Search Results

Search found 93838 results on 3754 pages for 'aspire one'.

Page 130/3754 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • How to move child element from one parent to another using jQuery

    - by Kapslok
    I am using the jQuery DataTables plugin. I would like to move the search box (.dataTables_filter) and number of records to display dropdown (.dataTables_length) from their parent element (.dataTables_wrapper) to another div on my page without losing any registered javascript behavior. For instance the search box has a function attached to the 'keyup' event and I want to keep that intact. The DOM looks like this: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> This is what I would like the DOM to look like after the move: <body> <div id="parent1"> <div class="dataTables_wrapper" id="table1_wrapper"> <table id="table1"> ... </table> </div> </div> <div id="parent2"> <div class="dataTables_filter" id="table1_filter"> <input type="text" class="search"> </div> <div class="dataTables_length" id="table1_length"> <select size="1" name="table1_length"> <option value="10">10</option> <option value="25">25</option> <option value="50">50</option> <option value="100">100</option> </select> </div> <ul> <li><a href="#">Link A</a></li> <li><a href="#">Link B</a></li> <li><a href="#">Link C</a></li> </ul> </div> </body> I've been looking at the .append(), .appendTo(), .prepend() and .prependTo() functions but haven't had any luck with these in practice. I've also looked at the .parent() and .parents() functions, but can't seem to code a workable solution. I have also considered changing the CSS so that the elements are absolutely positioned - but to be frank the page is setup with fluid elements all over, and I really want these elements to be floated in their new parents. Any help with this is much appreciated.

    Read the article

  • Many RewriteBase in one .htaccess file?

    - by Martti Laine
    Hello I have a domain and a wordpress-blog on same server. Now I have a problem (surprise). The wordpress is located on /httpdocs/blog/ and domain is pointing to /httpdocs/ and I'm trying to redirect it to /httpdocs/domain/. But, obvisiously, I have permalinks in Wordpress. Here's my current .htaccess: RewriteEngine On RewriteBase /blog/ RewriteCond %{REQUEST_FILENAME} !-f RewriteCond %{REQUEST_FILENAME} !-d RewriteRule . /blog/index.php [L] RewriteBase / RewriteCond %{HTTP_HOST} domain.com RewriteCond %{REQUEST_URI} !^/domain RewriteCond %{REQUEST_URI} !^/cgi-bin RewriteRule ^(.*)$ domain/$1 [L] But as you already propably assumed, this doesn't work. Wordpress' permalinks affects to /domain/ also, so my images and other urls go wrong. Any advice? Is it possible to use RewriteBase like this? Martti Laine

    Read the article

  • HTML: Place an image on top of another one

    - by Dimitris Baltas
    Inside a div, there is a picture that should have 10px margin in all directions from the DIV's border. On the left bottom corner of the picture there is an about-image. The picture is only displayed when its loaded in the DOM through jquery. The problem is that the existence of the about-image dislocates the picture downwards as many pixels as the height of the about-image. I am looking for the cleanest possible alternative to keep the picture inside the DIV and still display the about-image on top of it. Setting the picture as background will not work since i need the picture to load at once. Any improvement on the #about css would be greatly appreciated. Below is a full html page that reproduces the issue <html> <head> <title>Troubleshooting :: align the main picture inside the DIV</title> <style type="text/css"> html, body { background-color: #000000; } #about { z-index:2; position:relative; top:82%; left:3%; } #pic { width:100%; height:96%; } #main-content-image { height:100%; margin-right:10px; margin-left:10px; margin-top:10px; margin-bottom:10px; } #main-content { height:490px; border-width: 1px; border-style: solid; border-color: #777777; } #main-content-image.loading { background: url(http://farros.gr/images/ajax-loader2.gif) no-repeat center center; } a { text-decoration: none; text-decoration: none; color: #868686; outline:none; } .hide { display:none; } </style> <script type="text/javascript" src="http://ajax.googleapis.com/ajax/libs/jquery/1.3.2/jquery.min.js"></script> <script type="text/javascript"> <!-- $(document).ready(function(){ $(function () { var img = new Image(); $(img).load(function () { $(this).hide(); $(this).width('100%'); $(this).height('96%'); $('#main-content-image').removeClass('loading').append(this); $(this).fadeIn(); }).error(function () { // notify the user that the image could not be loaded }).attr('src', 'http://farros.gr/images/bg.jpg'); }); }); </script> </head> <body> <div id="main-content"> <div id="main-content-image" class="loading"> <a href="#"><img id="about" src='http://farros.gr/images/about.png' alt='Haris Farros'/></a> </div> </div> </body> </html>

