Search Results

Search found 4557 results on 183 pages for 'prefer'.

Page 123/183 | < Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >

  • What is the best signature for overloaded arithmetic operators in C++?

    - by JohnMcG
    I had assumed that the canonical form for operator+, assuming the existence of an overloaded operator+= member function, was like this: const T operator+(const T& lhs, const T& rhs) { return T(lhs) +=rhs; } But it was pointed out to me that this would also work: const T operator+ (T lhs, const T& rhs) { return lhs+=rhs; } In essence, this form transfers creation of the temporary from the body of the implementation to the function call. It seems a little awkward to have different types for the two parameters, but is there anything wrong with the second form? Is there a reason to prefer one over the other?

    Read the article

  • How do I learn Scheme?

    - by Gautam
    Hey, I'm a relative newbie to programming. I've picked up some very basic Java (File I/O, GUIs, inheritance) and would like to take a look at functional programming - in particular, I would like to learn Scheme. I'm having some trouble finding a Scheme implementation I can understand. Interpreters are weird; I'm not sure how to save my programs and create executables. I've downloaded PLT Scheme, but I would prefer using something less condescending, something similar to NetBeans. Is there a plugin or tool that will allow me to quickly and easily create and manage Scheme programs? All help is appreciated!

    Read the article

  • jquery ajax calls with scope safety

    - by acidzombie24
    My gut tells me that if i am on a laggy server and the user fires two events fast enough on the success function c will be the value of the most recent event causing func1 to use the wrong value. <--- This is a guess, i haven't proved it. Its a feeling. How do i ensure that i use the right value when calling func1? I prefer not to send c to the server and i dont know if or how to serialize the data and deserialize it back. How do i make this code safe? $('.blah').click(function (event) { var c = $(this).closest('.comment'); ... $.ajax({ url: "/u", type: "POST", dataType: "json", data: { ... }, success: function (data) { func1(c. data.blah);//here

    Read the article

  • Create set of random JPGs

    - by Kylar
    Here's the scenario, I want to create a set of random, small jpg's - anywhere between 50 bytes and 8k in size - the actual visual content of the jpeg is irrelevant as long as they're valid. I need to generate a thousand or so, and they all have to be unique - even if they're only different by a single pixel. Can I just write a jpeg header/footer and some random bytes in there? I'm not able to use existing photos or sets of photos from the web. The second issue is that the set of images has to be different for each run of the program. I'd prefer to do this in python, as the wrapping scripts are in Python. I've looked for python code to generate jpg's from scratch, and didn't find anything, so pointers to libraries are just as good.

    Read the article

  • Change notification in CouchDB when a field is set

    - by PartlyCloudy
    Hi, I'm trying to get notifications in a CouchDB change poll as soon as pre-defined field is set or changed. I've already had a look at filters that can be used for filtering change events(db/_changes?filter=myfilter). However, I've not yet found a way to include this temporal information, because you can only get the current version of the document in this filter functions. Is there any possibility to create such a filter? If it does not work, I could export my field to a separate database and the only poll for changes in that db, but I'd prefer to keep together my data for obvious reasons. Thanks in advance!

    Read the article

  • C# change e-mail 'from' address to a user-provided one.

    - by Jeff
    We have an app that allows users to send e-mails from our system. It allows the user to specify their e-mail address, and gives them several standard templates to use as a starting point for their e-mail. When we send the e-mails, we use the address they provided as the 'reply-to', but the 'from' address of the e-mail (naturally) looks like our system (from '[email protected]'). Is there a way to change this without getting tangled up in spam filters or automatic blocking? We'd prefer not to confuse the recipient as to who actually composed the e-mail they've received.

    Read the article

  • Which language shouöd I take?

    - by Kovu
    Hi. I will build an application, that will be like a mix from a trojaner and a remote tool. It will be a spy programm for our company, so the IT Admin and Managment can see what the people are doing or not. (Only for explayning, please don't discuss about "uhhh tahts not ok"). I must choose a language for that. My best knowlegde is in C#.Net and VB.Net, but one main feature should be: No framework must be installed - so DotNet is out of the run. I decided to VB6 and a few minutes ago I ask for a IDE and some people say: Don't use it, it's too old. So, I must ask: What language do you prefer for such an project?

    Read the article

  • RoR live-search (text_field_with_auto_complete) submit.

    - by looneygrc
    I have a "Movies" and a "Actors" table and "Casts" as join-model. To be more specific "Casts" has movie_id, actor_id and rolename. I want in "Movies" form to add a live search to search through actors and a "rolename" text_field and save those to "Casts". I don't know if text_field_with_auto_complete is the right choice but i prefer not to use much javascript because i am not familiar with it. I've been searching all over the internet to find something similar to this without any result. I've manage to get it working with "@actors.each do" but it makes a very long list.

    Read the article

  • C# managed dll call or unmanaged dll call?

    - by 5YrsLaterDBA
    I was asking to do two dll calls from our application. These two dlls are from other group and other company. Have read a little about managed and unmanaged. I would prefer to do managed call. But whether use managed or unmanaged is the decision of the caller only or it also depends on the callee? All dlls can be called with managed code? If callee is also a factor, how can I know this dll can be called with managed code?

    Read the article

  • Best way to save info in hash

    - by qwertymk
    I have a webpage that the user inputs data into a textarea and then process and display it with some javascript. For example if the user types: _Hello_ *World* it would do something like: <underline>Hello</underline> <b>World</b> Or something like that, the details aren't important. Now the user can "save" the page to make it something like site.com/page#_Hello_%20*World* and share that link with others. My question is: Is this the best way to do this? Is there a limit on a url that I should be worried about? Should I do something like what jsfiddle does? I would prefer not to as the site would work offline if the full text would be in the hash, and as the nature of the site is to be used offline, the user would have to first cache the jsfiddle-like hash before they could use it. What's the best way to do this?

    Read the article

  • Matlab: plotting frequency distribution with a curve

    - by Kaly
    I have to plot 10 frequency distributions on one graph. In order to keep things tidy, I would like to avoid making a histogram with bins and would prefer having lines that follow the contour of each histogram plot. I tried the following [counts, bins] = hist(data); plot(bins, counts) But this gives me a very inexact and jagged line. I read about ksdensity, which gives me a nice curve, but it changes the scaling of my y-axis and I need to be able to read the frequencies from the y-axis. Can you recommend anything else?

    Read the article

  • Sending emails from Django App

    - by Will M.
    We are a growing Django app that is currently using Google Apps to send email. We are hitting the maximum limits of email sending and need a better solution. We prefer not to have to manage our own email servers and the easier the better. What is the best, easiest, and cheapest way to send a large amount of email? We have looked at Postageapp but they require you to use your own SMTP server. We are considering App Engine to send email but it will require a lot of configuration to get it to work correctly. What can we use to quickly fix this problem?

    Read the article

  • select distinct over specific columns

    - by Midhat
    A query in a system I maintain returns QID AID DATA 1 2 x 1 2 y 5 6 t As per a new requirement, I do not want the (QID, AID)=(1,2) pair to be repeated. We also dont care what value is selected from "data" column. either x or y will do. What I have done is to enclose the original query like this SELECT * FROM (<original query text>) Results group by QID,AID Is there a better way to go about this? The original query uses multiple joins and unions and what not, So I would prefer not to touch it unless its absolutely necesary

    Read the article

  • Mysql SELECT with an OR across 2 columns

    - by Haroldo
    I'm creating a 'similar items' link table. i have a 2 column table. both columns contains product ids. The table is showing that these items are similar. However ids in the left column are more valuable. Say i want to select similar items to product '125b'. i only want 3 similar items to 125b. If there are any instances of 125b in col1 I would prefer these to finding 125b in col2. so i need a select statement along the lines of SELECT * FROM similar_items WHERE col_1={$id} OR col_2={$id} ORDER BY column(?) LIMIT 3 i do not want to do 2 separate queries ( ie query 2 if count(query1) <3 )

    Read the article

  • Access DB with SQL Server Front End

    - by uyuni99
    I have an old Access application that has a lot of code in forms and reports. The database is getting too large and I am thinking of moving the back end to SQL Server. My requirements are as follows: The DB needs to be multiuser and the users (3-5) will need to log in over the web I would prefer not to re-write the forms and reports in ASP or some other web front end. When I think about my choices, I see them as: Have an Access ADP front end and allows remote log-in to the server where it is stored. Not sure if it is possible for 2 users to simultaneously log in Distribute an ADP front end to the users, but I am not sure if it is possible to connect to a SQL Server back end over the internet, and the network traffic may be an issue. Any other solution? I appreciate all help. u

    Read the article

  • Programming in a noisy office [closed]

    - by John Isaacks
    Can anyone recommend any techniques or advice for working in a noisy office? I know some people wear headphones and listen to music but I prefer silence. I work in a room with 4 others, there are no walls between us, we just each have our own desk. There is usually always someone talking, or on the phone, or on the intercom. Has anyone else had to deal with this? What did you do? What would you recommend?

    Read the article

  • Which MySQL Datatype to use for storing boolean values from/to PHP?

