Search Results

Search found 15535 results on 622 pages for 'index buffer'.

Page 114/622 | < Previous Page | 110 111 112 113 114 115 116 117 118 119 120 121  | Next Page >

  • Writing file from HttpWebRequest periodically vs. after download finishes?

    - by WB3000
    Right now I am using this code to download files (with a Range header). Most of the files are large, and it is running 99% of CPU currently as the file downloads. Is there any way that the file can be written periodically so that it does not remain in RAM constantly? private byte[] GetWebPageContent(string url, long start, long finish) { byte[] result = new byte[finish]; HttpWebRequest request; request = WebRequest.Create(url) as HttpWebRequest; //request.Headers.Add("Range", "bytes=" + start + "-" + finish); request.AddRange((int)start, (int)finish); using (WebResponse response = request.GetResponse()) { return ReadFully(response.GetResponseStream()); } } public static byte[] ReadFully(Stream stream) { byte[] buffer = new byte[32768]; using (MemoryStream ms = new MemoryStream()) { while (true) { int read = stream.Read(buffer, 0, buffer.Length); if (read <= 0) return ms.ToArray(); ms.Write(buffer, 0, read); } } }

    Read the article

  • Retrieving dll version info via Win32 - VerQueryValue(...) crashes under Win7 x64

    - by user256890
    The respected open source .NET wrapper implementation (SharpBITS) of Windows BITS services fails identifying the underlying BITS version under Win7 x64. Here is the source code that fails. NativeMethods are native Win32 calls wrapped by .NET methods and decorated via DllImport attribute. private static BitsVersion GetBitsVersion() { try { string fileName = Path.Combine( System.Environment.SystemDirectory, "qmgr.dll"); int handle = 0; int size = NativeMethods.GetFileVersionInfoSize(fileName, out handle); if (size == 0) return BitsVersion.Bits0_0; byte[] buffer = new byte[size]; if (!NativeMethods.GetFileVersionInfo(fileName, handle, size, buffer)) { return BitsVersion.Bits0_0; } IntPtr subBlock = IntPtr.Zero; uint len = 0; if (!NativeMethods.VerQueryValue(buffer, @"\VarFileInfo\Translation", out subBlock, out len)) { return BitsVersion.Bits0_0; } int block1 = Marshal.ReadInt16(subBlock); int block2 = Marshal.ReadInt16((IntPtr)((int)subBlock + 2 )); string spv = string.Format( @"\StringFileInfo\{0:X4}{1:X4}\ProductVersion", block1, block2); string versionInfo; if (!NativeMethods.VerQueryValue(buffer, spv, out versionInfo, out len)) { return BitsVersion.Bits0_0; } ... The implementation follows the MSDN instructions by the letter. Still during the second VerQueryValue(...) call, the application crashes and kills the debug session without hesitation. Just a little more debug info right before the crash: spv = "\StringFileInfo\040904B0\ProductVersion" buffer = byte[1900] - full with binary data block1 = 1033 block2 = 1200 I looked at the targeted "C:\Windows\System32\qmgr.dll" file (The implementation of BITS) via Windows. It says that the Product Version is 7.5.7600.16385. Instead of crashing, this value should return in the verionInfo string. Any advice?

