Search Results

Search found 10042 results on 402 pages for 'bundle module'.

Page 113/402 | < Previous Page | 109 110 111 112 113 114 115 116 117 118 119 120  | Next Page >

  • Updating DetailViewController from RootController

    - by Stefano Salmaso
    I'm trying to create an iPad application with a similar user interface to Apple's Mail application, i.e: RootView controller (table view) on the left hand side of the split view for navigation with a multiple view hierarchy. When a table cell is selected a new table view is pushed on the left hand side The new view on the left side can update the detail view. I can accomplish both tasks BUT NOT TOGETHER. I mean I can make a multi-level table view in the RootController.(HERE you can find the working source code). Or I can make a single-level table view in the RootController which can update the detailViewController (here there is the source code:http://www.megaupload.com/?d=D6L0463G). Can anyone tell me how to make a multi-level table in the RootController which can update a detailViewController? There is more source code at the link but below is the method in which I presume I have to declare a new detailViewController (which has to be put in the UISplitViewController): - (void)tableView:(UITableView *)TableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { NSDictionary *dictionary = [self.tableDataSource objectAtIndex:indexPath.row]; //Get the children of the present item. NSArray *Children = [dictionary objectForKey:@"Children"]; // if([Children count] == 0) { /* Create and configure a new detail view controller appropriate for the selection. */ NSUInteger row = indexPath.row; UIViewController <SubstitutableDetailViewController> *detailViewController = nil; if (row == 0) { FirstDetailViewController *newDetailViewController = [[FirstDetailViewController alloc]initWithNibName:@"FirstDetailView" bundle:nil]; detailViewController = newDetailViewController; } if (row == 1) { SecondDetailViewController *newDetailViewController = [[SecondDetailViewController alloc]initWithNibName:@"SecondDetailView" bundle:nil]; detailViewController = newDetailViewController; } // Update the split view controller's view controllers array. NSArray *viewControllers = [[NSArray alloc] initWithObjects:self.navigationController, detailViewController, nil]; splitViewController.viewControllers = viewControllers//nothing happens..... [viewControllers release];// } else { //Prepare to tableview. RootViewController *rvController = [[RootViewController alloc]initWithNibName:@"RootViewController" bundle:[NSBundle mainBundle]]; //Increment the Current View rvController.current_level += 1; //Set the title; rvController.current_title = [dictionary objectForKey:@"Title"]; //Push the new table view on the stack [self.navigationController pushViewController:rvController animated:YES]; rvController.tableDataSource = Children; [rvController.tableView reloadData]; //without this instrucion,items won't be loaded inside the second level of the table [rvController release]; } }

    Read the article

  • Why is my UIViewController initializer never called?

    - by mystify
    I made a view-based project from a fresh template. There's a UIViewController which is created with an XIB. In the implementation I uncommented that and added an NSLog. But this is never called: // The designated initializer. Override to perform setup that is required before the view is loaded. - (id)initWithNibName:(NSString *)nibNameOrNil bundle:(NSBundle *)nibBundleOrNil { if ((self = [super initWithNibName:nibNameOrNil bundle:nibBundleOrNil])) { // Custom initialization NSLog(@"nib"); } return self; } since that is initialized from a nib / xib, that should be called for sure, right? however, it doesn't. I do get an NSLog message when I put that in viewDidLoad.

    Read the article

  • What is the proper location for a sqlite3 database file?

    - by Elliot Chen
    Hi, Everyone: I'm using a sqlite3 database to store app's data. Instead of building a database within program, I introduced an existing db file: 'abc.sqlite' into my project and put it under my 'Resources' folder. So, I think this db file should be inside of 'bundle', so at my init function, I used following statement to read it out: NSString *path = [[NSBundle mainBundle] pathForResource:@"abc" ofType:"sqlite"]; if(sqlite3_open([path UTF8String], &database) != SQLITE_OK) ... It's ok that this db can be opened and data can be retrieved from it. BUT, someone told me that it's better to copy this db file into user folder: such as 'Document'. So, my question is: is it ok to use this db from main bundle directly or copy it to user folder then use that copy. Which is better? Thank you very much!

