Search Results

Search found 3804 results on 153 pages for 'regex'.

Page 116/153 | < Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >

  • Regular Expression Fails

    - by Meander365
    Anyone help? When I run this I get " invalid quantifier ?<=href= " var aHrefMatch = new RegExp("(?<=href\=")[^]+?(?=")"); var matchedLink = mystring.match(aHrefMatch); But I know the regular expression is valid. Any ideas?

    Read the article

  • How can I match everything in a string until the second occurrence of a delimiter with a regular expression?

    - by Steve
    I am trying to refine a preg_match_all by finding the second occurrence of a period then a space: <?php $str = "East Winds 20 knots. Gusts to 25 knots. Waters a moderate chop. Slight chance of showers."; preg_match_all ('/(^)((.|\n)+?)(\.\s{2})/',$str, $matches); $dataarray=$matches[2]; foreach ($dataarray as $value) { echo $value; } ?> But it does not work: the {2} occurrence is incorrect. I have to use preg_match_all because I am scraping dynamic HTML. I want to capture this from the string: East Winds 20 knots. Gusts to 25 knots.

    Read the article

  • Regular Expression repetition of class

    - by codersarepeople
    I am trying to figure out a regular expression for the following: <tr class="A">.*</tr><tr class="(B|C)">.*</tr> Now The second tr class will repeat an unknown number of times, with something unknown in between repetitions, but simply putting it in parentheses and added a plus doesn't work. Here's the PHP code that didn't work: $pattern = '/<tr\ class=\"A\">.*(<tr\ class=\"(B|C)\">.*<\/tr>.*)+/'; preg_match_all($pattern,$playerHtml,$scores); But it only returns the first Here's an example of something that should match: <tr class="A">blah</tr>blah <tr class="B">blah</tr>blah <tr class="B">blah</tr>blah <tr class="C">blah</tr> This only matches blahblahblah

    Read the article

  • not autolinking all-numeric twitter hashtags in perl?

    - by all_numeric_no_hash
    I'm producing HTML from twitter search results. Happily using the Net::Twitter module :-) One of the rules in Twitter is that all-numeric hashtags are not links. This allows to unambiguously tweet things like "ur not my #1 anymore", as in here: http://twitter.com/natarias2007/status/11246320622 The solution I came up with looks like: $tweet =~ s{#([0-9]*[A-Za-z_]+[0-9]*)}{<a href="http://twitter.com/search?q=%23$1">#$1</a>}g; It seems to work (let's hope), but I'm still curious... how would you do it?

    Read the article

  • How to modify complex argument strings in Perl

    - by mmccoo
    I have a cmdline that I'm trying to modify to remove some of the arguments. What makes this complex is that I can have nested arguments. Say that I have this: $cmdline = "-a -xyz -a- -b -xyz -b- -a -xyz -a-" I have three different -xyz flags that are to be interpreted in two different contexts. One is the -a context and the other is the -b context. I want to remove the "a" -xyz's but leave the ones in the "b" -xyz. How can I most effectively do this in Perl?

    Read the article

  • Next line matching the regex in bash

    - by Lin_freak
    I have a file in the format: Port Number IP address Port Number IP address (Not sure how the output will be displayed here but let me tell you they are on separate lines) and so on.... I use the command grep -C 1 'port number' file.txt i.e. I want all IP addresses corresponding to a particular port. Making it simple, I want the next line matching a regular expression. Like if my regular expression matches line 2,4 and 6 then I want lines 3, 5 and 7 to be printed. How to do that?

    Read the article

  • Normalizing Strings using Regexes

    - by RasputinJones
    How do I match this string "1 & 2" from this string "Foo Bar 1 & 2"? How do I match this string "1, 2 & 3" from this string "Foo Baz 1, 2 & 3"? Trying to split out "Foo Bar" from the string using regexes while using the presence of "1 & 2" or "1, 2 & 3" as conditionals to normalize these strings into "Foo Bar 1" and "Foo Bar 2" or "Foo Baz 1", "Foo Baz 2" and "Foo Baz 3" respectively.

    Read the article

  • javascript regular expressions

    - by Zhasulan Berdybekov
    Help me with regular expressions. I need to check the text on the hour and minute. That is the first case, the text can be from 0 to 12. In the second case, the text can be from 1 to 60. this is my code: var hourRegEx = /^([0-9]{2})$/; //You can fix this line of code? $(document).ready( function(){ $('form.form').submit(function(){ if( $('input.hour').val().match(hourRegEx) ){ return true; } return false; }); }); In my case, the code says that, for example 52, too, the correct answer

    Read the article

  • python and regular expression with unicode

    - by bsn
    I need to delete some unicode symbols from the string '?????? ??????? ???????????? ??????????' I know they exist here for sure. I try: re.sub('([\u064B-\u0652\u06D4\u0670\u0674\u06D5-\u06ED]+)', '', '?????? ??????? ???????????? ??????????') but it doesn't work. String stays the same. ant suggestion what i do wrong?

