Search Results

Search found 13628 results on 546 pages for 'python datamodel'.

Page 135/546 | < Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >

  • How to read a csv file with python

    - by john
    Hello, I'm trying to read a csv file but it doesn't work. I can read my csv file but when I see what I read, there where white space between values. Here is my code # -*- coding: iso-8859-1 -*- import sql_db, tmpl_macros, os import security, form, common import csv class windows_dialect(csv.Dialect): """Describe the usual properties of unix-generated CSV files.""" delimiter = ',' quotechar = '"' doublequote = 1 skipinitialspace = 0 lineterminator = 'n' quoting = csv.QUOTE_MINIMAL def reco(d): cars = {210:'"', 211:'"', 213:"'", 136:'à', 143:'è', 142:'é'} for c in cars: d = d.replace(chr(c),cars[c]) return d def page_process(ctx): if ctx.req_equals('catalog_send'): if 'catalog_file' in ctx.locals.__dict__: contenu = ctx.locals.catalog_file[0].file.read() #contenu.encode('') p = csv.reader(contenu, delimiter=',') inserted = 0 modified = 0 (cr,db) = sql_db.cursor_get() for line in p: if line: logfile = open('/tmp/test.log', 'a') logfile.write(line[0]) logfile.write('\n') logfile.write('-----------------------------\n') logfile.close()

    Read the article

  • feedparser fails during script run, but can't reproduce in interactive python console

    - by Rhubarb
    It's failing with this when I run eclipse or when I run my script in iPython: 'ascii' codec can't decode byte 0xe2 in position 32: ordinal not in range(128) I don't know why, but when I simply execute the feedparse.parse(url) statement using the same url, there is no error thrown. This is stumping me big time. The code is as simple as: try: d = feedparser.parse(url) except Exception, e: logging.error('Error while retrieving feed.') logging.error(e) logging.error(formatExceptionInfo(None)) logging.error(formatExceptionInfo1()) Here is the stack trace: d = feedparser.parse(url) File "C:\Python26\lib\site-packages\feedparser.py", line 2623, in parse feedparser.feed(data) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 143, in goahead k = self.parse_endtag(i) File "C:\Python26\lib\sgmllib.py", line 320, in parse_endtag self.finish_endtag(tag) File "C:\Python26\lib\sgmllib.py", line 360, in finish_endtag self.unknown_endtag(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 476, in unknown_endtag method() File "C:\Python26\lib\site-packages\feedparser.py", line 1318, in _end_content value = self.popContent('content') File "C:\Python26\lib\site-packages\feedparser.py", line 700, in popContent value = self.pop(tag) File "C:\Python26\lib\site-packages\feedparser.py", line 641, in pop output = _resolveRelativeURIs(output, self.baseuri, self.encoding) File "C:\Python26\lib\site-packages\feedparser.py", line 1594, in _resolveRelativeURIs p.feed(htmlSource) File "C:\Python26\lib\site-packages\feedparser.py", line 1441, in feed sgmllib.SGMLParser.feed(self, data) File "C:\Python26\lib\sgmllib.py", line 104, in feed self.goahead(0) File "C:\Python26\lib\sgmllib.py", line 138, in goahead k = self.parse_starttag(i) File "C:\Python26\lib\sgmllib.py", line 296, in parse_starttag self.finish_starttag(tag, attrs) File "C:\Python26\lib\sgmllib.py", line 338, in finish_starttag self.unknown_starttag(tag, attrs) File "C:\Python26\lib\site-packages\feedparser.py", line 1588, in unknown_starttag attrs = [(key, ((tag, key) in self.relative_uris) and self.resolveURI(value) or value) for key, value in attrs] File "C:\Python26\lib\site-packages\feedparser.py", line 1584, in resolveURI return _urljoin(self.baseuri, uri) File "C:\Python26\lib\site-packages\feedparser.py", line 286, in _urljoin return urlparse.urljoin(base, uri) File "C:\Python26\lib\urlparse.py", line 215, in urljoin params, query, fragment)) File "C:\Python26\lib\urlparse.py", line 184, in urlunparse return urlunsplit((scheme, netloc, url, query, fragment)) File "C:\Python26\lib\urlparse.py", line 192, in urlunsplit url = scheme + ':' + url File "C:\Python26\lib\encodings\cp1252.py", line 15, in decode return codecs.charmap_decode(input,errors,decoding_table)