    Read the article

  • prepend to a file one liner shell?

    - by elmarco
    This is probably a complex solution. I am looking for a simple operator like "", but for prepending. I am afraid it does not exist. I'll have to do something like mv $F tmp cat header tmp $F Anything smarter? (I am not fond of tmp files)

    Read the article

  • Multiple Windows Forms on one application

    - by Shukhrat Raimov
    I have two windows forms, first is initial and second is invoked when button on the first is pressed. It's two different windows, with different tasks. I programmed for both MVP pattern. But in the Main() I have this: static void Main() { Application.EnableVisualStyles(); Application.SetCompatibleTextRenderingDefault(false); ViewFirst viewFirst = new ViewFirst();//First Form PresenterFirst presenterFirst = new PresenterFirst(viewFirst); Application.Run(viewFirst); } And I Have Second Windows Form: ViewSecond viewSecond = new ViewSecond();//Second Form PresenterSecond presenterSecond = new PresenterSecond(viewSecond); I want to run it in this app as soon as the button on the first is clicked. How could I do this? My button on the first WF is: private void history_button_Click(object sender, EventArgs e) { ViewSecond db = new ViewSecond();//second Form where I have sepparate WF. db.Show(); }

    Read the article

  • WIX: COM unregistration when removing one of two programs

    - by madbadger
    Hello, I am relatively new to WiX. It is a great tool, but I still need some time to learn it better. I have encountered a problem with registration and unregistration of a COM component. I have created installers for two applications, lets call them A and B. Both are using the same COM component. I have used the heat tool, as recommended. When installing A or B, the component is registered without any problems. But when I install A and B, then remove A (with Add/Remove programs) the COM class gets unregistered and B cannot use it anymore. Is there a clean solution to prevent this from happening? I would like to unregister the COM when BOTH A and B are uninstalled. Any help would be appreciated, Best regards, madbadger

    Read the article

  • How can I overlay one image onto another?

    - by Edward Tanguay
    I would like to display an image composed of two images. I want image rectangle.png to show with image sticker.png on top of it with its left-hand corner at pixel 10, 10. Here is as far as I got, but how do I combine the images? Image image = new Image(); image.Source = new BitmapImage(new Uri(@"c:\test\rectangle.png")); image.Stretch = Stretch.None; image.HorizontalAlignment = HorizontalAlignment.Left; Image imageSticker = new Image(); imageSticker.Source = new BitmapImage(new Uri(@"c:\test\sticker.png")); image.OverlayImage(imageSticker, 10, 10); //how to do this? TheContent.Content = image;

