Search Results

Search found 9484 results on 380 pages for 'np complete'.

Page 126/380 | < Previous Page | 122 123 124 125 126 127 128 129 130 131 132 133  | Next Page >

  • HTML Form input textbox not accepting special characters

    - by karthi89
    Hello, There seems to be a problem, where i can't display the complete value in a html form text input box. When I echo $ title, I get output as "Stacey's Mom" This is the html code I used to show the value. -- This returns the value in textbox as "Stacey". Samething happens when "," or "'" or "/" occurs in the text. How can I show the entire text in the textbox. Help would be much appreciated.

    Read the article

  • Redirect all requests to a subdirectory

    - by Karl Keefer
    I have a drupal site install at example.com/drupal but now that the site is built I want to forward all requests to that directory, without it ever showing "drupal" in url. I think this can be done with .htaccess, but I didn't know if that was a hack-y answer. I'm using mediatemple's GridServer so I don't have complete control over apache settings and stuff, although I do have SSH.

    Read the article

  • SharePoint Add New Item Button on Home Page

    - by ifunky
    I'm building a bulletin board site (in 2010) and I'm sure this must be simple but again it doesn't seem so. Anyway on my default page I have a query webpart showing the latest items and what I need is just a button at the top of the page "Add new item" which would show the popup and allow users to complete the form just like it works on the display list items form. I've looked at AllItems.aspx but can't even see the "Add new item" button to copy! Any ideas? Thanks Dan

    Read the article

  • Free version control services?

    - by thr
    What free version control service would you recommend? I'm not looking for a complete project management service like Sourceforge, just something so I don't have to run a SVN/GIT server myself.

    Read the article

  • Looking for an Open Source Project in need of help

    - by hvidgaard
    Hi StackOverflow! I'm a CS student on well on my way to graduate. I have had a difficult time of finding relevant student jobs (they seems to be taken merely hours after the notice gets on the board) , so instead I'm looking for an open source project in need of help. I'm aware that I should choose one that I use, but I'm not aware of any OS-project that I use that needs help. That's why I'm asking you. I don't have any deep experience, but I here are some of my biggest projects so far: BitTorrent-ish client in Python (a subset of BitTorrent) HTTP 1.1 webserver in Java Compiler from a subset of Java to run on JRE Flash-framework project to model an iPad look and feel (not to run actual iPad programs) complete with an API for programs. Complete MySQL database for a booking system, with departure and arrival times, so you could only book valid tickets (with a Java frontend). I know, Java and languages like AS3 and C# feels natural per se, Python, and have done a fair bit of hacking around in C, but I don't feel very comfortable with it. Mostly I'm afraid to make a fuckup because I have such a high degree of control. I would like to think I'm well aware of good software design practices, but in reality what I do is ask myself "would I like to use/maintain this?", and I love to refactor my code because I see optimizations. I love algorithms and to make them run in the best possible time. I don't have any preferred domain to work in, but I wouldn't mind it to be graphics or math heavy. Ideally I'm looking for a project in C++ to learn the in's and out's of it, but I'm well aware that I don't know that language very well. I would like to have a mentor-like figure until I'm confident enough to stand on my own, not one to review all my code (I'm sure someone will to start with anyway), but to ask questions about the project and language in question. I do have a wife and two children, so don't expect me to put in 10+ hours every week. In return I can work on my own, I strive to program modular and maintainable code. Know how to read an API, use Google, StackOverflow and online resources in general. If you have any questions, shoot. I'm looking forward to your suggestions.

    Read the article

  • C# multiple asynchronous HttpRequest with one callback

    - by aepheus
    I want to make 10 asynchronous http requests at once and only process the results when all have completed and in a single callback function. I also do not want to block any threads using WaitAll (it is my understanding that WaitAll blocks until all are complete). I think I want to make a custom IAsyncResult which will handle multiple calls. Am I on the right track? Are there any good resources or examples out there that describe handling this?

    Read the article

  • Mod rewrite with multiple query strings

    - by Boris
    Hi, I'm a complete n00b when it comes to regular expressions. I need these redirects: (1) www.mysite.com/products.php?id=001&product=Product-Name&source=Source-Name should become -> www.mysite.com/Source-Name/001-Product-Name (2) www.mysite.com/stores.php?id=002&name=Store-Name should become -> www.mysite.com/002-Store-Name Any help much appreciated :)

    Read the article

  • Programming Language Choices for High Integrity Systems

    - by Finbarr
    What programming languages are a good choice for High Integrity Systems? An example of a bad choice is Java as there is a considerable amount of code that is inaccessible to the programmer. I am looking for examples of strongly typed, block structured languages where the programmer is responsible for 100% of the code, and there is as little interference from things like a JVM as possible. Compilers will obviously be an issue. Language must have a complete and unambiguous definition.

    Read the article

  • Sequencing 2 lines of JQUERY

    - by nobosh
    I have the following lines of JQUERY: // When dragging ends stop: function(event, ui) { // Replace the placeholder with the original $placeholder.after( $this.show() ).remove(); // Run a custom stop function specitifed in the settings settings.stop.apply(this); }, I don't want settings.stop.apply(this); to run UNTIL the line above is $placeholder.after( $this.show() ).remove();, right now what's happening is the settings.stop is running to early. With JQUERY, how can I Sequence these two lines to not proceed until the first is complete? Thanks

    Read the article

  • How to remove control chars from UTF8 string

    - by Mimefilt
    Hi there, i have a VB.NET program that handles the content of documents. The programm handles high volumes of documents as "batch"(2Million documents;total 1TB volume) Some of this documents may contain control chars or chars like f0e8(http://www.fileformat.info/info/unicode/char/f0e8/browsertest.htm). Is there a easy and especially fast way to remove that chars?(except space,newline,tab,...) If the answer is regex: Has anyone a complete regex for me? Thanks!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • sending data packet just before closing socket

    - by xopht
    Before disconnect the client, the server wants to send some info to the client - why do I(server) disconnect you(client). If I send packet to the info and close the client socket immediately, closesocket() returns -1 and if I use linger option to work closesocket() successfully, the info cannot be sent completely. How can I complete this and is it possible to know socket buffer is empty(means my packet sent all)? thx.

    Read the article

  • uiimage oncomplete iphone

    - by dubbeat
    Is there such a thing as an "on load complete" for images in iphone? I want to be able to destroy a UIActivity indicator once and image is loaded. What the general best practice for doing this?

    Read the article

  • Client server architecture question

    - by Shane Fulmer
    I am working on a client server system, and am running into issues where multiple clients are executing an action at the same time. We are able to solve this by locking on the critical section of code, which ensures that the first client will complete the action before the second client enters the code block. My question is this: our server is also clustered, so multiple instances of the server itself can exist, which recreates the same problem as before. How could we solve this problem? Thanks!

    Read the article

  • iis 7.0 Internal 500 Error

    - by bill
    Hi All, i am tearing my hair out. I have read every post on the internet and cannot for the life of me figure out HOW to force IIS 7.0 on 2008 to display detailed errors. I have published a .net 4.0 app. i am at a complete loss. thanks!

    Read the article

< Previous Page | 122 123 124 125 126 127 128 129 130 131 132 133  | Next Page >