag, I have this: <div class="sc" id="SC" style="top: -2px; left: -574px;"><div class="scContent"> .... The style for <div class="sc" ...> is element.style { left:-574px; top:-2px; } .sc { background:#FFFFFF none repeat-x scroll 0 0; border-color:#CCCCBB; border-style:none solid solid none; border-width:1px; left:-200px; position:fixed; top:-200px; z-index:990; } If I disable both top: and both left: rules, the widget appears.

    Read the article

  • Backing Up vs. Redundancy

    - by TK Kocheran
    I'm currently in stage 2 of 3 of building my home workstation. What this means is that my RAID-0 array of solid state disks will be backed up nightly to a RAID-5 or RAID-6 array of traditional spinning hard disks. However, it recently dawned on me that redundancy is not backup. The main reason for setting up a RAID array with redundancy was to protect myself in the event of a drive failure to serve as an effective backup solution. Wait. What if a bolt of lightning finds a way to travel into my house, through my surge-protector, into my power supply and physically destroys all of my hard disks and SSDs? Well, in that case, I guess I'd be fine because I generally keep most important files (music, pictures, videos) stored in multiple places like on my laptop, my wife's laptop, and an encrypted USB hard drive. Wait. What if a giant hedgehog meteor attacks my house from space traveling at mach 3 and all machines and hard disks are blown to smithereens. Well, I guess I could find a way to do ridiculously slow and cumbersome rsyncs or backups to Amazon's Glacier. Wait. What if there's a nuclear apocalypse... and at this point I start laughing hysterically. At what point does backing up become irrelevant? I completely understand situation one (mechanical drive failure), situation two (workstation compromised or destroyed somehow), possibly even situation three (all machines and disks destroyed), but situation four? There's no questioning the need for backups. None. However, there are three questions I'd really like addressed: To what level should one backup? I definitely understand the merits of physical disk redundancy. I also believe in keeping important files on multiple machines and thinning out the possibility of losing all of my files. Online backups make sense, but they beg the following question. What should I be backing up remotely and how often? It's no problem storage-wise to back up important files (music, pictures, videos) and even configuration and temporal data for all of the machines in my network (all Linux based)... albeit locally. Transferring to the cloud is another story. Worst-case scenario, if I lost all of my configuration for my individual computers, the reality is that I probably lost the machines too. The cloud is a long way away from here; I can run backups over CAT-6 here and see 100MB/s easily, but I'm afraid that I'm only going to see 2MB/s at best when transferring up to the cloud.

    Read the article

  • Linq to SQL Repository ~theory~ - Generic but now uses Linq to Objects?

    - by Matt Tolliday
    The project I am currently working on used Linq to SQL as an ORM data access technology. Its an MVC3 Web app. The problem I faced was primarily due to the inability to mock (for testing) the DataContext which gets autogenerated by the DBML designer. So to solve this issue (after much reading) I refactored the repository system which was in place - single repository with seperate and duplicated access methods for each table which ended up with something like 300 methods only 10 of which were unique - into a single repository with generic methods taking the table and returning more generic types to the upper reaches of the application. My question revolves more around the design I've used to get thus far and the differences I'm noticing in the structure of the app. 1) Having refactored the code from the dark ages which used classic Linq to SQL queries: public Billing GetBilling(int id) { var result = ( from bil in _bicDc.Billings where bil.BillingId == id select bil).SingleOrDefault(); return (result); } it now looks like: public T GetRecordWhere<T>(Expression<Func<T, bool>> predicate) where T : class { T result; try { result = _dataContext.GetTable<T>().Where(predicate).SingleOrDefault(); } catch (Exception ex) { throw ex; } return result; } and is used by the controller with a query along the lines of: _repository.GetRecordWhere<Billing>(x => x.BillingId == 1); which is fine, and precisely what I wanted to achieve. ...however.... I'm also having to do the following to get precisely the result set i require in the controller class (the highest point of the app in essence)... viewModel.RecentRequests = _model.GetAllRecordsWhere<Billing>(x => x.BillingId == 1) .Where(x => x.BillingId == Convert.ToInt32(BillingType.Submitted)) .OrderByDescending(x => x.DateCreated). Take(5).ToList(); This - as far as my understanding is correct - is now using Linq to Objects rather than the Linq to SQL queries I was previously? Is this okay practise? It feels wrong to me but I dont know why. Probably because the logic of the queries is in the very highest tier of the app, rather than the lowest, but... I defer to you good people for advice. One of the issues I considered was bringing the entire table into memory but I understand that using the Iqeryable return type the where clause is taken to the database and evaluated there. Thus returning only the resultset i require... i may be wrong. And if you've made it this far, well done. Thank you, and if you have any advice it is very much appreciated!!