    Read the article

  • ArrayAdapter need to be clear even i am creating a new one

    - by Roi
    Hello I'm having problems understanding how the ArrayAdapter works. My code is working but I dont know how.(http://amy-mac.com/images/2013/code_meme.jpg) I have my activity, inside it i have 2 private classes.: public class MainActivity extends Activity { ... private void SomePrivateMethod(){ autoCompleteTextView.setAdapter(new ArrayAdapter<String>(this, android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList("")))); autoCompleteTextView.addTextChangedListener(new MyTextWatcher()); } ... private class MyTextWatcher implements TextWatcher { ... } private class SearchAddressTask extends AsyncTask<String, Void, String[]> { ... } } Now inside my textwatcher class i call the search address task: @Override public void afterTextChanged(Editable s) { new SearchAddressTask().execute(s.toString()); } So far so good. In my SearchAddressTask I do some stuff on doInBackground() that returns the right array. On the onPostExecute() method i try to just modify the AutoCompleteTextView adapter to add the values from the array obtained in doInBackground() but the adapter cannot be modified: NOT WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); adapter.addAll(new ArrayList<String>(Arrays.asList(addressArray))); adapter.notifyDataSetChanged(); Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // Returns true!!??! } I dont get why this is not working. Even if i run it on UI Thread... I kept investigating, if i recreate the arrayAdapter, is working in the UI (Showing the suggestions), but i still need to clear the old adapter: WORKING CODE: protected void onPostExecute(String[] addressArray) { ArrayAdapter<String> adapter = (ArrayAdapter<String>) autoCompleteDestination.getAdapter(); adapter.clear(); autoCompleteDestination.setAdapter(new ArrayAdapter<String>(NewDestinationActivity.this,android.R.layout.simple_spinner_dropdown_item, new ArrayList<String>(Arrays.asList(addressArray)))); //adapter.notifyDataSetChanged(); // no needed Log.d("SearchAddressTask", "adapter isEmpty : " + adapter.isEmpty()); // keeps returning true!!??! } So my question is, what is really happening with this ArrayAdapter? why I cannot modify it in my onPostExecute()? Why is working in the UI if i am recreating the adapter? and why i need to clear the old adapter then? I dont know there are so many questions that I need some help in here!! Thanks!!

    Read the article

  • javascript regex: match altered version of first match with only one expression

    - by theseion
    Hi there I'm writing a brush for Alex Gorbatchev's Syntax Highlighter to get highlighting for Smalltalk code. Now, consider the following Smalltalk code: aCollection do: [ :each | each shout ] I want to find the block argument ":each" and then match "each" every time it occurrs afterwards (for simplicity, let's say every occurrence an not just inside the brackets). Note that the argument can have any name, e.g. ":myArg". My attempt to match ":each": \:([\d\w]+) This seems to work. The problem is for me to match the occurrences of "each". I thought something like this could work: \:([\d\w]+)|\1 but the right hand side of the alternation seems to be treated as an independent expression, so backreferencing doesn't work. So my question is: is it even possible to accomplish what I want in a single expression? Or would I have to use the backreference within a second expression (via another function call)? Cheers.

    Read the article

  • Consolidate data from many different databases into one with minimum latency

    - by NTDLS
    I have 12 databases totaling roughly 1.0TB, each on a different physical server running SQL 2005 Enterprise - all with the same exact schema. I need to offload this data into a separate single database so that we can use for other purposes (reporting, web services, ect) with a maximum of 1 hour latency. It should also be noted that these servers are all in the same rack, connected by gigabit connections and that the inserts to the databases are minimal (Avg. 2500 records/hour). The current method is very flakey: The data is currently being replicated (SQL Server Transactional Replication) from each of the 12 servers to a database on another server (yes, 12 different employee tables from 12 different servers into a single employee table on a different server). Every table has a primary key and the rows are unique across all tables (there is a FacilityID in each table). What are my options, these has to be a simple way to do this.

    Read the article

  • Which one is more popular?

    - by atch
    Which of IDE's I'm more likely to meet in an office? Borland or Visual Studio? I wouldn't ask this question here (I could use google and type which is better) only for a reason that in my previous cariere as an engineer I worked (and most of my friends) all the time on AutoCAD not on Microstation even though Microstation had always been better software (stability, conforming to standards, ease of use etc.). Thanks for answers.

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • Replace string in one file with contents of a second file

    - by jag7720
    I have two files: fileA: date >> /root/kvno.out kvno serverXXX\$ >> /root/kvno.out fileB: foobar I need to create a new file, fileC, with the same contents as fileA, except with the string XXX being replaced with the contents of fileB: date >> /root/kvno.out kvno serverfoobar\$ >> /root/kvno.out I'd like to do this using sed. I tried some of the examples I found but I only get the contents of fileB in fileC.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Play and Stop in One button

    - by Ardi
    i'm newbie, i'm tried to make play audio play and stop for 1 button only, but i'm in trouble now. if i touch a button when audio is playing, it doesn't stop, even playing audio again and make a double sound. here's my code public class ProjectisengActivity extends Activity{ ImageButton mainkan; MediaPlayer mp; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.test2); mainkan=(ImageButton)findViewById(R.id.imageButton1); mainkan.setOnClickListener(new OnClickListener(){ @Override public void onClick(View v){ go(); } }); public void go(){ mp=MediaPlayer.create(ProjectisengActivity.this, R.raw.test); if(mp.isPlaying()){ mp.stop(); try { mp.prepare(); } catch (IllegalStateException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } mp.seekTo(0); } else { mp.start(); } i'm create for android 3.0 (HoneyComb) thanks for help

    Read the article

  • select one checkbox from multiple MAIN Checkboxes,disable all other MAIN boxes,n enable child checkbox

    - by harshil
    <input type="checkbox" id="chkMain" /> <input type="checkbox" id="chkMain1" /> <input type="checkbox" id="chkMain2" /> <input class="child" type="checkbox" id="chk1" disabled="true" /> <input class="child" type="checkbox" id="chk2" disabled="true" /> <input class="child" type="checkbox" id="chk3" disabled="true" /> <input class="child" type="checkbox" id="chk4" disabled="true" /> <input class="child" type="checkbox" id="chk5" disabled="true" /> <input class="child" type="checkbox" id="chk6" disabled="true" /> <input class="child" type="checkbox" id="chk7" disabled="true" /> $(function(){ $("input[id^=chkMain]").click ( function() { if( !$(this).is ( ":checked" ) ){ $(".child").attr ( "disabled" , true ); } else{ $(".child").removeAttr ( "disabled" ); } }); }); this enables all the child boxes when either chkMain or chkMain1 or chkMain2 are checked. what i want is: when chkMain is checked the code should disable chkMain1 and chkMain2 but enabling child boxes. or when chkMain1 is checked the code should disable chkMain and chkMain2 but enabling child boxes.

    Read the article

  • Combining multiple lines into one line

    - by mkal
    I have this use case of an xml file with input like Input: <abc a="1"> <val>0.25</val> </abc> <abc a="2"> <val>0.25</val> </abc> <abc a="3"> <val>0.35</val> </abc> ... Output: <abc a="1"><val>0.25</val></abc> <abc a="2"><val>0.25</val></abc> <abc a="3"><val>0.35</val></abc> I have around 200K lines in a file in the Input format, how can I quickly convert this into output format.

    Read the article

  • Microsecond (or one ms) time resolution on an embedded device (Linux Kernel)

    - by ChrisDiRulli
    Hey guys, I have a kernel module I've built that requires at least 1 ms time resolution. I currently use do_gettimeofday() but I'm concerned that this won't work once I move my module to an embedded device. The device has a 180 Mz processor (MIPS) and the default HZ value in the kernel is 100. Thus using jiffies will only give me at best 10 ms resolution. That won't cut it. What I'd like to know is if do_gettimeofday() is based on the timer interrupt (HZ). Can it be guaranteed to provide at least 1 ms of resolution? Thanks!

    Read the article

  • Can one prevent Genshi from parsing HTML entities?

    - by DNS
    I have the following Python code using Genshi (simplified): with open(pathToHTMLFile, 'r') as f: template = MarkupTemplate(f.read()) finalPage = template.generate().render('html', doctype = 'html') The source HTML file contains entities such as &copy;, &trade; and &reg;. Genshi replaces these with their UTF-8 character, which causes problems with the viewer (the output is used as a stand-alone file, not a response to a web request) that eventually sees the resulting HTML. Is there any way to prevent Genshi from parsing these entities? The more common ones like &amp; are passed through just fine.

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >