Search Results

Search found 3639 results on 146 pages for 'dom manipulation'.

Page 118/146 | < Previous Page | 114 115 116 117 118 119 120 121 122 123 124 125  | Next Page >

• Changing the image of a scroll bar without flash.

  - by user352527

  How can i change the appearance (not the color) of a scrollbar within a box with overflow? I know how to do it in flash, I need a way to do it without it. In fact, I want to know how they did this slider in the apple web site: http://www.apple.com/mac/ It seems they used css along with javascript, but that's all I know. Is it possible that they did it using DOM, DHTML, HTML 5, Ruby or PHP? I have no idea. If you'd be kind enough to share the answer, I thank you in advance.

  Read the article

• VB.Net 2008 Chrome or Firefox control

  - by AndyD273

  I'm trying to figure out a way to have multiple sessions at the same website at the same time. I've been using the SHDocVw.InternetExplorer control in Visual Studio 2008 to open a web browser and log in, but at times we need to use a separate login. I haven't found a way to do this using just internet explorer (it just uses the credentials of the first login), so I figure if I can find a similar control for another brower that allows DOM level access then I can just use that. If anyone knows of anything I can try that would be very helpful.

  Read the article

• How to use xml response as XMLObject outside of ajax callback function

  - by Anthony

  Hopefully I've just made a dumb oversight, but I can't figure out why the following doesn't work: $(function() { var xml; $.get( "somexml.xml", function(data){ xml = data; }, "xml"); alert(xml); }); If I put the alert inside of the callback function, I get back object XMLdocument but if I place it outside of the ajax call, I get undefined. Since my goal is to have a new DOM to parse, I don't want the entire handling of the XMLdocument to be within the callback function. I've tried defining the variable outside of the entire onready function, inside at the top (like above) and inside the callback function, all with no luck. According to Specifying the Data Type for Ajax Requests in the jquery documentation, this should be possible.

  Read the article

• Firefox XUL toolbar with javascript to IE?

  - by user325377

  Hi, I have developed a Firefox toolbar in XUL, which uses javascript to manipulate the DOM. I'd like to export this to IE. I know that IE doesn't support XUL, but wonder: (1) is there an easy way to use the existing javascript code for the IE toolbar as well? (2) is there a IE installer that easily creates all necessary registry values for creating a toolbar? I'd be grateful for any help. If anyone can point me to a sample IE toolbar code, with several buttons, drop-down menus and perhaps even a search box, that'll make things much easier as well. Thanks!

  Read the article

• What can cause my code to run slower when the server JIT is activated?

  - by durandai

  I am doing some optimizations on an MPEG decoder. To ensure my optimizations aren't breaking anything I have a test suite that benchmarks the entire codebase (both optimized and original) as well as verifying that they both produce identical results (basically just feeding a couple of different streams through the decoder and crc32 the outputs). When using the "-server" option with the Sun 1.6.0_18, the test suite runs about 12% slower on the optimized version after warmup (in comparison to the default "-client" setting), while the original codebase gains a good boost running about twice as fast as in client mode. While at first this seemed to be simply a warmup issue to me, I added a loop to repeat the entire test suite multiple times. Then execution times become constant for each pass starting at the 3rd iteration of the test, still the optimized version stays 12% slower than in the client mode. I am also pretty sure its not a garbage collection issue, since the code involves absolutely no object allocations after startup. The code consists mainly of some bit manipulation operations (stream decoding) and lots of basic floating math (generating PCM audio). The only JDK classes involved are ByteArrayInputStream (feeds the stream to the test and excluding disk IO from the tests) and CRC32 (to verify the result). I also observed the same behaviour with Sun JDK 1.7.0_b98 (only that ist 15% instead of 12% there). Oh, and the tests were all done on the same machine (single core) with no other applications running (WinXP). While there is some inevitable variation on the measured execution times (using System.nanoTime btw), the variation between different test runs with the same settings never exceeded 2%, usually less than 1% (after warmup), so I conclude the effect is real and not purely induced by the measuring mechanism/machine. Are there any known coding patterns that perform worse on the server JIT? Failing that, what options are available to "peek" under the hood and observe what the JIT is doing there?

  Read the article

• Why does dojo parsing time depend on css and images availability?

  - by Kniganapolke

  I have been profiling javascript on my page that uses dojo widgets. I don't use explicit parsing - the parser runs on page load. What I noticed is that if I clear browser cache before refreshing the page, dojo parsing takes much more time than if all the files are already cached. Note that we build all the required dojo modules into a layer (a single file), so we don't lazy-load any js files. I wonder if dojo parsing process depends on images and css resources, as far as I know it only instantiates widgets and injects dom nodes. Do you have any ideas why dojo parser runs longer (2-3 times longer in my case) when the cache is cleared?

  Read the article

• Automatically hyper-link URL's and Email's using C#, whilst leaving bespoke tags in place

  - by marcusstarnes

  I have a site that enables users to post messages to a forum. At present, if a user types a web address or email address and posts it, it's treated the same as any other piece of text. There are tools that enable the user to supply hyper-linked web and email addresses (via some bespoke tags/markup) - these are sometimes used, but not always. In addition, a bespoke 'Image' tag can also be used to reference images that are hosted on the web. My objective is to both cater for those that use these existing tools to generate hyper-linked addresses, but to also cater for those that simply type a web or email address in, and to then automatically convert this to a hyper-linked address for them (as soon as they submit their post). I've found one or two regular expressions that convert a plain string web or email address, however, I obviously don't want to perform any manipulation on addresses that are already being handled via the sites bespoke tagging, and that's where I'm stuck - how to EXCLUDE any web or email addresses that are already catered for via the bespoke tagging - I wan't to leave them as is. Here are some examples of bespoke tagging for the variations that I need to be left alone: [URL=www.msn.com]www.msn.com[/URL] [URL=http://www.msn.com]http://www.msn.com[/URL] [[email protected]][email protected][/EMAIL] [IMG]www.msn.com/images/test.jpg[/IMG] [IMG]http://www.msn.com/images/test.jpg[/IMG] The following examples would however ideally need to be automatically converted into web & email links respectively: www.msn.com http://www.msn.com [email protected] Ideally, the 'converted' links would just have the appropriate bespoke tags applied to them as per the initial examples earlier in this post, so rather than: <a href="..." etc. they'd become: [URL=http://www.. etc.) Unfortunately, we have a LOT of historic data stored with this bespoke tagging throughout, so for now, we'd like to retain that rather than implementing an entirely new way of storing our users posts. Any help would be much appreciated. Thanks.

  Read the article

• How can I strip Python logging calls without commenting them out?

  - by cdleary

  Today I was thinking about a Python project I wrote about a year back where I used logging pretty extensively. I remember having to comment out a lot of logging calls in inner-loop-like scenarios (the 90% code) because of the overhead (hotshot indicated it was one of my biggest bottlenecks). I wonder now if there's some canonical way to programmatically strip out logging calls in Python applications without commenting and uncommenting all the time. I'd think you could use inspection/recompilation or bytecode manipulation to do something like this and target only the code objects that are causing bottlenecks. This way, you could add a manipulator as a post-compilation step and use a centralized configuration file, like so: [Leave ERROR and above] my_module.SomeClass.method_with_lots_of_warn_calls [Leave WARN and above] my_module.SomeOtherClass.method_with_lots_of_info_calls [Leave INFO and above] my_module.SomeWeirdClass.method_with_lots_of_debug_calls Of course, you'd want to use it sparingly and probably with per-function granularity -- only for code objects that have shown logging to be a bottleneck. Anybody know of anything like this? Note: There are a few things that make this more difficult to do in a performant manner because of dynamic typing and late binding. For example, any calls to a method named debug may have to be wrapped with an if not isinstance(log, Logger). In any case, I'm assuming all of the minor details can be overcome, either by a gentleman's agreement or some run-time checking. :-)

  Read the article

• Before after select event validation and results with jquery

  - by richbyte

  I am using a javascript function (F) (jquery )which uses 3 select values selected by the user to calculates a value - R(result) R is a number ranging from (1 through 9), (11) and (22); I need 2 extra steps one before the calculation and one after. a. Before calculation takes place: Make sure all three select values are changed before function(F) takes place. If not prompt the user with a notice ( create dom element/ I am using jquery) b. After the value R is calculated show an element corresponding to the result e.g. if R is 1 show an element ( a predetermined "link" element corresponding to each result value) thanks a lot.

  Read the article

• performing a javascript event without triggering that event handler

  - by bento

  In my latest code, I have an event handler for a focus on a textarea. When the user clicks on the textarea, that event-handler is triggered which sets some other DOM states based on the selected textarea. However, elsewhere in my program I want to programmatically set the focus of the textarea without triggering that event handler. I know Backbone, for instance, has a way to silently perform an action. My only pseudo-solution is to temporarily set a variable: var silence = true; And then, in my event handler, only perform the logic if silence is false. The handler is still triggered, but the logic doesn't run. Does anyone else know of better strategies for this?

  Read the article

• HTML5: Can't drag on-the-fly created <div> tag even though draggable='true' Do I need to "BLESS"

  - by Pete Alvin

  After creating a div on the fly with this markup: $('.circuit').prepend("<div class='component' draggable='true'>TRANSISTOR</div>"); It is NOT draggable itself :( Is jQuery prepend() the correct way to create "live" tags in the DOM? Do I need to somehow bless it a different way to make draggable=true really work? How to I wire it up so that on-the-fly divs can be draggable? AFTER NOTE: I added a static div and that is draggable. INTERESTING: I view both the static and dynamic using FireFox F12 Firebug and they are identical. But one is draggable and one is not!!!

  Read the article

• Implement a calender with Ruby and Javascript in Rails

  - by samuel02

  I'm trying to implement a calendar with Ruby and Javascript in Rails. I'm using a calendar helper that creates a calendar with given year and month and events as parameters (<%= calendar(:year => 2012, :month => 4, :events => @events %>). I also have three buttons next, today and previous with which the user should be able to navigate the calendar with. I am also going to implement some js that makes it possible to select dates in the calendar. So what I would like to do is to insert the calendar in the DOM with javascript in order to generate a new calendar when the user clicks one of the buttons. That way I will be able to control the behavior of the buttons and add the select functionality. The problem is that I can't just insert my erb code in a javascript plus I'm not even sure it's the right way to go? Any suggestions are appreciated!

  Read the article

• jQuery draggable leaving cloned html behind

  - by Alex Crooks

  I am using jQuery UI; Draggable http://jqueryui.com/demos/draggable invoked like this: $(document).ready(function(){ $("#side_bar").sortable({ revert: true }); $(".draggable").draggable({ containment: 'parent', hascroll: true, handle: 'div.box_header', scrollSensitivity: 100, scrollSpeed: 100, axis: 'y', connectToSortable: '#side_bar', helper: 'clone', opacity: 0.35 }); }); You can see the html structure on http://www.sarsclan.co.uk (right side bar area). It seems to create a transparant clone as your dragging, but when you drop it puts the draggable div in the right place, but leaves the original div in it's place and just appends the dom with a clone of that original div in its new place.

  Read the article

• I am looking for an actual functional web browser control for .NET, maybe a C++ library

  - by Joshua

  I am trying to emulate a web browser in order to execute JavaScript code and then parse the DOM. The System.Windows.Forms.WebBrowser object does not give me the functionality I need. It let's me set the headers, but you cannot set the proxy or clear cookies. Well you can, but it is not ideal and messes with IE's settings. I've been extending the WebBrowser control pinvoking native windows functions so far, but it is really one hack on top of another. I can mess with the proxy and also clear cookies and such, but this control has its issues as I mentioned. I found something called WebKit .NET (http://webkitdotnet.sourceforge.net/), but I don't see support for setting proxies or cookie manipulation. Can someone recommend a c++/.NET/whatever library to do this: Basically tell me what I need to do to get an interface to similar this in .NET: // this should probably pause the current thread for the max timeout, // throw an exception on failure or return null w/e, VAGUELY similar to this string WebBrowserEmu::FetchBrowserParsedHtml(Uri url, WebProxy p, int timeoutSeconds, byte[] headers, byte[] postdata); void WebBrowserEmu::ClearCookies(); I am not responsible for my actions.

  Read the article

• functions inside or outside jquery document ready

  - by Hans

  Up until now I just put all my jQuery goodness inside the $(document).ready() function, including simple functions used in certain user interactions. But functions that don´t require the DOM document to be loaded or are only called afterwards anyway, can be placed outside the $(document).ready() as well. Consider for example a very simple validation function such as: function hexvalidate(color) { // Validates 3-digit or 6-digit hex color codes var reg = /^(#)?([0-9a-fA-F]{3})([0-9a-fA-F]{3})?$/; return reg.test(color); } The function is only called from within the $(document).ready() function though. What is best practice (syntax, speed); placing such a function inside or outside the jquery document ready function?

  Read the article

• Greasemonkey script not executed when unusual content loading is being used

  - by Sam Brightman

  I'm trying to write a Greasemonkey script for Facebook and having some trouble with the funky page/content loading that they do (I don't quite understand this - a lot of the links are actually just changing the GET, but I think they do some kind of server redirect to make the URL look the same to the browser too?). Essentially the only test required is putting a GM_log() on its own in the script. If you click around Facebook, even with facebook.com/* as the pattern, it is often not executed. Is there anything I can do, or is the idea of a "page load" fixed in Greasemonkey, and FB is "tricking" it into not running by using a single URL? If I try to do some basic content manipulation like this: GM.log("starting"); var GM_FB=new Object; GM_FB.birthdays = document.evaluate("//div[@class='UIUpcoming_Item']", document, null, XPathResult.UNORDERED_NODE_SNAPSHOT_TYPE, null); for (i = GM_FB.birthdays.snapshotLength - 1; i >= 0; i--) { if (GM_FB.birthdayRegex.test(GM_FB.birthdays.snapshotItem(i).innerHTML)) { GM_FB.birthdays.snapshotItem(i).setAttribute('style','font-weight: bold; background: #fffe88'); } } The result is that sometimes only a manual page refresh will make it work. Pulling up the Firebug console and forcing the code to run works fine. Note that this isn't due to late loading of certain parts of the DOM: I have adding some code later to wait for the relevant elements and, crucially, the message never gets logged for certain transitions. For example, when I switch from Messages to News Feed and back.

  Read the article

• IE 8 html parsing error message.

  - by user48408

  I'm experiencing the problem outlined in this kb article. http://support.microsoft.com/kb/927917 . Sorry I can't hyperlink cos i don't have enough points! "This problem occurs because a child container HTML element contains script that tries to modify the parent container element of the child container. The script tries to modify the parent container element by using either the innerHTML method or the appendChild method." The problem I'm having diagnosing the source of my problem is 2 fold: 1) This is only happening on some client machines (All are running IE8) and not others. How/Why only some? 2) I don't have any scripts which modify the innerHTML or call appendChild on any dom elements. I do have server side code which modify properties on asp .net server controls. (Essentially all thats happening is a panel control with some more controls is being made visbile or invisible on a button click), would these in turn then set the innerHTML property of the client rendered control(?)

  Read the article

• Chrome Extension Manifest 'Matches'

  - by Aristotle

  I'm trying my hands at a simple Chrome Extension, but am running into a problem with providing a value for the matches array in my content_scripts. { "name": "My Extension", "version": "1.0", "description": "My Extension Experiment", "browser_action": { "default_icon": "icon.png", "default_title": "Ext", "default_popup": "popup.html" }, "content_scripts": { "matches": ["http://*"], "js": ["scripts.js"] } } When I try to load this extension into Chrome, I get the following message: Could not load extension from 'C:\Users\foo\Desktop\Extensions\bar'.Invalid value for 'content_scripts'. I cannot see what is "invalid" about my value though. What I'm trying to do is match every URL, so my extension can manipulate the DOM (via javascript within scripts.js) of any page it is ran on. Am I missing something, going about this all wrong, or what? update After posting this question, I did notice that the Google example was slightly different than mine, so I modified my code a bit to reflect their syntax: "content_scripts": [{ "matches": ["http://*"], "js": ["scripts.js"] }] That being said, I still get the following error when trying to load my extension: Could not load extension from 'C:\Users\foo\Desktop\Extensions\bar'. Invalid value for 'content_scripts[0].matches[0]'.

  Read the article

• JAVA: Build XML document using XPath expressions

  - by snoe

  I know this isn't really what XPath is for but if I have a HashMap of XPath expressions to values how would I go about building an XML document. I've found dom-4j's DocumentHelper.makeElement(branch, xpath) except it is incapable of creating attributes or indexing. Surely a library exists that can do this? Map xMap = new HashMap(); xMap.put("root/entity/@att", "fooattrib"); xMap.put("root/array[0]/ele/@att", "barattrib"); xMap.put("root/array[0]/ele", "barelement"); xMap.put("root/array[1]/ele", "zoobelement"); would result in: <root> <entity att="fooattrib"/> <array><ele att="barattrib">barelement</ele></array> <array><ele>zoobelement</ele></array> </root>

  Read the article

• Subset and lagging list data structure R

  - by user1234440

  I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

  Read the article

• R plotting multiple histograms on single plot to .pdf as a part of R batch script

  - by Bryce Thomas

  I am writing R scripts which play just a small role in a chain of commands I am executing from a terminal. Basically, I do much of my data manipulation in a Python script and then pipe the output to my R script for plotting. So, from the terminal I execute commands which look something like $python whatever.py | R CMD BATCH do_some_plotting.R. This workflow has been working well for me so far, though I have now reached a point where I want to overlay multiple histograms on the same plot, inspired by this answer to another user's question on Stackoverflow. Inside my R script, my plotting code looks like this: pdf("my_output.pdf") plot(hist(d$original,breaks="FD",prob=TRUE), col=rgb(0,0,1,1/4),xlim=c(0,4000),main="original - This plot is in beta") plot(hist(d$minus_thirty_minutes,breaks="FD",prob=TRUE), col=rgb(1,0,0,1/4),add=T,xlim=c(0,4000),main="minus_thirty_minutes - This plot is in beta") Notably, I am using add=T, which is presumably meant to specify that the second plot should be overlaid on top of the first. When my script has finished, the result I am getting is not two histograms overlaid on top of each other, but rather a 3-page PDF whose 3 individual plots contain the titles: i) Histogram of d$original ii) original - This plot is in beta iii) Histogram of d$minus_thirty_minutes So there's two points here I'm looking to clarify. Firstly, even if the plots weren't overlaid, I would expect just a 2-page PDF, not a 3-page PDF. Can someone explain why I am getting a 3-page PDF? Secondly, is there a correction I can make here somewhere to get just the two histograms plotted, and both of them on the same plot (i.e. 1-page PDF)? The other Stackoverflow question/answer I linked to in the first paragraph did mention that alpha-blending isn't supported on all devices, and so I'm curious whether this has anything to do with it. Either way, it would be good to know if there is a R-based solution to my problem or whether I'm going to have to pipe my data into a different language/plotting engine.

  Read the article

• Simple Javascript Won't work

  - by webzide

  Dear Experts, I was testing some code and I became very frustrated as I couldn't even get an simple DOM alert box to work Anyway here's the code <!DOCTYPE HTML PUBLIC "-//W3C/DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/tdt/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <script type="text/javascript"> <!-- var x=document.getElementById("myHeader"); alert(x.innerHTML); //--> </script> </head> <body> <h1 id="myHeader">Click me!</h1> </body> </html> I don't know what I did wrong but I just don't see the alert box. I use FF btw.

  Read the article

• PHP: Join two separate mysql queries into the same json data object

  - by Dan

  I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• jquery iterating through newly created elements

  - by jaeyun

  Hi All, I am trying to add new rows in my table, and save them into DB. First, I use .append() to append rows on the table: $("#tablename").append("<tr id='newRow'><td>newly added row</td></tr>"); The appending function works fine. My page displays the correct result. However, I am unable to select them with $("#newRow").each(function () { alert "it never reaches here!"; }); I am guessing it is because the elements are added after the DOM is loaded. Can anyone please tell me how I can iterate through all my newly added elements? Thank you.

  Read the article

< Previous Page | 114 115 116 117 118 119 120 121 122 123 124 125  | Next Page >