    Read the article

  • Binding Silverlight UserControl custom properties to its' elements

    - by ghostskunks
    Hi. I'm trying to make a simple crossword puzzle game in Silverlight 2.0. I'm working on a UserControl-ish component that represents a square in the puzzle. I'm having trouble with binding up my UserControl's properties with its' elements. I've finally (sort of) got it working (may be helpful to some - it took me a few long hours), but wanted to make it more 'elegant'. I've imagined it should have a compartment for the content and a label (in the upper right corner) that optionally contains its' number. The content control probably be a TextBox, while label control could be a TextBlock. So I created a UserControl with this basic structure (the values are hardcoded at this stage): <UserControl x:Class="XWord.Square" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" FontSize="30" Width="100" Height="100"> <Grid x:Name="LayoutRoot" Background="White"> <Grid.ColumnDefinitions> <ColumnDefinition Width="*"/> <ColumnDefinition Width="Auto"/> </Grid.ColumnDefinitions> <Grid.RowDefinitions> <RowDefinition Height="Auto"/> <RowDefinition Height="*"/> </Grid.RowDefinitions> <TextBlock x:Name="Label" Grid.Row="0" Grid.Column="1" Text="7"/> <TextBox x:Name="Content" Grid.Row="1" Grid.Column="0" Text="A" BorderThickness="0" /> </Grid> </UserControl> I've also created DependencyProperties in the Square class like this: public static readonly DependencyProperty LabelTextProperty; public static readonly DependencyProperty ContentCharacterProperty; // ...(static constructor with property registration, .NET properties // omitted for brevity)... Now I'd like to figure out how to bind the Label and Content element to the two properties. I do it like this (in the code-behind file): Label.SetBinding( TextBlock.TextProperty, new Binding { Source = this, Path = new PropertyPath( "LabelText" ), Mode = BindingMode.OneWay } ); Content.SetBinding( TextBox.TextProperty, new Binding { Source = this, Path = new PropertyPath( "ContentCharacter" ), Mode = BindingMode.TwoWay } ); That would be more elegant done in XAML. Does anyone know how that's done?

    Read the article

  • Programming a windows service

    - by xarzu
    I have started prgramming a windows service. I have added a notify icon from the toolbox. It has the small notify icon that appears in the systray as a member of those icons. It works so far. So far I have a blank form. I have used the DoubleClick for the notifyIcon to bring up the form (I will use the form for something later). Now I have a list of things I want to accomplish to make this work like a true windows service. First of all, if possible, I owuld like to remove the maximize and cancel button on the form. Most windos service apps that I have seen offer the ability to close the app by right-mouse-button clicking on the notify icon which brings up a menu of options. I see in the properties of the form under Misc there is an CancelButton. But I do not see how do deactivate it. In the Properties of the forum I see under Window Style there is a ControlBox option that, if I turn to false, all three buttons, (minimize, maximize and cancel) go away. These are not what i am looking for. I would not like the option for them to resize, maximize or close the form here. I suspect people will close the box intending to make the box go away while still wanting the app to run. Under the "Focus" caption in Properties, there id "Deactivate". I have created my own event/method/function for this and in debug I noticed that when you click on the x-box in the upper right corner, this function is called. The problem is that after the function is over, the app closes anyway. How do I over-ride this function? Secondly, how do you catch the right button click event on the notify icon in the systray? I can see how to create events for "Click" and "MouseClick" etc. but how so I determine which button was click? Using the right buton click is how such programs know when to pull up a menu. So I would like to know how to do this as well.

    Read the article

  • Oracle Coding Standards Feature Implementation

    - by Mike Hofer
    Okay, I have reached a sort of an impasse. In my open source project, a .NET-based Oracle database browser, I've implemented a bunch of refactoring tools. So far, so good. The one feature I was really hoping to implement was a big "Global Reformat" that would make the code (scripts, functions, procedures, packages, views, etc.) standards compliant. (I've always been saddened by the lack of decent SQL refactoring tools, and wanted to do something about it.) Unfortunatey, I am discovering, much to my chagrin, that there doesn't seem to be any one widely-used or even "generally accepted" standard for PL-SQL. That kind of puts a crimp on my implementation plans. My search has been fairly exhaustive. I've found lots of conflicting documents, threads and articles and the opinions are fairly diverse. (Comma placement, of all things, seems to generate quite a bit of debate.) So I'm faced with a couple of options: Add a feature that lets the user customize the standard and then reformat the code according to that standard. —OR— Add a feature that lets the user customize the standard and simply generate a violations list like StyleCop does, leaving the SQL untouched. In my mind, the first option saves the end-users a lot of work, but runs the risk of modifying SQL in potentially unwanted ways. The second option runs the risk of generating lots of warnings and doing no work whatsoever. (It'd just be generally annoying.) In either scenario, I still have no standard to go by. What I'd need to know from you guys is kind of poll-ish, but kind of not. If you were going to use a tool of this nature, what parts of your SQL code would you want it to warn you about or fix? Again, I'm just at a loss due to a lack of a cohesive standard. And given that there isn't anything out there that's officially published by Oracle, I think this is something the community could weigh in on. Also, given the way that voting works on SO, the votes would help to establish the popularity of a given "refactoring." P.S. The engine parses SQL into an expression tree so it can robustly analyze the SQL and reformat it. There should be quite a bit that we can do to correct the format of the SQL. But I am thinking that for the first release of the thing, layout is the primary concern. Though it is worth noting that the thing already has refactorings for converting keywords to upper case, and identifiers to lower case.