    Read the article

  • WordPress 3.5 Multisite and nginx siteurl issues

    - by Florin Gogianu
    I'm setting up multisite on localhost in subdirectories. The problem is that when I'm trying to access the dashboard of a site I just created ( localhost/wptest/site/wp-admin ) I get "This webpage has a redirect loop" and when I try to access the actual website ( localhost/wptest/site ) the page loads but without assets, such as css. When I access the network dashboard, or the primary site dashboard on localhost/wptest everything is just fine. Also when I edit the permalink of the second site in the network dashboard, to be like this: localhost/site it also runs fine. How to make it work with the default permalink structure localhost/wptest/site? The wordpress files are in /usr/share/html/wptest The wp-config.php is as follows: define('WP_ALLOW_MULTISITE', true); define('MULTISITE', true); define('SUBDOMAIN_INSTALL', false); define('DOMAIN_CURRENT_SITE', 'localhost'); define('PATH_CURRENT_SITE', '/wptest/'); define('SITE_ID_CURRENT_SITE', 1); define('BLOG_ID_CURRENT_SITE', 1); And the server block / virtual host is like this: server { ##DM - uncomment following line for domain mapping listen 80 default_server; #server_name example.com *.example.com ; ##DM - uncomment following line for domain mapping #server_name_in_redirect off; access_log /var/log/nginx/example.com.access.log; error_log /var/log/nginx/example.com.error.log; root /usr/share/nginx/html/wptest; index index.html index.htm index.php; if (!-e $request_filename) { rewrite /wp-admin$ $scheme://$host$uri/ permanent; rewrite ^(/[^/]+)?(/wp-.*) $2 last; rewrite ^(/[^/]+)?(/.*\.php) $2 last; } location / { try_files $uri $uri/ /index.php?$args ; } location ~ \.php$ { try_files $uri /index.php; include fastcgi_params; fastcgi_pass unix:/var/run/php5-fpm.sock; } location ~* ^.+\.(ogg|ogv|svg|svgz|eot|otf|woff|mp4|ttf|rss|atom|jpg|jpeg|gif|png|ico|zip|tgz|gz|rar|bz2|doc|xls|exe|ppt|tar|mid|midi|wav|bmp|rtf)$ { access_log off; log_not_found off; expires max; } location = /robots.txt { access_log off; log_not_found off; } location ~ /\. { deny all; access_log off; log_not_found off; } } And finally here's an error log: 2013/06/29 08:05:37 [error] 4056#0: *52 rewrite or internal redirection cycle while internally redirecting to "/index.php", client: 127.0.0.1, server: example.com, request: "GET /nginx HTTP/1.1", host: "localhost"

