Search Results

Search found 9282 results on 372 pages for 'complete'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 118/372 | < Previous Page | 114 115 116 117 118 119 120 121 122 123 124 125  | Next Page >

  • Dynamic Multiple Choice (Like a Wizard) - How would you design it? (e.g. Schema, AI model, etc.)

    - by henry74
    This question can probably be broken up into multiple questions, but here goes... In essence, I'd like to allow users to type in what they would like to do and provide a wizard-like interface to ask for information which is missing to complete a requested query. For example, let's say a user types: "What is the weather like in Springfield?" We recognize the user is interested in weather, but it could be Springfield, Il or Springfield in another state. A follow-up question would be: What Springfield did you want weather for? 1 - Springfield, Il 2 - Springfield, Wi You can probably think of a million examples where a request is missing key data or its ambiguous. Make the assumption the gist of what the user wants can be understood, but there are missing pieces of data required to complete the request. Perhaps you can take it as far back as asking what the user wants to do and "leading" them to a query. This is not AI in the sense of taking any input and truly understanding it. I'm not referring to having some way to hold a conversation with a user. It's about inferring what a user wants, checking to see if there is an applicable service to be provided, identifying the inputs needed and overlaying that on top of what's missing from the request, then asking the user for the remaining information. That's it! :-) How would you want to store the information about services? How would you go about determining what was missing from the input data? My thoughts: Use regex expressions to identify clear pieces of information. These will be matched to the parameters of a service. Figure out which parameters do not have matching data and look up the associated question for those parameters. Ask those questions and capture answers. Re-run the service passing in the newly captured data. These would be more free-form questions. For multiple choice, identify the ambiguity and search for potential matches ranked in order of likelihood (add in user history/preferences to help decide). Provide the top 3 as choices. Thoughts appreciated. Cheers, Henry

    Read the article

  • SharePoint Add New Item Button on Home Page

    - by ifunky
    I'm building a bulletin board site (in 2010) and I'm sure this must be simple but again it doesn't seem so. Anyway on my default page I have a query webpart showing the latest items and what I need is just a button at the top of the page "Add new item" which would show the popup and allow users to complete the form just like it works on the display list items form. I've looked at AllItems.aspx but can't even see the "Add new item" button to copy! Any ideas? Thanks Dan

    Read the article

  • Regarding Application Templates

    - by user185590
    Hi Folks , Here is Jagadeesh, New to the Iphone Development Platform , i need to know the Difference among the Templates for our Applications( like we have Navigation, view, window, Open Gl, Tab Bar, Utility type application)over there and there is a small description at the bottom of the pane , can anyone let me know the Complete description and Templates Screen shot(like View based aPpliction screen shot, Window based Screen Shot Etc..., ) so that as a beginner it is very easy to learn....

    Read the article

  • linking c++ sources in iPhone project

    - by Steve918
    I have a single cpp file added to my iPhone project with a .cpp extension, but I'm seeing errors when linking like: operator new[](unsigned long)", referenced from: ___gxx_personality_sj0", referenced from: I thought as long as I named the cpp files with .cpp or .mm it would do the right thing, do I need to add some linker flags? Update: Complete Build log: http://dpaste.org/tXAy/ The C++ code: unzip.h unzip.cpp

    Read the article

  • Redirect all requests to a subdirectory

    - by Karl Keefer
    I have a drupal site install at example.com/drupal but now that the site is built I want to forward all requests to that directory, without it ever showing "drupal" in url. I think this can be done with .htaccess, but I didn't know if that was a hack-y answer. I'm using mediatemple's GridServer so I don't have complete control over apache settings and stuff, although I do have SSH.

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Portable PHP IDE / Editor

    - by Shishant
    Hello, There are a lot of IDE posts here but not for portable. Can anybody help me find a good portable PHP IDE? I am looking for this features: FTP Sitemanager Syntax Highlighting Auto-complete (Optional) I am fine even with a paid version. I tried aptana on my usb but the experience was not good.

    Read the article

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • Sequencing 2 lines of JQUERY

    - by nobosh
    I have the following lines of JQUERY: // When dragging ends stop: function(event, ui) { // Replace the placeholder with the original $placeholder.after( $this.show() ).remove(); // Run a custom stop function specitifed in the settings settings.stop.apply(this); }, I don't want settings.stop.apply(this); to run UNTIL the line above is $placeholder.after( $this.show() ).remove();, right now what's happening is the settings.stop is running to early. With JQUERY, how can I Sequence these two lines to not proceed until the first is complete? Thanks

    Read the article

  • How to remove control chars from UTF8 string

    - by Mimefilt
    Hi there, i have a VB.NET program that handles the content of documents. The programm handles high volumes of documents as "batch"(2Million documents;total 1TB volume) Some of this documents may contain control chars or chars like f0e8(http://www.fileformat.info/info/unicode/char/f0e8/browsertest.htm). Is there a easy and especially fast way to remove that chars?(except space,newline,tab,...) If the answer is regex: Has anyone a complete regex for me? Thanks!

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • Programming Language Choices for High Integrity Systems

    - by Finbarr
    What programming languages are a good choice for High Integrity Systems? An example of a bad choice is Java as there is a considerable amount of code that is inaccessible to the programmer. I am looking for examples of strongly typed, block structured languages where the programmer is responsible for 100% of the code, and there is as little interference from things like a JVM as possible. Compilers will obviously be an issue. Language must have a complete and unambiguous definition.

    Read the article

  • jQuery library to autopopulate multiple fields

    - by user1134179
    I have multiple textboxes with set character limits that together make up a code. There is value in the boxes being separated for a variety of reasons. I want to be able to paste a complete code in the first textbox and have it automatically populate all the textboxes. Is there a way to do this in javascript or a jquery library for this case? Currently I'm using jQuery autotab on each textbox and I'd prefer to keep that functionality.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 114 115 116 117 118 119 120 121 122 123 124 125  | Next Page >