    Read the article

  • parse unformatted string into dictionary with python

    - by user553131
    I have following string. DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) Key: a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO I need to create dictionary so it would be like { "DATE": "12242010", "Key Type": "Nod32 Anti-Vir (30d trial)", "Key": "a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO" } The problem is that string is unformatted DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) there is no space after Date before Key Type also it would be nice to have some validation for Key, eg if there are 5 chars in each box of key and number of boxes I am a beginner in python and moreover in regular expressions. Thanks a lot.

    Read the article

  • dropping characters from regular expression groups

    - by tcurdt
    The goal: I want to convert a number from the format "10.234,56" to "10234.56" Using this simple approach almost gets us there /([\d\.]+),(\d\d)/ => '\1.\2' The problem is that the first group of the match (of course) still contains the '.' character. So questions are: Is it possible to exclude a character from the group somehow? How would you solve this with a single regexp (I know this is a trivial problem when not using a single regexp)

    Read the article

  • Is it possible to exclude some elements from parsing when using regular expression and .replace()?

    - by Fletus Mefitis
    <script language="javascript"> $("div.post-content , .parsedsig").each(function(){ if($(this).html().indexOf("[/tabulaScriptum]") != -1) { pattern = /\[tabulaScriptum=(.*?)\]([^\[]*)\[\/tabulaScriptum\]/gi $(this).html($(this).html().replace(pattern, "<div class='tabulaScriptum'><div class='tabulaNomen'>$1</div><div class='tabulaImpleo'>$2</div></div>")) } }); </script> This script is working perfectly, except for one thing... I need not to replace [tabulaScriptum=][/tabulaScriptum] in certain elements. For example, I don't want to replace those "tags" in element that has class .code-box. Is it possible? Clarification: element .code-box is located within .post-content. Clarification #2: this script creates simple division spoiler. .tabulaScriptum is spoier's body, .tabulaNomen is spoiler's name and button which, in turn, reveals(or hides) .tabulaImpleo on click. Reveal\hide script is located in some other place, and I didn't post it here since it doesn't really matter. Clarification #3: http://jsfiddle.net/PRtsw/1/ fiddle.

    Read the article

  • Regular Expression

    - by Blanca
    Hi! i would like to avoid texts like this one: height="49" with a regular expresion. I tought in .replaceAll("\s*="*"",""); (replaceAll is used as a method in a java class), but eclipse don't allowed me to do that. Any other suggestion?? tx!

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Form validation in JAvascript with Regexp

    - by Nikita Barsukov
    I have a webpage with an input field where only digits are allowed. The input field has an onkeyup event that starts this validating function: function validate() { var uah_amount = document.getElementById("UAH").value; var allowed = /^\d+$/; document.getElementById("error").innerHTML = document.getElementById("UAH").value; if (!allowed.test(uah_amount)) { document.getElementById("error").style.backgroundColor = "red"; } } Everything works as I expect until I hit Backspace button to remove some characters. In this case function always behaves as if I entered letters. How to correct this?

    Read the article

  • Does '[ab]+' equal '(a|b)+' in python re module?

    - by user1477871
    I think pat1 = '[ab]' and pat2 = 'a|b' have the same function in Python(python2.7, windows) 're' module as a regular expression pattern. But I am confused with '[ab]+' and '(a|b)+', do they have the same function, if not plz explain details. ''' Created on 2012-9-4 @author: melo ''' import re pat1 = '(a|b)+' pat2 = '[ab]+' text = '22ababbbaa33aaa44b55bb66abaa77babab88' m1 = re.search(pat1, text) m2 = re.search(pat2, text) print 'search with pat1:', m1.group() print 'search with pat2:', m2.group() m11 = re.split(pat1, text) m22 = re.split(pat2, text) print 'split with pat1:', m11 print 'split with pat2:', m22 m111 = re.findall(pat1, text) m222 = re.findall(pat2, text) print 'findall with pat1:', m111 print 'findall with pat2:', m222 output as below: search with pat1: ababbbaa search with pat2: ababbbaa split with pat1: ['22', 'a', '33', 'a', '44', 'b', '55', 'b', '66', 'a', '77', 'b', '88'] split with pat2: ['22', '33', '44', '55', '66', '77', '88'] findall with pat1: ['a', 'a', 'b', 'b', 'a', 'b'] findall with pat2: ['ababbbaa', 'aaa', 'b', 'bb', 'abaa', 'babab'] why are 'pat1' and 'pat2' different and what's their difference? what kind of strings can 'pat1' actually match?

    Read the article

  • jQuery: Replace strings with .each()

    - by Warrantica
    I want a function that replace each li with an image. This is my code: $(document).ready(function(){ var tmphref; var tmpname; var str = '<a href="' + tmphref + '"><img src="http://www.somesite.com/a/' + tmpname[1] + '/avatar-small.jpg /></a>'; $('#somediv li a').each(function(){ tmphref = $(this).attr("href"); tmpname = /http\:\/\/(\w+)\.somesite\.com\//.exec(tmphref); $(this).parent().replaceWith(str); }); }); The image is in this specific path: www.somesite.com/a/username/avatar-small.jpg The code above doesn't work. Any ideas? Thank you in advance.

    Read the article

< Previous Page | 112 113 114 115 116 117 118 119 120 121 122 123  | Next Page >