    Read the article

  • Reading a child process's /proc/pid/mem file from the parent

    - by Amittai Aviram
    In the program below, I am trying to cause the following to happen: Process A assigns a value to a stack variable a. Process A (parent) creates process B (child) with PID child_pid. Process B calls function func1, passing a pointer to a. Process B changes the value of variable a through the pointer. Process B opens its /proc/self/mem file, seeks to the page containing a, and prints the new value of a. Process A (at the same time) opens /proc/child_pid/mem, seeks to the right page, and prints the new value of a. The problem is that, in step 6, the parent only sees the old value of a in /proc/child_pid/mem, while the child can indeed see the new value in its /proc/self/mem. Why is this the case? Is there any way that I can get the parent to to see the child's changes to its address space through the /proc filesystem? #include <fcntl.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #include <sys/types.h> #include <sys/stat.h> #include <sys/wait.h> #include <unistd.h> #define PAGE_SIZE 0x1000 #define LOG_PAGE_SIZE 0xc #define PAGE_ROUND_DOWN(v) ((v) & (~(PAGE_SIZE - 1))) #define PAGE_ROUND_UP(v) (((v) + PAGE_SIZE - 1) & (~(PAGE_SIZE - 1))) #define OFFSET_IN_PAGE(v) ((v) & (PAGE_SIZE - 1)) # if defined ARCH && ARCH == 32 #define BP "ebp" #define SP "esp" #else #define BP "rbp" #define SP "rsp" #endif typedef struct arg_t { int a; } arg_t; void func1(void * data) { arg_t * arg_ptr = (arg_t *)data; printf("func1: old value: %d\n", arg_ptr->a); arg_ptr->a = 53; printf("func1: address: %p\n", &arg_ptr->a); printf("func1: new value: %d\n", arg_ptr->a); } void expore_proc_mem(void (*fn)(void *), void * data) { off_t frame_pointer, stack_start; char buffer[PAGE_SIZE]; const char * path = "/proc/self/mem"; int child_pid, status; int parent_to_child[2]; int child_to_parent[2]; arg_t * arg_ptr; off_t child_offset; asm volatile ("mov %%"BP", %0" : "=m" (frame_pointer)); stack_start = PAGE_ROUND_DOWN(frame_pointer); printf("Stack_start: %lx\n", (unsigned long)stack_start); arg_ptr = (arg_t *)data; child_offset = OFFSET_IN_PAGE((off_t)&arg_ptr->a); printf("Address of arg_ptr->a: %p\n", &arg_ptr->a); pipe(parent_to_child); pipe(child_to_parent); bool msg; int child_mem_fd; char child_path[0x20]; child_pid = fork(); if (child_pid == -1) { perror("fork"); exit(EXIT_FAILURE); } if (!child_pid) { close(child_to_parent[0]); close(parent_to_child[1]); printf("CHILD (pid %d, parent pid %d).\n", getpid(), getppid()); fn(data); msg = true; write(child_to_parent[1], &msg, 1); child_mem_fd = open("/proc/self/mem", O_RDONLY); if (child_mem_fd == -1) { perror("open (child)"); exit(EXIT_FAILURE); } printf("CHILD: child_mem_fd: %d\n", child_mem_fd); if (lseek(child_mem_fd, stack_start, SEEK_SET) == (off_t)-1) { perror("lseek"); exit(EXIT_FAILURE); } if (read(child_mem_fd, buffer, sizeof(buffer)) != sizeof(buffer)) { perror("read"); exit(EXIT_FAILURE); } printf("CHILD: new value %d\n", *(int *)(buffer + child_offset)); read(parent_to_child[0], &msg, 1); exit(EXIT_SUCCESS); } else { printf("PARENT (pid %d, child pid %d)\n", getpid(), child_pid); printf("PARENT: child_offset: %lx\n", child_offset); read(child_to_parent[0], &msg, 1); printf("PARENT: message from child: %d\n", msg); snprintf(child_path, 0x20, "/proc/%d/mem", child_pid); printf("PARENT: child_path: %s\n", child_path); child_mem_fd = open(path, O_RDONLY); if (child_mem_fd == -1) { perror("open (child)"); exit(EXIT_FAILURE); } printf("PARENT: child_mem_fd: %d\n", child_mem_fd); if (lseek(child_mem_fd, stack_start, SEEK_SET) == (off_t)-1) { perror("lseek"); exit(EXIT_FAILURE); } if (read(child_mem_fd, buffer, sizeof(buffer)) != sizeof(buffer)) { perror("read"); exit(EXIT_FAILURE); } printf("PARENT: new value %d\n", *(int *)(buffer + child_offset)); close(child_mem_fd); printf("ENDING CHILD PROCESS.\n"); write(parent_to_child[1], &msg, 1); if (waitpid(child_pid, &status, 0) == -1) { perror("waitpid"); exit(EXIT_FAILURE); } } } int main(void) { arg_t arg; arg.a = 42; printf("In main: address of arg.a: %p\n", &arg.a); explore_proc_mem(&func1, &arg.a); return EXIT_SUCCESS; } This program produces the output below. Notice that the value of a (boldfaced) differs between parent's and child's reading of the /proc/child_pid/mem file. In main: address of arg.a: 0x7ffffe1964f0 Stack_start: 7ffffe196000 Address of arg_ptr-a: 0x7ffffe1964f0 PARENT (pid 20376, child pid 20377) PARENT: child_offset: 4f0 CHILD (pid 20377, parent pid 20376). func1: old value: 42 func1: address: 0x7ffffe1964f0 func1: new value: 53 PARENT: message from child: 1 CHILD: child_mem_fd: 4 PARENT: child_path: /proc/20377/mem CHILD: new value 53 PARENT: child_mem_fd: 7 PARENT: new value 42 ENDING CHILD PROCESS.

    Read the article

  • Mixing c++ standard strings and windows API

    - by JB
    Many windows APIs take a pointer to a buffer and a size element but the result needs to go into a c++ string. (I'm using windows unicode here so they are wstrings) Here is an example :- #include <iostream> #include <string> #include <vector> #include <windows.h> using namespace std; // This is the method I'm interested in improving ... wstring getComputerName() { vector<wchar_t> buffer; buffer.resize(MAX_COMPUTERNAME_LENGTH+1); DWORD size = MAX_COMPUTERNAME_LENGTH; GetComputerNameW(&buffer[0], &size); return wstring(&buffer[0], size); } int main() { wcout << getComputerName() << "\n"; } My question really is, is this the best way to write the getComputerName function so that it fits into C++ better, or is there a better way? I don't see any way to use a string directly without going via a vector unless I missed something? It works fine, but somehow seems a little ugly. The question isn't about that particular API, it's just a convenient example.

    Read the article

  • how to make grid column as drop down list for all rows using jquery

    - by kumar
    Hello friends.. colNames: ['A','B','C','D'], colModel: [ { name: 'A', index: 'A', width: 90 }, { name: 'B', index: 'B', width: 100 }, { name: 'C', index: 'C', width: 70 }, { name: 'D', index: 'D', edittype: 'select', width: 100, editoptions: { value: { 1: 'Yes', 2: 'No'}} } ], My concersn here is.. I am displying A B C D values from db2... for Last Column D I need to put defalut drop down list for all the rows. Thanks can any body help me out.. thanks

    Read the article

  • Typed Arrays in Gecko 2: Float32Array concatenation and expansion.

    - by janesconference
    Hi all, I'm a bit confused with Javascript Typed Arrays. What I have several *Float32Array*s, that have no concat method. I'd like to concatenate them all inside another Float32Array, but: as I said before, there is no concatenation method if I try to write past the array length, the array is not expanded (aka this won't work - please note that event.frameBuffer and buffer are both Float32Array and that I don't know what the final length of my buffer will be): var length_now = buffer.length; for (var i = 0; i < event.frameBuffer.length; i += 1) { buffer [length_now + i] = event.frameBuffer[i]; } The only solution I found is to copy the Float32Array in a regular array, that's definitely not what I want. How would you do, stackoverflowers?

    Read the article

  • Remove all dots except the first one from a string

    - by Šime Vidas
    Given a string '1.2.3.4.5' I would like to get this output '1.2345' I wrote this function process( input ) { var index = input.indexOf( '.' ); if ( index ) { input = input.substr( 0, index + 1 ) + input.slice( index ).replace( /\./g, '' ); } return input; } Live demo: http://jsfiddle.net/EDTNK/ It works but I was hoping for a slightly more elegant solution...

    Read the article

  • PHP Detect if any URL variables have been set

    - by zuk1
    Hey guys, it's kind of hard to explain but basically I want to detect if any variables have been set through the URL. So with my IF statement all of the following should return true: http://domain.com/index.php?m=100 http://domain.com/index.php?q=harhar http://domain.com/index.php?variable=poo&crazy=yes and all the following return false: http://domain.com/index.php http://domain.com/test.php http://domain.com/no_variables.php Any ideas?