    Read the article

  • Can't get MySQL source query to work using Python mysqldb module

    - by Chris
    I have the following lines of code: sql = "source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql" cursor.execute (sql) When I execute my program, I get the following error: Error 1064: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'source C:\My Dropbox\workspace\projects\hosted_inv\create_site_db.sql' at line 1 Now I can copy and past the following into mysql as a query: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql And it works perfect. When I check the query log for the query executed by my script, it shows that my query was the following: source C:\\My Dropbox\\workspace\\projects\\hosted_inv\\create_site_db.sql However, when I manually paste it in and execute, the entire create_site_db.sql gets expanded in the query log and it shows all the sql queries in that file. Am I missing something here on how mysqldb does queries? Am I running into a limitation. My goal is to run a sql script to create the schema structure, but I don't want to have to call mysql in a shell process to source the sql file. Any thoughts? Thanks!

    Read the article

  • Python metaclass for enforcing immutability of custom types

    - by Mark Lehmacher
    Having searched for a way to enforce immutability of custom types and not having found a satisfactory answer I came up with my own shot at a solution in form of a metaclass: class ImmutableTypeException( Exception ): pass class Immutable( type ): ''' Enforce some aspects of the immutability contract for new-style classes: - attributes must not be created, modified or deleted after object construction - immutable types must implement __eq__ and __hash__ ''' def __new__( meta, classname, bases, classDict ): instance = type.__new__( meta, classname, bases, classDict ) # Make sure __eq__ and __hash__ have been implemented by the immutable type. # In the case of __hash__ also make sure the object default implementation has been overridden. # TODO: the check for eq and hash functions could probably be done more directly and thus more efficiently # (hasattr does not seem to traverse the type hierarchy) if not '__eq__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __eq__.' ) if not '__hash__' in dir( instance ): raise ImmutableTypeException( 'Immutable types must implement __hash__.' ) if _methodFromObjectType( instance.__hash__ ): raise ImmutableTypeException( 'Immutable types must override object.__hash__.' ) instance.__setattr__ = _setattr instance.__delattr__ = _delattr return instance def __call__( self, *args, **kwargs ): obj = type.__call__( self, *args, **kwargs ) obj.__immutable__ = True return obj def _setattr( self, attr, value ): if '__immutable__' in self.__dict__ and self.__immutable__: raise AttributeError( "'%s' must not be modified because '%s' is immutable" % ( attr, self ) ) object.__setattr__( self, attr, value ) def _delattr( self, attr ): raise AttributeError( "'%s' must not be deleted because '%s' is immutable" % ( attr, self ) ) def _methodFromObjectType( method ): ''' Return True if the given method has been defined by object, False otherwise. ''' try: # TODO: Are we exploiting an implementation detail here? Find better solution! return isinstance( method.__objclass__, object ) except: return False However, while the general approach seems to be working rather well there are still some iffy implementation details (also see TODO comments in code): How do I check if a particular method has been implemented anywhere in the type hierarchy? How do I check which type is the origin of a method declaration (i.e. as part of which type a method has been defined)?

    Read the article

  • use doctest and logging in python program

    - by Luke
    #!/usr/bin/python2.4 import logging import sys import doctest def foo(x): """ foo (0) 0 """ print ("%d" %(x)) _logger.debug("%d" %(x)) def _test(): doctest.testmod() _logger = logging.getLogger() _logger.setLevel(logging.DEBUG) _formatter = logging.Formatter('%(message)s') _handler = logging.StreamHandler(sys.stdout) _handler.setFormatter(_formatter) _logger.addHandler(_handler) _test() I would like to use logger module for all of my print statements. I have looked at the first 50 top google links for this, and they seem to agree that doctest uses it's own copy of the stdout. If print is used it works if logger is used it logs to the root console. Can someone please demonstrate a working example with a code snippet that will allow me to combine. Note running nose to test doctest will just append the log output at the end of the test, (assuming you set the switches) it does not treat them as a print statement.