    - by Beat
    Since MySQL doesn't seem to have any 'boolean' datatype, which datatype do you 'abuse' for storing true/false information in MySQL? Especially in the context of writing and reading from/to a PHP-Script. Over time I have used and seen several approaches: tinyint, varchar fields containing the values 0/1, varchar fields containing the strings '0'/'1' or 'true'/'false' and finally enum Fields containing the two options 'true'/'false'. None of the above seems optimal, I tend to prefer the tinyint 0/1 variant, since automatic type conversion in PHP gives me boolean values rather simply. So which datatype do you use, is there a type designed for boolean values which I have overlooked? Do you see any advantages/disadvantages by using one type or another?

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Outlook 2007 plugin

    - by JL
    I am about to embark on my first outlook 2007 plugin. I would like to create a new tool bar that will have a button that will initially be disabled. When the user selects a message the button should be enabled... but only if the email is of a certain type of email... This is where I need your expert advice, is there a way to quickly flag an email in outlook, so that in the email select event you can look for a property of that email... for example... on_select if mail.type = "FromISP" then I would prefer not to use the from field.... the other thing is during the send process I need to set the flag, I am doing this again using .net so I have full control over how the mail is created. Any ideas would help... Thanks

    Read the article

  • Generic collection class?

    - by Mark
    Is there anyway I can do this? class TSOC<TCollection, TValue> : ICollection<TValue>, INotifyCollectionChanged where TCollection : ICollection { private TCollection<TValue> collection; } It doesn't like my definition of collection. I'd prefer the definition to look like TSOC<TCollection> where the user can pass in List<int> or something, but then I need to pull out the "int" to know what interface to implement.

    Read the article

  • Jquery ajax and php die()

    - by BizMark
    Hi, I have an IE problem. I am using the jquery ajax method to call a php script. The php script just calls die(). In firefox, the error message is displayed, but in IE the success message is displayed without any data. I would prefer the error function to be called. Is there any way to fix this? I'm guessing my javascript code needs change somehow. Thanks! <?php die() ?> $.ajax({ url: "phps/php.php?id="+the_id, dataType: "json", error: function(){ alert('error'); }, success: function(data){ alert("SUCCESS"); } });

    Read the article

  • iPhone to Java EE remoting

    - by Justin Simonelis
    Hi there! I was looking for some opinions on the best remote method invocation practices when developing iPhone applications that communicate with Java (java EE) servers. Many iphone applications these days typically talk to a server back end. I typically prefer to write my servers in java using some Spring libraries. So far I have not found or stuck to a definitive practice for iphone-java server communication. What are some technical solutions and libraries that you have used to implement this kind of client-server communication? One thing I always keep in mind is that I want the communication protocols to be simple so that multiple platforms can be added for example, in future adding Android and possibly Blackberry clients, that can use the same protocol to talk to the server.

    Read the article

  • Can a parser tell the lexer to ignore a newline?

    - by chollida
    I'm writing a preprocessor for my language. In the preprocessor I've output a line that wasn't in the source file. This causes any error messages that Anltr creates to be incremented by one line. The Lexer handles the line count so I'm wondering if there is a way for the parser to tell the lexer to decrement the line count, or to ignore a specific newline. I'm also open to other suggestions on how to work around this. The only constraint I have is putting the extra line inline with the existing code. I'd prefer to keep it on it's own line to keep my parsing sane.

    Read the article

  • Fastest way to convert a binary file to SQLite database

    - by chown
    I've some binary files and I'm looking for a way to convert each of those files to a SQLite database. I've already tried C# but the performance is too slow. I'm seeking an advice on how and what programming language should be the best to perform this kind of conversion. Though I prefer any Object Oriented Language more (like C#, Java etc), I'm open for any programming language that boosts up the conversion. I don't need a GUI frontend for the conversion, running the script/program from console is okay. Thanks in advance

    Read the article

  • How to distribute the chance to display each SWF evenly among banner collection?

    - by Michael Mao
    Hi all: I am working on The ausdcf.org to try adding several banner ads in swf format to the top. Everything starts to work, but I've got several questions that need your help: The client chose not to go with Google AdManager, but prefer a "minimal approach" to do this task. What I am trying to do is sort of "mimicking" the way Google AdManager does for banners, that is, to split the chance of each particular swf to be shown to the visitor evenly among the banner collection. Definitely I can add some jQuery code to do this from client-side, a random number generator and if-else statement would work - just $.load() it! However, what if I'd like to make sure those disabled Javascript (is there any now btw?) still be able to see different swfs in each visit. Any suggestion on how to approach this? Many thanks in advance.

    Read the article

< Previous Page | 119 120 121 122 123 124 125 126 127 128 129 130  | Next Page >