    Read the article

  • APE engine Mysql push data to channel on insert

    - by Fotis
    Hello, i am working with APE Engine (http://www.ape-project.org) and up until now i had no actual problem. The problem is that i would like to use the MySQL module and push data to a channel each time a row is inserted into a table. I've tried to setup a server side module, i created an SQL query but data is fetched only when the server boots. How can i make this work?

    Read the article

  • pg.so problem with Ruby in Windows

    - by Alexander
    I have installed the pg module with help of gem install pg Which returned Successfully installed pg-0.8.0-x86-mswin32-60 When a .rb-file looks like this require 'rubygems' require 'pg' I get an LoadError (exception 126) which tells me that it can't find the module C:/Ruby/lib/ruby/gems/1.8/gems/pg-0.8.0-x86-mswin32-60/lib/pg.so. I heard something about that it is a Linux compilation. I'm really stuck so I really welcome suggestions. I have also installed PostgreSQL, I use Windows XP.

    Read the article

  • How do I set the user's locale on a JSP

    - by ebynum
    I have a .jsp page that the user loads directly. The request it with a URL like the following: http://www.example.com/myfile.jsp?country=CA&language=fr In the JSP, I pull the URL GET parameters and attempt to set the locale using them as follows: <% String myLanguage = request.getParameter("language"); String myCountry = request.getParameter("country"); Locale myLocale = new Locale(myLanguage, myCountry); pageContext.setAttribute("myLocale", myLocale, PageContext.PAGE_SCOPE); %> <fmt:setLocale value="${myLocale}" scope="page" /> There are several places in the JSP that then display a message pulled from a localized resource bundle using <bean:message bundle="ts" key="..." /> from Struts. On the first request for this page (after changing the language in the URL), it is returned in US English (the default Locale), and then subsequent refreshes will return the properly localized content.

    Read the article

  • selecting the first of multiple classes

    - by gleddy
    Not sure if you can do this, but I want to select the first of two classes of an element with jQuery and return it's first class only. <div class="module blue"> I want to return 'module'. tried this: var state = $('body').attr('class').first(); but none of that seems to work, thanks for any advice.

    Read the article

  • Showing value of UISlider inside App Prefs?

    - by Garrett H
    I have a settings bundle, working perfectly, that I would like to customize a bit. I have, among other things, a PSSliderSpecifier and a PSTitleValueSpecifier. What I would like to do is change the value of the PSTitleValueSpecifier to show the current value of the slider, preferably updating every time the slider's value changes (Actually, what I'd like even more would be displaying the slider's value on the same row as the slider). I know the settings bundle is rather strict about what you're allowed to do in it, but is there any way of doing this?

    Read the article

  • How to get all usages/references of control in DotNetNuke?

    - by macias
    Sorry for lame question but I am literally starting with DNN. When you are in admin/design mode you can list all modules used, and when you click on module at the end you will see the list of controls used in this module with info about filename of the source. The problem I have is in reverse -- I already know the filename with source, I would like to list all modules which use this control. How to do it?

    Read the article

  • Replacing python docstrings

    - by tomaz
    I have written a epytext to reST markup converter, and now I want to convert all the docstrings in my entire library from epytext to reST format. Is there a smart way to read the all the docstrings in a module and write back the replacements? ps: ast module perhaps?