    Read the article

  • Python fit polynomial, power law and exponential from data

    - by Nadir
    I have some data (x and y coordinates) coming from a study and I have to plot them and to find the best curve that fits data. My curves are: polynomial up to 6th degree; power law; and exponential. I am able to find the best fit for polynomial with while(i < 6): coefs, val = poly.polyfit(x, y, i, full=True) and I take the degree that minimizes val. When I have to fit a power law (the most probable in my study), I do not know how to do it correctly. This is what I have done. I have applied the log function to all x and y and I have tried to fit it with a linear polynomial. If the error (val) is lower than the others polynomial tried before, I have chosen the power law function. Am I correct? Now how can I reconstruct my power law starting from the line y = mx + q in order to draw it with the original points? I need also to display the function found. I have tried with: def power_law(x, m, q): return q * (x**m) using x_new = np.linspace(x[0], x[-1], num=len(x)*10) y1 = power_law(x_new, coefs[0], coefs[1]) popt, pcov = curve_fit(power_law, x_new, y1) but it seems not to work well.

    Read the article

  • Python dealing with dates and times

    - by randombits
    I'm looking for a solution to the following: Given today's date, figure out what month was before. So 2 should return for today, since it is currently March, the third month of the year. 12 should return for January. Then based on that, I need to be able to iterate through a directory and find all files that were created that month. Bonus points would include finding the most current file created for the previous month.

    Read the article

  • Errno socket error in python

    - by Emma
    i wrote this code : import random import sys import urllib openfile = open(sys.argv[1]).readlines() c = random.choice(openfile) i = 0 while i < 5: i=i+1 c = random.choice(openfile) proxies = {'http': c} opener = urllib.FancyURLopener(proxies).open("http://whatismyip.com.au/").read() ::: I put 3 proxy in a txt file . : http://211.161.159.74:8080 http://119.70.40.101:8080 http://124.42.10.119:8080 but when execute it i get this error : IOError: [Errno socket error] (10054, 'Connection reset by peer') what am i going to do ? please help me .

    Read the article

  • Shared value in parallel python

    - by Jonathan
    Hey all- I'm using ParallelPython to develop a performance-critical script. I'd like to share one value between the 8 processes running on the system. Please excuse the trivial example but this illustrates my question. def findMin(listOfElements): for el in listOfElements: if el < min: min = el import pp min = 0 myList = range(100000) job_server = pp.Server() f1 = job_server.submit(findMin, myList[0:25000]) f2 = job_server.submit(findMin, myList[25000:50000]) f3 = job_server.submit(findMin, myList[50000:75000]) f4 = job_server.submit(findMin, myList[75000:100000]) The pp docs don't seem to describe a way to share data across processes. Is it possible? If so, is there a standard locking mechanism (like in the threading module) to confirm that only one update is done at a time? l = Lock() if(el < min): l.acquire if(el < min): min = el l.release I understand I could keep a local min and compare the 4 in the main thread once returned, but by sharing the value I can do some better pruning of my BFS binary tree and potentially save a lot of loop iterations. Thanks- Jonathan

    Read the article

  • recursively implementing 'minimum number of coins' in python

    - by user5198
    This problem is same as asked in here. Given a list of coins, their values (c1, c2, c3, ... cj, ...), and the total sum i. Find the minimum number of coins the sum of which is i (we can use as many coins of one type as we want), or report that it's not possible to select coins in such a way that they sum up to S. I"m just introduced to dynamic programming yesterday and I tried to make a code for it. # Optimal substructure: C[i] = 1 + min_j(C[i-cj]) cdict = {} def C(i, coins): if i <= 0: return 0 if i in cdict: return cdict[i] else: answer = 1 + min([C(i - cj, coins) for cj in coins]) cdict[i] = answer return answer Here, C[i] is the optimal solution for amount of money 'i'. And available coins are {c1, c2, ... , cj, ...} for the program, I've increased the recursion limit to avoid maximum recursion depth exceeded error. But, this program gives the right answer only someones and when a solution is not possible, it doesn't indicate that. What is wrong with my code and how to correct it?

