Search Results

Search found 5433 results on 218 pages for 'escaped characters'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 121/218 | < Previous Page | 117 118 119 120 121 122 123 124 125 126 127 128  | Next Page >

  • Creating a unique URL safe hash

    - by Ben Foster
    I want to hash/encode a unique integer (database ID) to create a similarly unique string. It needs to meet the following requirements: Must start with a letter or number, and can contain only letters and numbers. All letters in a container name must be lowercase. Must be from 3 through 63 characters long (although the shorter the better) The result does not need to be reversible, just repeatable - so a 1-way hash would be fine.

    Read the article

  • How may I scroll with vim into a big file ?

    - by Luc M
    Hello, I have a big file with thousands of lines of thousands of characters. I move the cursor to 3000th character. If I use PageDown or <CTRL>-D, the file will scroll but the cursor will come back to the first no-space character. There's is an option to set to keep the cursor in the same column after a such scroll ? I have the behavior with gvim on Window, vim on OpenVMS and Cygwin. Regards

    Read the article

  • Sanitizing MySQL user parameters.

    - by Tom
    What are the dangerous characters that should be replaced in user input when the users' input will be inserted in a MySQL query? I know about quotes, double quotes, \r and \n. Are there others?(I don't have the option of using a smart connector that accepts parameters so I have to build the query myself and this will be implemented in multiple programming languages, including some obscure ones so solutions such as mysql_real_escape_string in PHP are not valid)

    Read the article

  • Length of current selection in Eclipse

    - by Grzegorz Oledzki
    Do you know any easy way to know what is the length of current selection in Eclipse? I.e. I select a line fragment and would like to know how many characters are there? Usually I count them manually, but that's stupid. When being desperate I move to the start, check the column number, move to the end, check the column number, subtract, think a minute if I should add 1 or not... and my selection is lost.

    Read the article

  • Add text to every line in text file using PowerShell

    - by Joshua
    I'd like to add characters to the end of every line of text in a .txt document. #Define Variables $a = c:\foobar.txt $b = get-content $a #Define Functions function append-text { foreach-Object { add "*" } } #Process Code $b | append-text Something like that. Essentially, load a given text file, add a "*" the the end of every single line of text in that text file, save and close.

    Read the article

  • Preventing server-side scripting, XSS

    - by Tim
    Hey all Are there any pre-made scripts that I can use for PHP / MySQL to prevent server-side scripting and JS injections? I know about the typical functions such as htmlentities, special characters, string replace etc. but is there a simple bit of code or a function that is a failsafe for everything? Any ideas would be great. Many thanks :)

    Read the article

  • MS Access ADODB.recordset character limit is 2036!? Can this be increased?

    - by souper-dragon
    In the following AccessVBA code, I am trying to write a record to a memo field called "Recipient_Display": oRec1.Fields("RECIPIENT_DISPLAY") = Left(sRecipientDisplayNames, Len(sRecipientDisplayNames) - 2) When the string contains 2036 characters, the write completes. Above this number I get the following error: Run-time error'-2147217887(80040e21)': Could not update; currently locked by another session on this machine. What is the significance of this number 2036 and is there a property I can adjust that will allow the above update to take place?

    Read the article

  • Why is my Android emulator keyboard in Japanese character mode?

    - by mckoss
    I'm debugging my Android application using the AVD (Android Virtual Device). When I try to enter text in a text field, my characters are being interpreted as Japanese (or Chinese?) in the IME. I don't know how I got into this mode or how to get out of it (I just want to enter alphabetic keys)? Here's a screen shot: http://u.go2.me/3cn

    Read the article

  • Replace occurences of NSString - iPhone

    - by ncohen
    Hi everyone, I have a long NSString in which I m trying to replace special characters. Part of my string looks like this: "veau (c\u00f4telette)","veau (filet)","agneau (gigot)","agneau (c\u00f4telette)","b*\u0153*uf (hach\u00e9)","porc (hach\u00e9)" I would like to replace all the \u0153 with "oe". I ve tried: [response stringByReplacingOccurrencesOfString:@"\u0153" withString:@"oe"]; but it doesn't work.... I don't understand why! Thanks

    Read the article

  • Need help with regex blank space

    - by Gandalf StormCrow
    How to replace from regex many empty/blank characters with none? ex: <div class="someClass" id="someID"> ...bunch of elements/content <input type="button" name="myInput" id="inputID" title="myInput Title" /> ...bunch of elements/content </div> when replaced : <a class="myselector" rel="I need this value"></a><div class="someClass" id="someID">...bunch of elements/content<input type="button" name="myInput" id="inputID" title="myInput Title" />...bunch of elements/content</div>

    Read the article

  • Uses for the capacity value of a string

    - by dreamlax
    In the C++ Standard Library, std::string has a public member function capacity() which returns the size of the internal allocated storage, a value greater than or equal to the number of characters in the string (according to here). What can this value be used for? Does it have something to do with custom allocators?

    Read the article

  • Scribus - disable escaping of text field

    - by ityndall
    Scribus 1.3.3.13 - Ubuntu 64bit I have a scribus document that I'm creating with text fields. I'm using the text fields for code samples, as that appeared to be the only way to have a scrolling text frame. Upon conversion of the document, these text fields get populated with escape characters. Is there any way to disable the escape sequences that are getting populating into these text fields?

    Read the article

  • How to eat HTML tags?

    - by Lost_in_code
    Is there any function that converts <a href="test.php"/> to &lt; href=&quot;test.php&quot;/&gt; It would be helpful if all html characters were converted in the similar manner. Is there a function or library to do this?

    Read the article

  • Ajax Control Toolkit not working on IE8

    - by e-turhan
    hi, I am using Ajax Control Toolkit version 40412 in my asp.net 4.0 website. When I run the page in Firefox it is working good but I run the page in IE8 it is not rendering toolkit controls and putting "//" characters on the bottom of page.This is happening with every control of toolkit. What can be the problem with this, any ideas?

    Read the article

  • More elegant way to write this?

    - by tesmar
    Hi, I am trying to make a multi-dimensional array of characters in ruby, and this works, but is there a more elegant way? def initialize(text) @map = Array.new i = 0 text.split("\n").each do |x| @map[i] = x.scan(/./) i += 1 end #@map = text end#constructor

    Read the article

  • Ignoring a character along with word boundary in regex

    - by DavidP6
    I am using gsub in Ruby to make a word within text bold. I am using a word boundary so as to not make letters within other words bold, but am finding that this ignores words that have a quote after them. For example: text.gsub(/#{word}\b/i, "<b>#{word}</b>") text = "I said, 'look out below'" word = below In this case the word below is not made bold. Is there any way to ignore certain characters along with a word boundary?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 117 118 119 120 121 122 123 124 125 126 127 128  | Next Page >