    Read the article

  • prgramming a windows service

    - by xarzu
    I have started prgramming a windows service. I have added a notify icon from the toolbox. It has the small notify icon that appears in the systray as a member of those icons. It works so far. So far I have a blank form. I have used the DoubleClick for the notifyIcon to bring up the form (I will use the form for something later). Now I have a list of things I want to accomplish to make this work like a true windows service. First of all, if possible, I owuld like to remove the maximize and cancel button on the form. Most windos service apps that I have seen offer the ability to close the app by right-mouse-button clicking on the notify icon which brings up a menu of options. I see in the properties of the form under Misc there is an CancelButton. But I do not see how do deactivate it. In the Properties of the forum I see under Window Style there is a ControlBox option that, if I turn to false, all three buttons, (minimize, maximize and cancel) go away. These are not what i am looking for. I would not like the option for them to resize, maximize or close the form here. I suspect people will close the box intending to make the box go away while still wanting the app to run. Under the "Focus" caption in Properties, there id "Deactivate". I have created my own event/method/function for this and in debug I noticed that when you click on the x-box in the upper right corner, this function is called. The problem is that after the function is over, the app closes anyway. How do I over-ride this function? Secondly, how do you catch the right button click event on the notify icon in the systray? I can see how to create events for "Click" and "MouseClick" etc. but how so I determine which button was click? Using the right buton click is how such programs know when to pull up a menu. So I would like to know how to do this as well.

    Read the article

  • physics game programming box2d - orientating a turret-like object using torques

    - by egarcia
    This is a problem I hit when trying to implement a game using the LÖVE engine, which covers box2d with Lua scripting. The objective is simple: A turret-like object (seen from the top, on a 2D environment) needs to orientate itself so it points to a target. The turret is on the x,y coordinates, and the target is on tx, ty. We can consider that x,y are fixed, but tx, ty tend to vary from one instant to the other (i.e. they would be the mouse cursor). The turret has a rotor that can apply a rotational force (torque) on any given moment, clockwise or counter-clockwise. The magnitude of that force has an upper limit called maxTorque. The turret also has certain rotational inertia, which acts for angular movement the same way mass acts for linear movement. There's no friction of any kind, so the turret will keep spinning if it has an angular velocity. The turret has a small AI function that re-evaluates its orientation to verify that it points to the right direction, and activates the rotator. This happens every dt (~60 times per second). It looks like this right now: function Turret:update(dt) local x,y = self:getPositon() local tx,ty = self:getTarget() local maxTorque = self:getMaxTorque() -- max force of the turret rotor local inertia = self:getInertia() -- the rotational inertia local w = self:getAngularVelocity() -- current angular velocity of the turret local angle = self:getAngle() -- the angle the turret is facing currently -- the angle of the like that links the turret center with the target local targetAngle = math.atan2(oy-y,ox-x) local differenceAngle = _normalizeAngle(targetAngle - angle) if(differenceAngle <= math.pi) then -- counter-clockwise is the shortest path self:applyTorque(maxTorque) else -- clockwise is the shortest path self:applyTorque(-maxTorque) end end ... it fails. Let me explain with two illustrative situations: The turret "oscillates" around the targetAngle. If the target is "right behind the turret, just a little clock-wise", the turret will start applying clockwise torques, and keep applying them until the instant in which it surpasses the target angle. At that moment it will start applying torques on the opposite direction. But it will have gained a significant angular velocity, so it will keep going clockwise for some time... until the target will be "just behind, but a bit counter-clockwise". And it will start again. So the turret will oscillate or even go in round circles. I think that my turret should start applying torques in the "opposite direction of the shortest path" before it reaches the target angle (like a car braking before stopping). Intuitively, I think the turret should "start applying torques on the opposite direction of the shortest path when it is about half-way to the target objective". My intuition tells me that it has something to do with the angular velocity. And then there's the fact that the target is mobile - I don't know if I should take that into account somehow or just ignore it. How do I calculate when the turret must "start braking"?

    Read the article

  • Wake On Lan only works on first boot, not sequent ones

    - by sp3ctum
    I have converted my old Dell Latitude D410 laptop to a server for tinkering. It is running an updated Debian Squeeze (6) with a Xen enabled kernel (I want to toy with virtual machines later on). I am running it 'headless' via an ethernet connection. I am struggling to enable Wake On Lan for the box. I have enabled the setting in the BIOS, and it works nicely, but only for the first time after the power cord is plugged in. Here is my test: Plug in power cord, don't boot yet Send magic Wake On Lan packet from test machine (Ubuntu) using the wakeonlan program Server expected to start (does every time) Once server has booted, log in via ssh and shut it down via the operating system After shutdown, wake server up via WOL again (fails every time) Some observations: Right after step 1 I can see the integrated NIC has a light on. I deduce this means the NIC gets adequate power and that the ethernet cable is connected to my switch. This light is not on after step 4 (the shutdown stage). The light becomes back on after I disconnect and reconnect the power cord, after which WOL works as well. After step 4 I can verify that wake on lan is enabled via the ethtool program (repeatable each time) This blog post suggested the problem may lay in the fact the motherboard might not be giving adequate power to the NIC after shutdown, so I copied an acpitool script that supposedly should signal the system to give the needed power to the card when shut down. Obviously it did not fix my issue. I have included the relevant power settings in the paste below. I have tried different combinations of parameters of shutdown (the program) options, as well as the poweroff program. I even tried "telinit 0", which I figured would do the most direct boot via software. If I keep the laptop's power button pressed down and do a hard boot this way, the light on the ethernet port stays lit and a WOL is possible. I copied a bunch of hopefully useful information in this paste I have tried this with the laptop battery connected and without it. I get the same result. Promptly pressing the power button causes the system to shut down with the message "The system is going down for system halt NOW!", and WOL is still unsuccessful.

    Read the article

  • Richfaces modal panel and a4j:keepAlive

    - by mykola
    Hello! I've got unexpected problems with richfaces (3.3.2) modal panel. When i try to open it, browser opens two panels instead of one: one is in the center, another is in the upper left corner. Besides, no fading happens. Also i have three modes: view, edit, new - and when i open my panel it should show either "Create new..." or "Edit..." in the header and actually it shows but not in the header as the latter isn't rendered at all though it should, because i set proper mode in action before opening this modal panel. Besides it works fine on all other pages i've made and there are tens of such pages in my application. I can't understand what's wrong here. The only way to fix it is to remove <a4j:keepAlive/> from the page that is very strange, imho. I'm not sure if code will be usefull here as it works fine everywhere in my application but this only case. So if you put it on your page it will probably work without problems. My only question is: are there any hidden or rare problems in interaction of these two elements (<rich:modalPanel> and <a4j:keepAlive>)? Or shall i spent another two or three days searching for some wrong comma, parenthesis or whatever in my code? :) For most curious. Panel itself: <!-- there's no outer form --> <rich:modalPanel id="panel" autosized="true" minWidth="300" minHeight="200"> <f:facet name="header"> <h:panelGroup id="panelHeader"> <h:outputText value="#{msg.new_smth}" rendered="#{MbSmth.newMode}"/> <h:outputText value="#{msg.edit_smth}" rendered="#{MbSmth.editMode}"/> </h:panelGroup> </f:facet> <h:panelGroup id="panelDiv"> <h:form > <!-- fields and buttons --> </h:form> </h:panelGroup> </rich:modalPanel> One of the buttons that open panel: <a4j:commandButton id="addBtn" reRender="panelHeader, panelDiv" value="#{form.add}" oncomplete="#{rich:component('panel')}.show()" action="#{MbSmth.add}" image="create.gif"/> Action invoked on button click: public void add() { curMode = NEW_MODE; // initial mode is VIEW_MODE newSmth = new Smth(); } Mode check: public boolean isNewMode() { return curMode == NEW_MODE; } public boolean isEditMode() { return curMode == EDIT_MODE; }

    Read the article

  • What presentation software suits my needs?

    - by claws
    Background: I'm teaching biology to 12th grade students. The syllabus I'm teaching is huge. I mean literally, very huge. There is a lot for students to remember. There are no less than 1000 facts (weird names, dates etc) for students to remember. They'll have to remember all of them, they don't have a choice. The notes I compiled for their learning itself is upto 80 printed pages(Just the bullet outline & facts). That's just one chapter. We have 34 chapters. Also my students are very hardworking, they study upto 8-10hrs per day (Yeah! we are from India :). So, I want to ensure maximum retaining by the students at each and every stage (Teaching & Learning). I'm trying to as many memory training techniques as possible. I'm trying to incorporate, mnemonics, strong visual aids (pictures, 3D-animations, real videos etc.), spaced repetition etc. I think MS powerpoint is not suitable for my needs: There are about 200 slides per chapter. Its very easy for students to get lost while teaching. Because the problem with powerpoint is that it gives facts (as bullets) but it doesn't exploit the association & organization (Concept Map) of the content, which helps students learn quickly. I found an amazing software called XMind. You can see the screenshot here. Problem is that it is not as powerpoint in terms of powerpoint. This software can be used for just for concept maps. In the above screenshot, each topic occupies a single slide. I have an Image/picture(Detailed huge picture) and about 5-10 bullet points and probably a video or an animation of somethings. And this XMind is not good at presenting, in terms that it doesn't allow me to set what to present after what. I want to present a top down view, with a slide for each topic. PS: I Don't like prezi.com. I tried but it simply is too confusing for my students. It zooms here and there. I didn't tried it but I've seen few presentations.

    Read the article

  • Segmenting a double array of labels

    - by Ami
    The Problem: I have a large double array populated with various labels. Each element (cell) in the double array contains a set of labels and some elements in the double array may be empty. I need an algorithm to cluster elements in the double array into discrete segments. A segment is defined as a set of pixels that are adjacent within the double array and one label that all those pixels in the segment have in common. (Diagonal adjacency doesn't count and I'm not clustering empty cells). |-------|-------|------| | Jane | Joe | | | Jack | Jane | | |-------|-------|------| | Jane | Jane | | | | Joe | | |-------|-------|------| | | Jack | Jane | | | Joe | | |-------|-------|------| In the above arrangement of labels distributed over nine elements, the largest cluster is the “Jane” cluster occupying the four upper left cells. What I've Considered: I've considered iterating through every label of every cell in the double array and testing to see if the cell-label combination under inspection can be associated with a preexisting segment. If the element under inspection cannot be associated with a preexisting segment it becomes the first member of a new segment. If the label/cell combination can be associated with a preexisting segment it associates. Of course, to make this method reasonable I'd have to implement an elaborate hashing system. I'd have to keep track of all the cell-label combinations that stand adjacent to preexisting segments and are in the path of the incrementing indices that are iterating through the double array. This hash method would avoid having to iterate through every pixel in every preexisting segment to find an adjacency. Why I Don't Like it: As is, the above algorithm doesn't take into consideration the case where an element in the double array can be associated with two unique segments, one in the horizontal direction and one in the vertical direction. To handle these cases properly, I would need to implement a test for this specific case and then implement a method that will both associate the element under inspection with a segment and then concatenate the two adjacent identical segments. On the whole, this method and the intricate hashing system that it would require feels very inelegant. Additionally, I really only care about finding the large segments in the double array and I'm much more concerned with the speed of this algorithm than with the accuracy of the segmentation, so I'm looking for a better way. I assume there is some stochastic method for doing this that I haven't thought of. Any suggestions?

    Read the article

  • is it possible to extract certain strings based off a predefined white-space count?

    - by s2xi
    So after several Advil's I think I need help I am trying to make a script that lets the user upload a .txt file, the file will look like this as an example EXT. DUNKIN' DONUTS - DAY Police vehicles remain in the parking lot. The determined female reporter from the courthouse steps, MELINDA FUENTES (32), interviews Comandante Chitt, who holds a napkin to his jaw, like he cut himself shaving. MELINDA < Comandante Chitt, how does it feel to get shot in the face? > COMANDANTE CHITT < Not too different than getting shot in the arm or leg. > MELINDA < Tell us what happened. > COMANDANTE CHITT < I parked my car. (indicates assault vehicle in donut shop) He aimed his weapon at my head. I fired seven shots. He stopped aiming his weapon at my head. > Melinda waits for more, but Chitt turns and walks away into the roped-off crime scene. Melinda is confused for a second, then resumes smiling. MELINDA < And there you have it... A man of few words. > Ok, so based off of this what I want to do is this: The PHP script looks at the file and counts 35 white spaces, since all files will have the same layout and never differ in white spaces I chose this as the best way to go. for every 35 white spaces extract character 36 until the end of line. Then tally up $character++ so in the end the output would look like ----------------------------------- It looks like you have 2 characters in your script Melinda Commandante Chitt ----------------------------------- using PHP to select distinct names, and use the strtolower() to lower case the strings and ucfirst() to make the first letter upper-case thats my project, I'm at the stage where I'm going crazy trying to figure out how to count white-spaces and everything after that white space until the first white-space after the word IS a character name

    Read the article

  • Favorite Visual Studio keyboard remappings?

    - by hoytster
    Stack Overflow has covered favorite short-cuts and add-ins, optimizations and preferences -- great topics all. If this one has been covered, I can't find it -- so thanks in advance for the link. What are your favorite Visual Studio keyboard remappings? Mine are motivated by the fact that I'm a touch-typist. Mouse, function keys, arrow keys, Home, End -- bleh. These are commands I do all day every day, so I've remapped them to sequences I can execute without moving my hands from the home row. The command that is remapped in Tools = Customize = [Keyboard] is shown in parentheses. I'm 100% positive that there are better remappings than these, so please post yours! Please include the command; oft times, figuring it out is a challenge. -- Hoytster Running the app and operating the debugger Ctrl+Q + Ctrl+R Run the application, in debug mode (Debug.Start) Ctrl+Q + Ctrl+Q Quit (stop) the application (Debug.StopDebugging) Ctrl+T Toggle a breakpoint at the current line (Debug.ToggleBreakpoint) Ctrl+K + Ctrl+I Step Into the method (Debug.StepInto) Ctrl+K + Ctrl+O Step Out of the method (Debug.StepOut) Ctrl+N Step over the method to the Next statement (Debug.StepOver) Ctrl+K + Ctrl+C Run the code, stopping at the Cursor position (Debug.RunToCursor) Ctrl+K + Ctrl+E Set then next statement to Execute (Debug.SetNextStatement) Navigating the code Ctrl+S Move a character LEFT (Edit.CharLeft) Ctrl+D Move a character RIGHT (Edit.CharRight) Ctrl+Q + Ctrl+S Move to the LEFT END of the current line (Edit.LineStart) Ctrl+Q + Ctrl+D Move to the RIGHT END of the current line (Edit.LineEnd) Ctrl+E Move a line UP (Edit.LineUp) Ctrl+X Move a line DOWN (Edit.LineDown) Ctrl+K + Ctrl+K Toggle (add or remove) bookmark (Edit.ToggleBookmark) Ctrl+K + Ctrl+N Move to the NEXT bookmark (Edit.NextBookmark) Ctrl+K + Ctrl+P Move to the PREVIOUS bookmark (Edit.PreviousBookmark) Ctrl+Q + Ctrl+W Save all modified Windows (File.SaveAll) Ctrl+L Find the NEXT instance of the search string (Edit.FindNext) Ctrl+K + Ctrl+L Find the PREVIOUS instance of the search string (Edit.FindPrevious) Ctrl+Q + Ctrl+L Drop down the list of open files (Window.ShowEzMDIFileList) The last sequence is like clicking the downward-facing triangle in the upper-right corner of the code editor window. VS will display a list of all the open windows. You can select from the list by typing the file name; the matching file will be selected as you type. Pause for a second and resume typing, and the matching process starts over, so you can select a different file. Nice, VS Team. The key takes you to the tab for the selected file.

    Read the article

  • How to apply or chain multiple matching templates in XSLT?

    - by Ignatius
    I am working on a stylesheet employing many templates with match attributes: <xsl:template match="//one" priority="0.7"> <xsl:param name="input" select="."/> <xsl:value-of select="util:uppercase($input)"/> <xsl:next-match /> </xsl:template> <xsl:template match="/stuff/one"> <xsl:param name="input" select="."/> <xsl:value-of select="util:add-period($input)"/> </xsl:template> <xsl:function name="util:uppercase"> <xsl:param name="input"/> <xsl:value-of select="upper-case($input)"/> </xsl:function> <xsl:function name="util:add-period"> <xsl:param name="input"/> <xsl:value-of select="concat($input,'.')"/> </xsl:function> What I would like to do is be able to 'chain' the two functions above, so that an input of 'string' would be rendered in the output as 'STRING.' (with the period.) I would like to do this in such a way that doesn't require knowledge of other templates in any other template. So, for instance, I would like to be able to add a "util:add-colon" method without having to open up the hood and monkey with the existing templates. I was playing around with the <xsl:next-match/> instruction to accomplish this. Adding it to the first template above does of course invoke both util:uppercase and util:add-period, but the output is an aggregation of each template output (i.e. 'STRINGstring.') It seems like there should be an elegant way to chain any number of templates together using something like <xsl:next-match/>, but have the output of each template feed the input of the next one in the chain. Am I overlooking something obvious?

    Read the article

  • Code-Golf: Friendly Number Abbreviator

    - by David Murdoch
    Based on this question: Is there a way to round numbers into a friendly format? THE CHALLENGE - UPDATED! (removed hundreds abbreviation from spec) The shortest code by character count that will abbreviate an integer (no decimals). Code should include the full program. Relevant range is from 0 - 9,223,372,036,854,775,807 (the upper limit for signed 64 bit integer). The number of decimal places for abbreviation will be positive. You will not need to calculate the following: 920535 abbreviated -1 place (which would be something like 0.920535M). Numbers in the tens and hundreds place (0-999) should never be abbreviated (the abbreviation for the number 57 to 1+ decimal places is 5.7dk - it is unneccessary and not friendly). Remember to round half away from zero (23.5 gets rounded to 24). Banker's rounding is verboten. Here are the relevant number abbreviations: h = hundred (102) k = thousand (103) M = million (106) G = billion (109) T = trillion (1012) P = quadrillion (1015) E = quintillion (1018) SAMPLE INPUTS/OUTPUTS (inputs can be passed as separate arguments): First argument will be the integer to abbreviate. The second is the number of decimal places. 12 1 => 12 // tens and hundreds places are never rounded 1500 2 => 1.5k 1500 0 => 2k // look, ma! I round UP at .5 0 2 => 0 1234 0 => 1k 34567 2 => 34.57k 918395 1 => 918.4k 2134124 2 => 2.13M 47475782130 2 => 47.48G 9223372036854775807 3 => 9.223E // ect... . . . Original answer from related question (javascript, does not follow spec): function abbrNum(number, decPlaces) { // 2 decimal places => 100, 3 => 1000, etc decPlaces = Math.pow(10,decPlaces); // Enumerate number abbreviations var abbrev = [ "k", "m", "b", "t" ]; // Go through the array backwards, so we do the largest first for (var i=abbrev.length-1; i>=0; i--) { // Convert array index to "1000", "1000000", etc var size = Math.pow(10,(i+1)*3); // If the number is bigger or equal do the abbreviation if(size <= number) { // Here, we multiply by decPlaces, round, and then divide by decPlaces. // This gives us nice rounding to a particular decimal place. number = Math.round(number*decPlaces/size)/decPlaces; // Add the letter for the abbreviation number += abbrev[i]; // We are done... stop break; } } return number; }

    Read the article

  • Unable to telnet out on port 25 on windows server 2008

    - by NickGPS
    Hi All, I just setup a Windows 2008 R2 server and am trying to get a basic mail server up and running so that I can send emails from my applications. I setup a virtual SMTP server in IIS6 and tried doing a local telnet to port 25, which seemed to work fine. There were no errors during this stage and I can see the mail message appear in the Queue folder. The problem is that mail never leaves the Queue folder. I then tried to telnet to a remote mail server on port 25 but couldn't connect:- telnet 209.85.227.27 25 Could not open connection to the host, on port 25: Connection failed) I checked my firewall and there is a default setting to allow all outgoing TCP traffic with no restriction. I even setup a specific rule for outgoing port 25 traffic but to no avail. I then ran a SmtpDiag.exe command .\SmtpDiag.exe [email protected] [email protected] and received the following output Searching for Exchange external DNS settings. Computer name is WIN-SERVERNAME. Failed to connect to the domain controller. Error: 8007054b Checking SOA for gmail.com. Checking external DNS servers. Checking internal DNS servers. SOA serial number match: Passed. Checking local domain records. Checking MX records using TCP: gmail.com. Checking MX records using UDP: gmail.com. Both TCP and UDP queries succeeded. Local DNS test passed. Checking remote domain records. Checking MX records using TCP: gmail.com. Checking MX records using UDP: gmail.com. Both TCP and UDP queries succeeded. Remote DNS test passed. Checking MX servers listed for [email protected]. Connecting to gmail-smtp-in.l.google.com [209.85.227.27] on port 25. Connecting to the server failed. Error: 10060 Failed to submit mail to gmail-smtp-in.l.google.com. Is there any other diagnostics I can do to figure out if it's my firewall or something else? I have removed antivirus to make sure that it wasn't causing the problem. Any ideas would be much appreciated.

    Read the article

  • Puppet and launchd services?

    - by Joel Westberg
    We have a production environment configured with Puppet, and want to be able to set up a similar environment on our development machines: a mix of Red Hats, Ubuntus and OSX. As might be expected, OSX is the odd man out here, and sadly, I'm having a lot of trouble with getting this to work. My first attempt was using macports, using the following declaration: package { 'rabbitmq-server': ensure => installed, provider => macports, } but this, sadly, generates the following error: Error: /Stage[main]/Rabbitmq/Package[rabbitmq-server]: Could not evaluate: Execution of '/opt/local/bin/port -q installed rabbitmq-server' returned 1: usage: cut -b list [-n] [file ...] cut -c list [file ...] cut -f list [-s] [-d delim] [file ...] while executing "exec dscl -q . -read /Users/$env(SUDO_USER) NFSHomeDirectory | cut -d ' ' -f 2" (procedure "mportinit" line 95) invoked from within "mportinit ui_options global_options global_variations" Next up, I figured I'd give homebrew a try. There is no package provider available by default, but puppet-homebrew seemed promising. Here, I got much farther, and actually managed to get the install to work. package { 'rabbitmq': ensure => installed, provider => brew, } file { "plist": path => "/Library/LaunchDaemons/homebrew.mxcl.rabbitmq.plist", source => "/usr/local/opt/rabbitmq/homebrew.mxcl.rabbitmq.plist", ensure => present, owner => root, group => wheel, mode => 0644, } service { "homebrew.mxcl.rabbitmq": enable => true, ensure => running, provider => "launchd", require => [ File["/Library/LaunchDaemons/homebrew.mxcl.rabbitmq.plist"] ], } Here, I don't get any error. But RabbitMQ doesn't start either (as it does if I do a manual load with launchctl) [... snip ...] Debug: Executing '/bin/launchctl list' Debug: Executing '/usr/bin/plutil -convert xml1 -o /dev/stdout /Library/LaunchDaemons/homebrew.mxcl.rabbitmq.plist' Debug: Executing '/usr/bin/plutil -convert xml1 -o /dev/stdout /var/db/launchd.db/com.apple.launchd/overrides.plist' Debug: /Schedule[weekly]: Skipping device resources because running on a host Debug: /Schedule[puppet]: Skipping device resources because running on a host Debug: Finishing transaction 2248294820 Debug: Storing state Debug: Stored state in 0.01 seconds Finished catalog run in 25.90 seconds What am I doing wrong?