    Read the article

  • read a binary file (python)

    - by beratch
    Hi, I cant read a file, and I dont understand why: f = open("test/test.pdf", "r") data = list(f.read()) print data Returns : [] I would like to open a PDF, and extract every bytes, and put it in a List. What's wrong with my code ? :( Thanks,

    Read the article

  • Opening SSL URLs with Python

    - by RadiantHex
    Hi folks, I'm using mechanize to navigate pages, it works pretty well. Unfortunately I have a random error come up, by random I mean it occasionally appears. URLError at /test/ urlopen error [Errno 1] _ssl.c:1325: error:140943FC:SSL routines:SSL3_READ_BYTES:sslv3 alert bad record mac I really need help on this one :) any ideas?

    Read the article

  • Documenting module/class/function bodies in python sphinx docs

    - by perrierism
    Is there a way with Sphinx documentation to output a function or class body (the code itself) with the autodoc feature? I'm using autodoc to much success. In addition to the docstrings getting pulled in to the documentation I want like a link to click for each function where it will show you the source... is that possible? This is about what most of my documentation looks like now: .. module:`foo.mymodule` Title =================== .. automodule:: foo.mymodule .. autoclass:: MyModulesClass :members: :undoc-members:

    Read the article

  • Common Pitfalls in Python

    - by Anurag Uniyal
    Today I was bitten again by "Mutable default arguments" after many years. I usually don't use mutable default arguments unless needed but I think with time I forgot about that, and today in the application I added tocElements=[] in a pdf generation function's argument list and now 'Table of Content' gets longer and longer after each invocation of "generate pdf" :) My question is what other things should I add to my list of things to MUST avoid? Mutable default arguments Import modules always same way e.g. from y import x and import x are different things, they are treated as different modules. Do not use range in place of lists because range() will become an iterator anyway, the following will fail: myIndexList = [0,1,3] isListSorted = myIndexList == range(3) # will fail in 3.0 isListSorted = myIndexList == list(range(3)) # will not same thing can be mistakenly done with xrange: `myIndexList == xrange(3)`. Catching multiple exceptions try: raise KeyError("hmm bug") except KeyError,TypeError: print TypeError It prints "hmm bug", though it is not a bug, it looks like we are catching exceptions of type KeyError,TypeError but instead we are catching KeyError only as variable TypeError, use this instead: try: raise KeyError("hmm bug") except (KeyError,TypeError): print TypeError

    Read the article

  • Python - urllib2 & cookielib

    - by Adrian
    I am trying to open the following website and retrieve the initial cookie and use it for the second url-open BUT if you run the following code it outputs 2 different cookies. How do I use the initial cookie for the second url-open? import cookielib, urllib2 cj = cookielib.CookieJar() opener = urllib2.build_opener(urllib2.HTTPCookieProcessor(cj)) home = opener.open('https://www.idcourts.us/repository/start.do') print cj search = opener.open('https://www.idcourts.us/repository/partySearch.do') print cj Output shows 2 different cookies every time as you can see: <cookielib.CookieJar[<Cookie JSESSIONID=0DEEE8331DE7D0DFDC22E860E065085F for www.idcourts.us/repository>]> <cookielib.CookieJar[<Cookie JSESSIONID=E01C2BE8323632A32DA467F8A9B22A51 for www.idcourts.us/repository>]>

    Read the article

  • removing pairs of elements from numpy arrays that are NaN (or another value) in Python

    - by user248237
    I have an array with two columns in numpy. For example: a = array([[1, 5, nan, 6], [10, 6, 6, nan]]) a = transpose(a) I want to efficiently iterate through the two columns, a[:, 0] and a[:, 1] and remove any pairs that meet a certain condition, in this case if they are NaN. The obvious way I can think of is: new_a = [] for val1, val2 in a: if val2 == nan or val2 == nan: new_a.append([val1, val2]) But that seems clunky. What's the pythonic numpy way of doing this? thanks.