    Read the article

  • maya2008 win32api 64 bit python

    - by knishua
    how is it possible to run import win32api successfully on a 64bit maya version 2008 following error occurs Error: No module named win32api Traceback (most recent call last): File "", line 1, in ImportError: No module named win32api # I need to get mouse cursor position in python so that i can place window exactly in that position. Is there any other way to get it Brgds, kNish

    Read the article

  • Common utility functions for Perl .t tests

    - by zedoo
    Hi I am getting started with Test::More, already have a few .t test scripts. Now I'd like to define a function that will only be used for the tests, but accross different .t files. Where's the best place to put such a function? Define another .t without any tests and require it where needed? (As a sidenote I use the module structure created by Module::Starter)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • I18n - JSF variable value translation

    - by Yurish
    Hi! I am using Bundle Internationalization in my project. I have initialized bundle via <f:loadBundle basename="ui.all.bundles.AppResources_en" var="msg"/> When i need to translate some text, i am using a key to resourceBundle, to get a value of it, for example: #{msg.someText}. But, now i want to translate text, which key is a value of another variable. For example: I have variable String textToTransl. It`s value is status_booked. In my AppResources is defined, that status_booked means "It is booked!", so, when i am pointing it to #{msg.textToTransl} i need to see "It is booked!" How can i make it work?

    Read the article

  • Getting "uninitialized constant" in Rails app

    - by Robert McCabe
    I'm new to Rails and feeling my way, but this has me stumped. I moved some constants to a separate module ie: module Fns Fclick = "function() { alert(\"You clicked the map.\");}\n" ... end then in my controller added: require "fns" class GeomapController < ApplicationController def index fstring = Fns::Fclick ... end but when I run the server I get: uninitialized constant Fns::Fclick what am I missing?

    Read the article

  • What should be proper location for sqlit3 database file?

    - by Elliot Chen
    Hi, Everyone: I'm using a sqlite3 database to store app's data. Instead of building a database within program, I introduced an existing db file: 'abc.sqlite' into my project and put it under my 'Resources' folder. So, I think this db file should be inside of 'bundle', so at my init function, I used following statement to read it out: NSString *path = [[NSBundle mainBundle] pathForResource:@"abc" ofType:"sqlite"]; if(sqlite3_open([path UTF8String], &database) != SQLITE_OK) ... It's ok that this db can be opened and data can be retrieved from it. BUT, someone told me that it's better to copy this db file into user folder: such as 'Document'. So, my question is: is it ok to use this db from main bundle directly or copy it to user folder then use that copy. Which is better? Thank you very much!

    Read the article

  • Good way to "wrap" jars for OSGi with Maven

    - by javamonkey79
    I was looking at the PAX tools on OPS4J for example: this one and I thought I'd found a nice way to: Specify an artifact Create an assembled jar (jar that contains all dependencies) from that jar and it's transitive dependencies Wrap it with BND to create an OSGi bundle It turns out, that I was wrong - it doesn't appear that the PAX stuff does this. (RTFM, right? :) ) But this got me wondering: is there something out there that does what I'm asking? I've thought maybe I could do this by creating a simple POM and using the maven-bundle-plugin but this seems like it might be a bit cumbersome for what I'm asking. NOTE: I get that embedding and assembling jar's is not really "the OSGi way" - so I wouldn't do this unless I really felt it useful. For example - Spring. Thanks in advance.

    Read the article

  • My iPhone App don't works in iOS 4. Why?

    - by noflipes
    Hi everybody. I make a iPhone App that display some videos, I made it with Xcode 3.2.2 with iPhone SDK 3.1.3 and works fine. But a few days ago I downloaded the last version of the iPhone SDK for iOS 4, the proyect Build ok, no erros, no warnings, but when I run the aplication the video didnt work, the image didn't load but sound works. I don't understand it. Here is the code that I used. NSBundle *Bundle = [NSBundle mainBundle]; NSString *moviePath = [Bundle pathForResource:@"Prueba" ofType:@"mp4"]; NSURL *movieURL = [[NSURL fileURLWithPath:moviePath] retain]; MPMoviePlayerController *theMovie = [[MPMoviePlayerController alloc] initWithContentURL:movieURL]; theMovie.scalingMode = MPMovieScalingModeFill; [theMovie play]; Some idea? Best regards

    Read the article

  • Is it possible to add IPTC data to a JPG using python when no such data already exists?

    - by ventolin
    With the IPTCInfo module under Python (http://snippets.dzone.com/posts/show/768 for more info) it's possible to read, modify and write IPTC info to pictures. However, if a JPG doesn't already have IPTC information, the module simply raises an exception. It doesn't seem to be able to create and add this metadata information itself. What alternatives are there? I've googled for the past hour but to no avail whatsoever.

    Read the article

  • how can i update view when fragment change?

    - by user1524393
    i have a activity that have 2 sherlockfragment in this The first two pages display fragments with custom list views which are built from xml from server using AsyncTask. However, when the app runs, only one list view is displayed, the other page is just blank public class VpiAbsTestActivity extends SherlockFragmentActivity { private static final String[] CONTENT = new String[] { "1","2"}; TestFragmentAdapter mAdapter; ViewPager mPager; PageIndicator mIndicator; protected void onCreate(Bundle savedInstanceState) { setRequestedOrientation(ActivityInfo.SCREEN_ORIENTATION_PORTRAIT); super.onCreate(savedInstanceState); setContentView(R.layout.simple_tabs); mAdapter = new TestFragmentAdapter(getSupportFragmentManager()); mPager = (ViewPager)findViewById(R.id.pager); mPager.setAdapter(mAdapter); mIndicator = (TabPageIndicator)findViewById(R.id.indicator); mIndicator.setViewPager(mPager); mIndicator.notifyDataSetChanged(); } class TestFragmentAdapter extends FragmentPagerAdapter { private int mCount = CONTENT.length; public TestFragmentAdapter(FragmentManager fm) { super(fm); } @Override public Fragment getItem(int position) { switch(position) { case 0: return new customlist(); case 1: return new customlistnotuser(); default: return null; } } @Override public int getCount() { return mCount; } public CharSequence getPageTitle(int position) { return VpiAbsTestActivity.CONTENT[position % VpiAbsTestActivity.CONTENT.length].toUpperCase(); } @Override public void destroyItem(View collection, int position, Object view) { ((ViewPager) collection).removeView((View) view); } } } what can i update viewpager when change pages ? the customlistnotuser page likes customlist page but not show public class customlistnotuser extends SherlockFragment { // All static variables static final String URL = "url"; // XML node keys static final String KEY_TEST = "test"; // parent node static final String KEY_ID = "id"; static final String KEY_TITLE = "title"; static final String KEY_Description = "description"; static final String KEY_DURATION = "duration"; static final String KEY_THUMB_URL = "thumb_url"; static final String KEY_PRICE = "price"; static final String KEY_URL = "url"; private ProgressDialog pDialog; ListView list; LazyAdapterbeth adapter; XMLParser parser = new XMLParser(); public void onActivityCreated(Bundle savedInstanceState) { super.onActivityCreated(savedInstanceState); } public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); new getFeed().execute(); } public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { View thisfragment = inflater.inflate(R.layout.dovomi, container, false); return thisfragment; } private class getFeed extends AsyncTask<Void, Void, Document> { } protected Document doInBackground(Void... params) { XMLParser parser = new XMLParser(); String xml = parser.getXmlFromUrl(URL); // getting XML from URL Document doc = parser.getDomElement(xml); // getting DOM element return doc; } protected void onPostExecute(Document doc) { ArrayList<HashMap<String, String>> songsList = new ArrayList<HashMap<String, String>>(); NodeList nl = doc.getElementsByTagName(KEY_TEST); // looping through all song nodes <song> for (int i = 0; i < nl.getLength(); i++) { // creating new HashMap HashMap<String, String> map = new HashMap<String, String>(); Element e = (Element) nl.item(i); // adding each child node to HashMap key => value map.put(KEY_ID, parser.getValue(e, KEY_ID)); map.put(KEY_TITLE, parser.getValue(e, KEY_TITLE)); map.put(KEY_Description, parser.getValue(e, KEY_Description)); map.put(KEY_DURATION, parser.getValue(e, KEY_DURATION)); map.put(KEY_THUMB_URL, parser.getValue(e, KEY_THUMB_URL)); map.put(KEY_PRICE, parser.getValue(e, KEY_PRICE)); map.put(KEY_URL, parser.getValue(e, KEY_URL)); // adding HashList to ArrayList songsList.add(map); pDialog.dismiss(); } list=(ListView)getActivity().findViewById(R.id.list); // Getting adapter by passing xml data ArrayList adapter=new LazyAdapterbeth(getActivity(), songsList); list.setAdapter(adapter); // Click event for single list row list.setOnItemClickListener(new OnItemClickListener() {

    Read the article

  • Isuue when uploading new version to app store

    - by user2978997
    Can I use new certificate and provisioning profile to upload new version? We have discovered one or more issues with your recent delivery for "EMTV News". To process your delivery, the following issues must be corrected: Invalid Provisioning Profile - The provisioning profile included in the bundle com.pointabout.C1E322F0 (Payload/EMTV.app) is invalid. (Missing code-signing certificate.) For more information, visit the iOS Developer Portal. Once these issues have been corrected, go to the Version Details page and click "Ready to Upload Binary." Continue through the submission process until the app status is "Waiting for Upload." You can then deliver the corrected binary. Regards, The App Store team Note: I am using new Certificate and provisioning profile but same bundle ID which is being used in old version of the app.

    Read the article

  • JSF tags not being rendered as HTML

    - by Toto
    I'm following the Java EE firstcup tutorial using Netbeans and Glassfish. When I execute the JSF web tier I've been instructed to code, the browser gets the same JSF markup coded in the .xhtml file, and the tags are not rendered as HTML tags. I know this by using the view source code in my browser. For example, for this code: <html xmlns="http://www.w3.org/1999/xhtml" xmlns:f="http://java.sun.com/jsf/core" xmlns:h="http://java.sun.com/jsf/html"> <h:head> <title>Page title here</title> </h:head> <h:body> <h2> <h:outputText value="#{bundle.WelcomeMessage}" /> </h2> </h:body> </html> The browser should get something like: <html ...> <head> <title>Page title here</title> </head> <body> <h2> the welcome message goes here </h2> </body> </html> Right? Well, my browser is getting jsf code (the first piece of code above) and not the html code (the second piece of code above). It seems to be a configuration problem in netbeans or glassfish but don't know what. Any ideas? This is my web.xml file: <?xml version="1.0" encoding="UTF-8"?> <web-app version="3.0" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_3_0.xsd"> <context-param> <param-name>javax.faces.PROJECT_STAGE</param-name> <param-value>Development</param-value> </context-param> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>/firstcup/*</url-pattern> </servlet-mapping> <session-config> <session-timeout> 30 </session-timeout> </session-config> <welcome-file-list> <welcome-file>greetings.xhtml</welcome-file> </welcome-file-list> </web-app> This is my faces-config.xml file: <?xml version='1.0' encoding='UTF-8'?> <!-- =========== FULL CONFIGURATION FILE ================================== --> <faces-config version="2.0" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-facesconfig_2_0.xsd"> <application> <resource-bundle> <base-name>firstcup.web.WebMessages</base-name> <var>bundle</var> </resource-bundle> <locale-config> <default-locale>en</default-locale> <supported-locale>es</supported-locale> </locale-config> </application> <navigation-rule> <from-view-id>/greetings.xhtml</from-view-id> <navigation-case> <from-outcome>success</from-outcome> <to-view-id>/response.xhtml</to-view-id> </navigation-case> </navigation-rule> </faces-config> Moreover: The url I'm entering in the browser is http://localhost:8081/firstcup/ but I've also tried: http://localhost:8081/firstcup/greetings.xhtml I've checked Glassfish logs and there's no information about not being able to load FacesServlet

    Read the article

< Previous Page | 109 110 111 112 113 114 115 116 117 118 119 120  | Next Page >