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • how to animate 2 surfaces in Matlab?

    - by Kate
    Hi everyone, I've written this code which makes an animation of 2 ellipsoids. Parameter k1 of these ellipsoids must depend on time (so they'd move asynchronously), but I need to animate them in one figure. Can I use loop for it or is it better to use timer & some kind of callback functions? The second problem - I need to move inner ellipsoid so they would have one common side. How can I do this? a=5; b=a; c=10; u = (0:0.05*pi:2*pi)'; v = [0:0.05*pi:2*pi]; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; % cut upper V1=4/3*pi*a*b*c; d=1/2; e=2^d; a2=a/e; b2=a/e; c2=c; V2=4/3*pi*a2*b2*c2; X2 = a2*sin(u)*cos(v);%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; % cut h=1/3; for j = 1:20 k1=(sin(pi*j/20)+0.5)^h; a=a*k1; c=c*k1; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; a2=a2*k1; b2=a2*k1; c2=c2*k1; X2 = a2*sin(u)*cos(v)+5;%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; hS1=surf(X,Y,Z); alpha(.11) hold on hS2=surf(X2,Y2,Z2); hold off axis([-20 20 -20 20 -20 20]); F(j) = getframe; end movie(F,4)

    Read the article

  • Unknown problem causing major computer failure, Booting problem with windows 7, mainly with 0x0000000A

    - by ken
    Where do I begin? OS=Windows 7 I think it all started when I ran an installation file. I suspect it may have been a virus (even though AVG scan didnt pick anything up). The installation failed, computer crashed then restarted. In the middle of the reboot, I get BSOD. Normal boot up doesnt work so I use safe mode. Method 1: Not a problem I thought cos I will do what I normally do and that was to recover from my image file. Unfortunately, my Acronis software cant recover in safe mode. Method 2: I created a bootable disc for the Acronis recovery software. Managed to boot to Acronis and started the recovery from image file. This fail with some error message (did not manage to record). Something to do with not be able to copy to $AVG folder. Method 3: At this stage, assumed it was still a virus causing the problem so decided to format that partition to remove everything and hopefully the virus too. Had a lot of problems trying to bypass the system to allow me to format but (i think- more on this later) I managed to do that. Image was recovered, thought problem was resolved. Tried to boot windows but new error: Boot Manager is missing. Read up on this and managed to copy the Boot Manager from my Laptop's Manufacturer's partition (partition contains factory setup image file). Windows loaded but new BSOD with 0x000000A problem. Method 4: Attempted to reinstall factory settings but this failed cos i suspect by formating the partition, I may have removed the recovery software. Tried to create a bootable dvd of factory setting but machine is so bad it continues to crash. Bootable dvd method failed. Method 5:Spent alot of time reading up on this error, even installed a software to help scan and fix the problem. Scan failed and software required money! Anyway, lots of BSOD with different error message like 0x00000001A and 0x0000000D1. Error message changes with some reboots. Method 6: Found a hotfix from the windows site to fix 0x0000000A problem, great I thought! In safe mode, I cant install the file cos of error:0x8007043c. Tried to then install the fix in normal mode but installation just hangs. Returned to safe mode and followed advice to bypass 0x8007043c by changing the BITS status (read here: http://www.vistaheads.com/forums/microsoft-public-windowsupdate/181931-error-number-0x8007043c-windows-update.html). However, my machine at this time is so flaky that it hangs everytime i right mouse click the computer icon. I am at my wits end. Ya help or ideas? Cheers

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 104 105 106 107 108 109 110 111 112 113 114 115  | Next Page >