    Read the article

  • impress.js Navigation with active class

    - by ArtGoddess
    I would like to use impress.js in order to make a website, with a navigation bar. In each slide, the corresponding anchor or div must have an "active" class, in order to achieve a different link appearance. I have followed all instructions provided here: https://github.com/Ralt/impress.js/commit/f88feb8cae704ce27bd2168bdb77768f516ac2da#L2R605 but the "active" class on the correct menu must be added. This is the code that generates the menu items. How can I add for example the "active" class in the first link? /* ************************ MENU ***************************** */ // Capitalize first letter of string // @see http://stackoverflow.com/a/1026087/851498 var capitalize = function( str ) { return str.charAt(0).toUpperCase() + str.slice(1); } // `showMenu` API function creates the menu // It defines the names of each entry by the id capitalized. var showMenu = function() { // Create the menu wrapper and the element that will be cloned // for each entry. var menu = document.createElement('div'), el = document.createElement('div'); // Apply some classes menu.className = 'menu'; el.className = 'menu-item'; // Create an element that will be the "button" and append it // to the menu var button = document.createElement('div'); button.className = 'menu-button'; button.textContent = 'Menu'; menu.appendChild(button); // Now, for each div in #impress, add an entry to the menu [].forEach.call(byId('impress').firstElementChild.children, function( child, index ) { var newEl = el.cloneNode(), i = index + 1, text = i + '. ' + capitalize(child.id); // Set the text of the new element newEl.textContent = text; // Add an onclick event to the new element // We need to use a closure to make sure the index is correct (function( index ) { newEl.addEventListener('click', function() { goto(index); }); }( index )); // And append the new element to the menu menu.appendChild(newEl); }); // And append the menu to #impress document.body.appendChild(menu); }; Then, in each click it must be removed the active class on the current, and add it to the clicked element. // Remove the active class from the current active document.querySelector( '.active' )[ 0 ].classList.remove( 'active' ); // And add it to the clicked index byId('impress').firstElementChild.children[ index ].classList.add( 'active' ); Where do I have to apply this code? Thank you!

    Read the article

  • Interoperability between two AES algorithms

    - by lpfavreau
    Hello, I'm new to cryptography and I'm building some test applications to try and understand the basics of it. I'm not trying to build the algorithms from scratch but I'm trying to make two different AES-256 implementation talk to each other. I've got a database that was populated with this Javascript implementation stored in Base64. Now, I'm trying to get an Objective-C method to decrypt its content but I'm a little lost as to where the differences in the implementations are. I'm able to encrypt/decrypt in Javascript and I'm able to encrypt/decrypt in Cocoa but cannot make a string encrypted in Javascript decrypted in Cocoa or vice-versa. I'm guessing it's related to the initialization vector, nonce, counter mode of operation or all of these, which quite frankly, doesn't speak to me at the moment. Here's what I'm using in Objective-C, adapted mainly from this and this: @implementation NSString (Crypto) - (NSString *)encryptAES256:(NSString *)key { NSData *input = [self dataUsingEncoding: NSUTF8StringEncoding]; NSData *output = [NSString cryptoAES256:input key:key doEncrypt:TRUE]; return [Base64 encode:output]; } - (NSString *)decryptAES256:(NSString *)key { NSData *input = [Base64 decode:self]; NSData *output = [NSString cryptoAES256:input key:key doEncrypt:FALSE]; return [[[NSString alloc] initWithData:output encoding:NSUTF8StringEncoding] autorelease]; } + (NSData *)cryptoAES256:(NSData *)input key:(NSString *)key doEncrypt:(BOOL)doEncrypt { // 'key' should be 32 bytes for AES256, will be null-padded otherwise char keyPtr[kCCKeySizeAES256 + 1]; // room for terminator (unused) bzero(keyPtr, sizeof(keyPtr)); // fill with zeroes (for padding) // fetch key data [key getCString:keyPtr maxLength:sizeof(keyPtr) encoding:NSUTF8StringEncoding]; NSUInteger dataLength = [input length]; // See the doc: For block ciphers, the output size will always be less than or // equal to the input size plus the size of one block. // That's why we need to add the size of one block here size_t bufferSize = dataLength + kCCBlockSizeAES128; void* buffer = malloc(bufferSize); size_t numBytesCrypted = 0; CCCryptorStatus cryptStatus = CCCrypt(doEncrypt ? kCCEncrypt : kCCDecrypt, kCCAlgorithmAES128, kCCOptionECBMode | kCCOptionPKCS7Padding, keyPtr, kCCKeySizeAES256, nil, // initialization vector (optional) [input bytes], dataLength, // input buffer, bufferSize, // output &numBytesCrypted ); if (cryptStatus == kCCSuccess) { // the returned NSData takes ownership of the buffer and will free it on deallocation return [NSData dataWithBytesNoCopy:buffer length:numBytesCrypted]; } free(buffer); // free the buffer; return nil; } @end Of course, the input is Base64 decoded beforehand. I see that each encryption with the same key and same content in Javascript gives a different encrypted string, which is not the case with the Objective-C implementation that always give the same encrypted string. I've read the answers of this post and it makes me believe I'm right about something along the lines of vector initialization but I'd need your help to pinpoint what's going on exactly. Thank you!

    Read the article

  • ASP.NET Repeater and DataBinder.Eval

    - by Fernando
    I've got a <asp:Repeater> in my webpage, which is bound to a programatically created dataset. The purpose of this repeater is to create an index from A-Z, which, when clicked, refreshes the information on the page. The repeater has a link button like so: <asp:LinkButton ID="indexLetter" Text='<%#DataBinder.Eval(Container.DataItem,"letter")%>' runat="server" CssClass='<%#DataBinder.Eval(Container.DataItem, "cssclass")%>' Enabled='<%#DataBinder.Eval(Container.DataItem,"enabled")%>'></asp:LinkButton> The dataset is created the following way: protected DataSet getIndex(String index) { DataSet ds = new DataSet(); ds.Tables.Add("index"); ds.Tables["index"].Columns.Add("letter"); ds.Tables["index"].Columns.Add("cssclass"); ds.Tables["index"].Columns.Add("enabled"); char alphaStart = Char.Parse("A"); char alphaEnd = Char.Parse("Z"); for (char i = alphaStart; i <= alphaEnd; i++) { String cssclass="", enabled="true"; if (index == i.ToString()) { cssclass = "selected"; enabled = "false"; } ds.Tables["index"].Rows.Add(new Object[3] {i.ToString(),cssclass,enabled }); } return ds; } However, when I run the page, a "Specified cast is not valid exception" is thrown in Text='<%#DataBinder.Eval(Container.DataItem,"letter")'. I have no idea why, I have tried manually casting to String with (String), I've tried a ToString() method, I've tried everything. Also, if in the debugger I add a watch for DataBinder.Eval(Container.DataItem,"letter"), the value it returns is "A", which according to me, should be fine for the Text Property. EDIT: Here is the exception: System.InvalidCastException was unhandled by user code Message="Specified cast is not valid." Source="App_Web_cmu9mtyc" StackTrace: at ASP.savecondition_aspx._DataBinding_control7(Object sender, EventArgs e) in e:\Documents and Settings\Fernando\My Documents\Visual Studio 2008\Projects\mediTrack\mediTrack\saveCondition.aspx:line 45 at System.Web.UI.Control.OnDataBinding(EventArgs e) at System.Web.UI.Control.DataBind(Boolean raiseOnDataBinding) at System.Web.UI.Control.DataBind() at System.Web.UI.Control.DataBindChildren() InnerException: Any advice will be greatly appreciated, thank you EDIT 2: Fixed! The problem was not in the Text or CSS tags, but in the Enabled tag, I had to cast it to a Boolean value. The problem was that the exception was signaled at the Text tag, I don't know why

    Read the article

  • Something like System.Diagnostics.Process.Start to run a stream

    - by phenevo
    Hi, I get from server images and videos by stream. Now I'm saving it: Stream str = client.GetFile(path); using (var outStream = new FileStream(@"c:\myFile.jpg", FileMode.Create)) { var buffer = new byte[4096]; int count; while ((count = str.Read(buffer, 0, buffer.Length)) > 0) { outStream.Write(buffer, 0, count); } } I can be jpg, mpg, flv and a lot of other multimedia types (Before I get stream I know what is a extension of this file). Now I want to not save it , bu run direct from stream. Is it possible ??