    Read the article

  • Convert alphabet letters to number in python

    - by altin
    Can someone help me finish this characters = ['a''b''c''d''e''f''g''h''i''j''k''l''m''n''o''p''q''r''t''u''v''w''x''y''z'] numbers = ['1''2''3''4''5''6''7''8''9''10''11''12''13''14''15''16''17''18''19''20''21''22''23''24'] text = raw_input(' Write text: ') Ive tryed to many ways but couldnt get to the pint, I want to make exc if i type hello the output to be in numbers lined like in alphabet... example a = 1 < in alphabet Can anyone give ideas ? or help sth ?

    Read the article

  • Listing all possible values for SOAP enumeration with Python SUDS

    - by bdk
    I'm connecting with a SUDS client to a SOAP Server whose wsdl contains manu enumerations like the following: </simpleType> <simpleType name="FOOENUMERATION"> <restriction base="xsd:string"> <enumeration value="ALPHA"><!-- enum const = 0 --> <enumeration value="BETA"/><!-- enum const = 1 --> <enumeration value="GAMMA"/><!-- enum const = 2 --> <enumeration value="DELTA"/><!-- enum const = 3 --> </restriction> </simpleType> In my client I am receiving sequences which contain elements of these various enumeration types. My need is that given a member variable, I need to know all possible enumeration values. Basically I need a function which takes an instance of one of these enums and returns a list of strings which are all the possible values. When I have an instance, running: print type(foo.enumInstance) I get: <class 'suds.sax.text.Text'> I'm not sure how to get the actual simpleType name from this, and then get the possible values from that short of parsing the WSDL myself.

    Read the article

  • Python web scraping involving HTML tags with attributes

    - by rohanbk
    I'm trying to make a web scraper that will parse a web-page of publications and extract the authors. The skeletal structure of the web-page is the following: <html> <body> <div id="container"> <div id="contents"> <table> <tbody> <tr> <td class="author">####I want whatever is located here ###</td> </tr> </tbody> </table> </div> </div> </body> </html> I've been trying to use BeautifulSoup and lxml thus far to accomplish this task, but I'm not sure how to handle the two div tags and td tag because they have attributes. In addition to this, I'm not sure whether I should rely more on BeautifulSoup or lxml or a combination of both. What should I do? At the moment, my code looks like what is below: import re import urllib2,sys import lxml from lxml import etree from lxml.html.soupparser import fromstring from lxml.etree import tostring from lxml.cssselect import CSSSelector from BeautifulSoup import BeautifulSoup, NavigableString address='http://www.example.com/' html = urllib2.urlopen(address).read() soup = BeautifulSoup(html) html=soup.prettify() html=html.replace('&nbsp', '&#160') html=html.replace('&iacute','&#237') root=fromstring(html) I realize that a lot of the import statements may be redundant, but I just copied whatever I currently had in more source file. EDIT: I suppose that I didn't make this quite clear, but I have multiple tags in page that I want to scrape.

    Read the article

  • Python TKinter connect variable to entry widget

    - by Sano98
    Hi everyone, I'm trying to associate a variable with a Tkinter entry widget, in a way that: Whenever I change the value (the "content") of the entry, mainly by typing something into it, the variable automatically gets assigned the value of what I've typed. Without me having to push a button "Update value " or something like that first. Whenever the variable gets changed (by some other part of the programm), I want the entry value displayed to be adjusted automatically. I believe that this could work via the textvariable. I read the example on http://effbot.org/tkinterbook/entry.htm, but it is not exactly helping me for what I have in mind. I have a feeling that there is a way of ensuring the first condition with using entry's "validate". Any ideas? Thank you for your input! Sano

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Python learner needs help spotting an error

    - by Protean
    This piece of code gives a syntax error at the colon of "elif process.loop(i, len(list_i) != 'repeat':" and I can't seem to figure out why. class process: def loop(v1, v2): if v1 < v2 - 1: return 'repeat' def isel(chr_i, list_i): for i in range(len(list_i)): if chr_i == list_i[i]: return list_i[i] elif process.loop(i, len(list_i) != 'repeat': return 'error'()

    Read the article

< Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >