Search Results

Search found 94938 results on 3798 pages for 'one man army'.

Page 130/3798 | < Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >

  • Which one is more popular?

    - by atch
    Which of IDE's I'm more likely to meet in an office? Borland or Visual Studio? I wouldn't ask this question here (I could use google and type which is better) only for a reason that in my previous cariere as an engineer I worked (and most of my friends) all the time on AutoCAD not on Microstation even though Microstation had always been better software (stability, conforming to standards, ease of use etc.). Thanks for answers.

    Read the article

  • Params order in Foo.new(params[:foo]), need one before the other (Rails)

    - by Jeena
    I have a problem which I don't know how to fix. It has to do with the unsorted params hash. I have a object Reservation which has a virtual time= attribute and a virtual eating_session= attribute when I set the time= I also want to validate it via an external server request. I do that with help of the method times() which makes a lookup on a other server and saves all possible times in the @times variable. The problem now is that the method times() needs the eating_session attribute to find out which times are valid, but rails sometimes calls the times= method first, before there is any eating_session in the Reservation object when I just do @reservation = Reservation.new(params[:reservation]) class ReservationsController < ApplicationController def new @reservation = Reservation.new(params[:reservation]) # ... end end class Reservation < ActiveRecord::Base include SoapClient attr_accessor :date, :time belongs_to :eating_session def time=(time) @time = times.find { |t| t[:time] == time } end def times return @times if defined? @times @times = [] response = call_soap :search_availability { # eating_session is sometimes nil :session_id => eating_session.code, # <- HERE IS THE PROBLEM :dining_date => date } response[:result].each do |result| @times << { :time => "#{DateTime.parse(result[:time]).strftime("%H:%M")}", :correlation_data => result[:correlation_data] } end @times end end I have no idea how to fix this, any help is apriciated.

    Read the article

  • Consolidate data from many different databases into one with minimum latency

    - by NTDLS
    I have 12 databases totaling roughly 1.0TB, each on a different physical server running SQL 2005 Enterprise - all with the same exact schema. I need to offload this data into a separate single database so that we can use for other purposes (reporting, web services, ect) with a maximum of 1 hour latency. It should also be noted that these servers are all in the same rack, connected by gigabit connections and that the inserts to the databases are minimal (Avg. 2500 records/hour). The current method is very flakey: The data is currently being replicated (SQL Server Transactional Replication) from each of the 12 servers to a database on another server (yes, 12 different employee tables from 12 different servers into a single employee table on a different server). Every table has a primary key and the rows are unique across all tables (there is a FacilityID in each table). What are my options, these has to be a simple way to do this.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Play and Stop in One button

    - by Ardi
    i'm newbie, i'm tried to make play audio play and stop for 1 button only, but i'm in trouble now. if i touch a button when audio is playing, it doesn't stop, even playing audio again and make a double sound. here's my code public class ProjectisengActivity extends Activity{ ImageButton mainkan; MediaPlayer mp; /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.test2); mainkan=(ImageButton)findViewById(R.id.imageButton1); mainkan.setOnClickListener(new OnClickListener(){ @Override public void onClick(View v){ go(); } }); public void go(){ mp=MediaPlayer.create(ProjectisengActivity.this, R.raw.test); if(mp.isPlaying()){ mp.stop(); try { mp.prepare(); } catch (IllegalStateException e) { // TODO Auto-generated catch block e.printStackTrace(); } catch (IOException e) { // TODO Auto-generated catch block e.printStackTrace(); } mp.seekTo(0); } else { mp.start(); } i'm create for android 3.0 (HoneyComb) thanks for help

    Read the article

  • select one checkbox from multiple MAIN Checkboxes,disable all other MAIN boxes,n enable child checkbox

    - by harshil
    <input type="checkbox" id="chkMain" /> <input type="checkbox" id="chkMain1" /> <input type="checkbox" id="chkMain2" /> <input class="child" type="checkbox" id="chk1" disabled="true" /> <input class="child" type="checkbox" id="chk2" disabled="true" /> <input class="child" type="checkbox" id="chk3" disabled="true" /> <input class="child" type="checkbox" id="chk4" disabled="true" /> <input class="child" type="checkbox" id="chk5" disabled="true" /> <input class="child" type="checkbox" id="chk6" disabled="true" /> <input class="child" type="checkbox" id="chk7" disabled="true" /> $(function(){ $("input[id^=chkMain]").click ( function() { if( !$(this).is ( ":checked" ) ){ $(".child").attr ( "disabled" , true ); } else{ $(".child").removeAttr ( "disabled" ); } }); }); this enables all the child boxes when either chkMain or chkMain1 or chkMain2 are checked. what i want is: when chkMain is checked the code should disable chkMain1 and chkMain2 but enabling child boxes. or when chkMain1 is checked the code should disable chkMain and chkMain2 but enabling child boxes.

    Read the article

  • Combining multiple lines into one line

    - by mkal
    I have this use case of an xml file with input like Input: <abc a="1"> <val>0.25</val> </abc> <abc a="2"> <val>0.25</val> </abc> <abc a="3"> <val>0.35</val> </abc> ... Output: <abc a="1"><val>0.25</val></abc> <abc a="2"><val>0.25</val></abc> <abc a="3"><val>0.35</val></abc> I have around 200K lines in a file in the Input format, how can I quickly convert this into output format.

    Read the article

  • Microsecond (or one ms) time resolution on an embedded device (Linux Kernel)

    - by ChrisDiRulli
    Hey guys, I have a kernel module I've built that requires at least 1 ms time resolution. I currently use do_gettimeofday() but I'm concerned that this won't work once I move my module to an embedded device. The device has a 180 Mz processor (MIPS) and the default HZ value in the kernel is 100. Thus using jiffies will only give me at best 10 ms resolution. That won't cut it. What I'd like to know is if do_gettimeofday() is based on the timer interrupt (HZ). Can it be guaranteed to provide at least 1 ms of resolution? Thanks!

    Read the article

  • Can one prevent Genshi from parsing HTML entities?

    - by DNS
    I have the following Python code using Genshi (simplified): with open(pathToHTMLFile, 'r') as f: template = MarkupTemplate(f.read()) finalPage = template.generate().render('html', doctype = 'html') The source HTML file contains entities such as &copy;, &trade; and &reg;. Genshi replaces these with their UTF-8 character, which causes problems with the viewer (the output is used as a stand-alone file, not a response to a web request) that eventually sees the resulting HTML. Is there any way to prevent Genshi from parsing these entities? The more common ones like &amp; are passed through just fine.

    Read the article

  • Skipping one item in the column

    - by zurna
    I created a simple news website. I store both videos and images in IMAGES table. Videos added have videos and images added have images stored in a column called ImagesType. Images and Videos attached to a news is stored in ImagesID column of the NEWS table. My problem occurs when I need to display the first image of a news. i.e. IMAGES table: ImagesID ImagesLgURL ImagesType 1 /FLPM/media/videos/0H7T9C0F.flv videos 2 /FLPM/media/images/8R5D7M8O.jpg images 3 /FLPM/media/images/0E7Q9Z0C.jpg images NEWS table NewsID ImagesID NewsTitle 1 1;2; Street Chic: Paris ERROR 2 3; Paris Runway NO ERROR The following code give me an error with the 2nd news item because the first ImageID stored in the list is not an image but a video. I need to figure out a way to skip the video item and display the next image. I hope I made sense. SQL = "SELECT NEWSID, CATEGORIESID, IMAGESID, NEWSTITLE, NEWSSHORTDESC, NEWSACTIVE, NEWSDATEENTERED" SQL = SQL & " FROM NEWS N" SQL = SQL & " WHERE NEWSACTIVE = 1" SQL = SQL & " ORDER BY NEWSDATEENTERED DESC" Set objNews = objConn.Execute(SQL) Do While intLooper1 <= 3 And Not objNews.EOF IMAGES = Split(Left(objNews("IMAGESID"),Len(objNews("IMAGESID"))-1), ";") SQL = "SELECT ImagesID, ImagesName, ImagesLgURL, ImagesSmURL, ImagesType" SQL = SQL & " FROM IMAGES I" SQL = SQL & " WHERE ImagesID = " & IMAGES(0) & " AND ImagesType = 'images'" Set objLgImage = objConn.Execute(SQL) <div> <a href="?Section=news&SubSection=redirect&NEWSID=<%=objNews("NEWSID")%>"> <img src="<%=objLgImage("ImagesLgURL")%>" alt="<%=objLgImage("ImagesName")%>" /> </a> </div> <% objLgImage.Close Set objLgImage = Nothing intLooper1 = intLooper1 + 1 objNews.MoveNext Loop %>

    Read the article

  • Regex not working in one case

    - by Arnej65
    I have a string with the following information. Obabikon, ON 49°10'N 94°10’W 2278 km N69°W I have a regex search as follows: String LongPattern = @"(~)?([0-9\?])+°([0-9\?])*'[EWO]"; return FindPattern(source, LongPattern); It should be finding the <94°10’W But is it not. This regex is working for the rest of my data with out any problems. Any clues?

    Read the article

  • MonoRail - Select parent category from one dropdown, show child category dropdown

    - by Justin
    Hey, I'm new to MonoRail and am trying to figure out how to have it so that I can select a parent category in a dropdown then have it show a second dropdown with the categories that are children of the parent. If I were using what I'm used to, ASP.NET MVC, I would have a javascript function that would be called onchange of the first dropdown and would make an ajax call to a controller method (passing in the selected parent category id) that would grab all child categories of that parent category and return them in JSON. Then in the callback javascript function I would eval the JSON and populate the second dropdown with the child categories. How would I do this using MonoRail/jQuery? Here's the code I have so far: $FormHelper.Select("business.category.id", $categories, "%{value='id', text='name', firstoption='Select a Category'}") $FormHelper.Select("business.category.id", $childCategories, "%{value='id', text='name', firstoption='Select a Sub-Category'}") Then in BusinessController.cs: private void AddDataToModels() { PropertyBag["categories"] = CategoryRepository.GetParentCategories(); PropertyBag["childCategories"] = CategoryRepository.GetChildCategories(1); } Thanks for any input on how to approach this! Justin

    Read the article

  • How do I extract a postcode from one column in SSIS using regular expression

    - by Aphillippe
    I'm trying to use a custom regex clean transformation (information found here ) to extract a post code from a mixed address column (Address3) and move it to a new column (Post Code) Example of incoming data: Address3: "London W12 9LZ" Incoming data could be any combination of place names with a post code at the start, middle or end (or not at all). Desired outcome: Address3: "London" Post Code: "W12 9LZ" Essentially, in plain english, "move (not copy) any post code found from address3 into Post Code". My regex skills aren't brilliant but I've managed to get as far as extracting the post code and getting it into its own column using the following regex, matching from Address3 and replacing into Post Code: Match Expression: (?<stringOUT>([A-PR-UWYZa-pr-uwyz]([0-9]{1,2}|([A-HK-Ya-hk-y][0-9]|[A-HK-Ya-hk-y][0-9] ([0-9]|[ABEHMNPRV-Yabehmnprv-y]))|[0-9][A-HJKS-UWa-hjks-uw])\ {0,1}[0-9][ABD-HJLNP-UW-Zabd-hjlnp-uw-z]{2}|([Gg][Ii][Rr]\ 0[Aa][Aa])|([Ss][Aa][Nn]\ {0,1}[Tt][Aa]1)|([Bb][Ff][Pp][Oo]\ {0,1}([Cc]\/[Oo]\ )?[0-9]{1,4})|(([Aa][Ss][Cc][Nn]|[Bb][Bb][Nn][Dd]|[BFSbfs][Ii][Qq][Qq]|[Pp][Cc][Rr][Nn]|[Ss][Tt][Hh][Ll]|[Tt][Dd][Cc][Uu]|[Tt][Kk][Cc][Aa])\ {0,1}1[Zz][Zz]))) Replace Expression: ${stringOUT} So this leaves me with: Address3: "London W12 9LZ" Post Code: "W12 9LZ" My next thought is to keep the above match/replace, then add another to match anything that doesn't match the above regex. I think it might be a negative lookahead but I can't seem to make it work. I'm using SSIS 2008 R2 and I think the regex clean transformation uses .net regex implementation. Thanks.

    Read the article

  • How does one save cookies in HTTP Builder 0.5.0/HTTPClient

    - by Misha Koshelev
    I am trying per instructions here: http://www.innovation.ch/java/HTTPClient/advanced_info.html However, if I am using HTTP Builder, the following lines System.setProperty("HTTPClient.cookies.save","true") System.setProperty("HTTPClient.cookies.jar","/home/misha/.httpclient_cookies") do not seem to create a file: ~/.httpclient_cookies I will post a solution as always when figure it out. :) Misha

    Read the article

  • Convert an array of bytes into one decimal number as a string

    - by Martin Kirsche
    I'm trying to write function that converts an arbitrary large array of bytes (larger than 64-bit) into a decimal number represented as string in c# and I simply can't figure out how to do it. For example the following code ... Console.WriteLine(ConvertToString( new byte[] { 0x11, 0x22, 0x33, 0x44, 0x55, 0x66, 0x77, 0x88, 0x99, 0xAA, 0xBB, 0xCC, 0xDD, 0xEE, 0xFF, 0x00 })); .. should print out 22774453838368691933757882222884355840 I don't want to just use an extra library like biginteger for that, because I want it to be simple and like to understand how it works.

    Read the article

  • How one extends JNA interface mappings? (Java)

    - by rukoche
    User32 interface (platform library) is missing some WinAPI functions, so I tried extending it: package myapp import com.sun.jna.platform.win32.W32API public interface User32 extends com.sun.jna.platform.win32.User32 { myapp.User32 INSTANCE boolean IsWindow(W32API.HWND hWnd) } But then calling myapp.User32.INSTANCE.FindWindow(..) results in java.lang.NullPointerException: Cannot invoke method FindWindow() on null object

    Read the article

  • PHP: Array of objects is empty when I come to retrieve one from the array

    - by Tom
    Good morning, I am trying to load rows from a database and then create objects from them and add these objects to a private array. Here are my classes: <?php include("databaseconnect.php"); class stationItem { private $code = ''; private $description = ''; public function setCode($code ){ $this->code = $code; } public function getCode(){ return $this->code; } public function setDescription($description){ $this->description = $description; } public function getDescription(){ return $this->description; } } class stationList { private $stationListing; function __construct() { connect(); $stationListing = array(); $result = mysql_query('SELECT * FROM stations'); while ($row = mysql_fetch_assoc($result)) { $station = new stationItem(); $station->setCode($row['code']); $station->setDescription($row['description']); array_push($stationListing, $station); } mysql_free_result($result); } public function getStation($index){ return $stationListing[$index]; } } ?> As you can see I am creating a stationItem object per database row (which for now has a code and description) and I then push these on to the end of my array which is held as a private variable in stationList. This is code which creates this classes and attempts to access the properties on them: $stations = new stationList(); $station = $stations->getStation(0); echo $station->getCode(); I am finding that the sizeof($stationList) at the end of the constructor is 1 but then it is zero when we come to try to get an object from the array using the index. Therefore the error that I get is: Fatal error: Call to a member function getCode() on a non-object Please can someone explain to me why this is happening? I guess I am misunderstanding how object references work in PHP5.

    Read the article

  • Handling one-to-many relationship with ZF partialLoop

    - by snaken
    Lets say i'm listing musical artists, each artist has basic information like Name, Age etc. stored in an artist table. They also have entries in an Albums table (album name/album cover etc), referencing the artist table using the artist id as a foreign key. I have the Model_Artist (Artist.php) file: class Model_Artist extends Zend_Db_Table_Abstract { protected $_name = 'artist'; protected $_dependentTables = array('Model_ArtistAlbums'); public function fetchArtistss() { $select = $this->select(); return $this->fetchAll($select); } } and to the Model_ArtistAlbums (ArtistAlbums.php) file class Model_ArtistAlbums extends Zend_Db_Table_Abstract { protected $_name = 'albums'; protected $_referenceMap = array( 'Artists' => array( 'columns' => 'alb_art_id', 'refTableClass' => 'Model_Artist', 'refColumns' => 'art_id' ) ); // etc } in my controller: public function indexAction() { /* THIS WORKS $art = new Model_Artist(); $artRowset = $art->find(1); $art1 = $artRowset->current(); $artalbums = $art1->findDependentRowset('Model_ArtistAlbums'); foreach($artalbums as $album){ echo $album->alb_title."<br>"; } */ $arts = new Model_Artist(); $this->view->artists = $arts->fetchArtists(); } in the view file: $this->partial()->setObjectKey('artist'); echo $this->partialLoop('admin/list-artists.phtml', $this->artists); but with this code in artists/list-artists.phtml: foreach($this->artist->findDependentRowset('albums') as $album): // other stuff endforeach; i get this error: Fatal error: Call to a member function findDependentRowset() on a non-object A var_dump of $this->artist = NULL.

    Read the article

< Previous Page | 126 127 128 129 130 131 132 133 134 135 136 137  | Next Page >