    Read the article

  • Android - Read PNG image without alpha and decode as ARGB_8888

    - by loki666
    I try to read an image from sdcard (in emulator) and then create a Bitmap image with the BitmapFactory.decodeByteArray method. I set the options: options.inPrefferedConfig = Bitmap.Config.ARGB_8888 options.inDither = false Then I extract the pixels into a ByteBuffer. ByteBuffer buffer = ByteBuffer.allocateDirect(width*height*4) bitmap.copyPixelsToBuffer(buffer) I use this ByteBuffer then in the JNI to convert it into RGB format and want to calculate on it. But always I get false data - I test without modifying the ByteBuffer. Only thing I do is to put it into the native method into JNI. Then cast it into a unsigned char* and convert it back into a ByteBuffer before returning it back to Java. unsigned char* buffer = (unsinged char*)(env->GetDirectBufferAddress(byteBuffer)) jobject returnByteBuffer = env->NewDirectByteBuffer(buffer, length) Before displaying the image I get data back with bitmap.copyPixelsFromBuffer( buffer ) But then it has wrong data in it. My Question is if this is because the image is internally converted into RGB 565 or what is wrong here? ..... Have an answer for it: - yes, it is converted internally to RGB565. Does anybody know how to create such an bitmap image from PNG with ARGB8888 pixel format? If anybody has an idea, it would be great!

    Read the article

  • Large File Download - Connection With Server Reset

    - by daveywc
    I have an asp.net website that allows the user to download largish files - 30mb to about 60mb. Sometimes the download works fine but often it fails at some varying point before the download finishes with the message saying that the connection with the server was reset. Originally I was simply using Server.TransmitFile but after reading up a bit I am now using the code posted below. I am also setting the Server.ScriptTimeout value to 3600 in the Page_Init event. private void DownloadFile(string fname, bool forceDownload) { string path = MapPath(fname); string name = Path.GetFileName(path); string ext = Path.GetExtension(path); string type = ""; // set known types based on file extension if (ext != null) { switch (ext.ToLower()) { case ".mp3": type = "audio/mpeg"; break; case ".htm": case ".html": type = "text/HTML"; break; case ".txt": type = "text/plain"; break; case ".doc": case ".rtf": type = "Application/msword"; break; } } if (forceDownload) { Response.AppendHeader("content-disposition", "attachment; filename=" + name.Replace(" ", "_")); } if (type != "") { Response.ContentType = type; } else { Response.ContentType = "application/x-msdownload"; } System.IO.Stream iStream = null; // Buffer to read 10K bytes in chunk: byte[] buffer = new Byte[10000]; // Length of the file: int length; // Total bytes to read: long dataToRead; try { // Open the file. iStream = new System.IO.FileStream(path, System.IO.FileMode.Open, System.IO.FileAccess.Read, System.IO.FileShare.Read); // Total bytes to read: dataToRead = iStream.Length; //Response.ContentType = "application/octet-stream"; //Response.AddHeader("Content-Disposition", "attachment; filename=" + filename); // Read the bytes. while (dataToRead > 0) { // Verify that the client is connected. if (Response.IsClientConnected) { // Read the data in buffer. length = iStream.Read(buffer, 0, 10000); // Write the data to the current output stream. Response.OutputStream.Write(buffer, 0, length); // Flush the data to the HTML output. Response.Flush(); buffer = new Byte[10000]; dataToRead = dataToRead - length; } else { //prevent infinite loop if user disconnects dataToRead = -1; } } } catch (Exception ex) { // Trap the error, if any. Response.Write("Error : " + ex.Message); } finally { if (iStream != null) { //Close the file. iStream.Close(); } Response.Close(); } }

    Read the article

  • copying a short int to a char array

    - by cateof
    I have a short integer variable called s_int that holds value = 2 unsighed short s_int = 2; I want to copy this number to a char array to the first and second position of a char array. Let's say we have char buffer[10];. We want the two bytes of s_int to be copied at buffer[0] and buffer[1]. How can I do it?

    Read the article

  • Generic Dictionary C#

    - by pm_2
    I have a class that inherits from a generic dictionary as follows: Class myClass : System.Collections.Generic.Dictionary<int, Object> I have added a list of values to this in a particular order, but I now wish to change that order. Is there any way (without removing and re-adding) that I could effectively re-index the values; so change the object at index 1 to now be at index 10 for example? For example, this doesn't work: myClass[1].Index = 10;

    Read the article

  • ignore certain buffers using iswitchb

    - by robUK
    Hello, GNU Emacs 23.1 I am using iswitchb. However, when I press c-x b I get a list of buffers. However, I don't want to display one like scratch, Messages, GNU Emacs, etc. Just the buffers I have opened myself. So I am looking for a way to ignore these buffers. This is what I have in my configuration. However, it doesn't ignore the buffers I don't want. Have I done anything wrong? ;; Setup iswitchb to select different buffers, ignore buffers to reduce list (iswitchb-mode 1) (setq iswitchb-buffer-ignore '("*scratch*")) (setq iswitchb-buffer-ignore '("*Messages*")) (setq iswitchb-buffer-ignore '("*GNU Emacs*")) (setq iswitchb-buffer-ignore '("*compilation*")) Many thanks for any suggestions,

    Read the article

  • Is it possible to BitBlt directly on to a GDI+ bitmap?

    - by jnm2
    I am trying to BitBlt from an HBITMAP to a GDI+ bitmap. I tried this, but nothing happens: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); IntPtr hBufferDC = BufferGraphics.GetHdc(); ... BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); EDIT: Apparently the hDC doesn't work if I acquire it and then much later use it with BitBlt. I needed to make sure the hDC was still valid. This is the solution: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); ... IntPtr hBufferDC = BufferGraphics.GetHdc(); BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); BufferGraphics.ReleaseHdc(hBufferDC); Does anyone know why this change is necessary? Why might it not work to use an hDC that was gotten earlier as in the first example?

    Read the article

  • char[] and char* compatibility?

    - by Aerovistae
    In essence, will this code work? And before you say "Run it and see!", I just realized my cygwin didn't come with gcc and it's currently 40 minutes away from completing reinstallation. That being said: char* words[1000]; for(int i = 0; i<1000; i++) words[i] = NULL; char buffer[ 1024 ]; //omit code that places "ADD splash\0" into the buffer if(strncmp (buffer, "ADD ", 4){ char* temp = buffer + 4; printf("Adding: %s", temp); int i = 0; while(words[i] != NULL) i++; words[i] = temp; } I'm mostly uncertain about the line char* temp = buffer + 4, and also whether I can assign words[i] in the manner that I am. Am I going to get type errors when I eventually try to compile this in 40 minutes? Also-- if this works, why don't I need to use malloc() on each element of words[]? Why can I say words[i] = temp, instead of needing to allocate memory for words[i] the length of temp?

    Read the article

  • Faster way to clone.

    - by AngryHacker
    I am trying to optimize a piece of code that clones an object: #region ICloneable public object Clone() { MemoryStream buffer = new MemoryStream(); BinaryFormatter formatter = new BinaryFormatter(); formatter.Serialize(buffer, this); // takes 3.2 seconds buffer.Position = 0; return formatter.Deserialize(buffer); // takes 2.1 seconds } #endregion Pretty standard stuff. The problem is that the object is pretty beefy and it takes 5.4 seconds (according ANTS Profiler - I am sure there is the profiler overhead, but still). Is there a better and faster way to clone?

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • PIX_FMT_YUYV422 8 bits conversion ffmpeg

    - by Sridhar
    Hi, I have a raw YUYV422 buffer with 8-bit 4:2:2 Component Y’CbCr format (Y0, Cb, Y1, Cr order). I know that ffmpeg's PIX_FMT_YUYV422 only handle 16-bit buffers.So I am getting Bad memory error when scaling that buffer into YUV420P. Can any one give me a clue, how can I use this buffer with ffmpeg to covert into YUV420. Thanks, Raghu

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 110 111 112 113 114 115 116 117 118 119 120 121  | Next Page >