Search Results

Search found 11010 results on 441 pages for 'txt record'.

Page 137/441 | < Previous Page | 133 134 135 136 137 138 139 140 141 142 143 144  | Next Page >

  • SOM Algorithm Matlab HELP

    - by Tim
    I'm trying to pass a txt file to som_read_data from a GUI......i created a function that takes a txt file from the GUI and then passes it to som_read_data..but i'm getting some errors...here are a list of some of the errors.....any one with ideas? ??? Error using ==> ftell Invalid file identifier. Use fopen to generate a valid file identifier. Error in ==> som_read_data at 169 fpos1 = ftell(fid); c1 = 0; % read first non-comment line Error in ==> prog_som at 3 sD = som_read_data(m);

    Read the article

  • Team Build MSBuild Task Does Not Update Main Build Log File

    - by NotMyself
    I have an after build event in my main TFSBuild.proj file that uses the MSBuild task to call a deployment task after a successful build. It looks like this: <ItemGroup> <DeploymentTargets Include="..\Sources\Build\SkunkWorks.Build.Deployment.targets"> <Properties></Properties> </DeploymentTargets> </ItemGroup> <Target Name="AfterBuild"> <Message Text="Executing Deployment"/> <MSBuild Projects="@(DeploymentTargets)" Properties="PickUpLocation='@(DropLocation)'" ContinueOnError="false"/> </Target> This works fine and the deployment script is called as you would expect. The problem is that any errors or messages produced by executing the MSBuild are not written to the BuildLog.txt or ErrorsAndWarnings.txt files that are placed in the drop location after a successful build. Is there an easy way to capture this information?

    Read the article

  • Listening to the iPhone mic with SCListener and playing music at the same time: how?

    - by Eamon Ford
    Hello, I am using Stephen Celis' SCListener class (for iPhone) to "listen" from the microphone, but I also need to be playing music at the same time using the MediaPlayer framework. However, when I start listening with SCListener, the music fades out and stops. I have set the kAudioSessionCategory_PlayAndRecord property on the audio session in SCListener, which should allow me to play audio and record audio at the same time, but as far as I can tell it has no effect. I'm confused, because according to other developers' results, this works just fine, but not for me. I'm thinking maybe the kAudioSessionCategory_PlayAndRecord property allows you to play sound and record if you're using the AVAudioPlayer framework or something to play the sound, but maybe not the MediaPlayer framework? This would be a problem for me because I need to play music from the user's iPod library, which, as far as I know is only possible to do using the MediaPlayer framework. Does anyone know how I can get around this problem? Thanks in advance!

    Read the article

  • TVirtualStringTree - resetting non-visual nodes and memory consumption

    - by Remy Lebeau - TeamB
    I have an app that loads records from a binary log file and displays them in a virtual TListView. There are potentially millions of records in a file, and the display can be filtered by the user, so I do not load all of the records in memory at one time, and the ListView item indexes are not a 1-to-1 relation with the file record offsets (List item 1 may be file record 100, for instance). I use the ListView's OnDataHint event to load records for just the items the ListView is actually interested in. As the user scrolls around, the range specified by OnDataHint changes, allowing me to free records that are not in the new range, and allocate new records as needed. This works fine, speed is tolerable, and the memory footprint is very low. I am currently evaluating TVirtualStringTree as a replacement for the TListView, mainly because I want to add the ability to expand/collapse records that span multiple lines (I can fudge it with the TListView by incrementing/decrementing the item count dynamically, but this is not as straight forward as using a real tree). For the most part, I have been able to port the TListView logic and have everything work as I need. I notice that TVirtualStringTree's virtual paradigm is vastly different, though. It does not have the same kind of OnDataHint functionality that TListView does (I can use the OnScroll event to fake it, which allows my memory buffer logic to continue working), and I can use the OnInitializeNode event to associate nodes with records that are allocated. However, once a tree node is initialized, it sees that it remains initialized for the lifetime of the tree. That is not good for me. As the user scrolls around and I remove records from memory, I need to reset those non-visual nodes without removing them from the tree completely, or losing their expand/collapse states. When the user scrolls them back into view, I can re-allocate the records and re-initialize the nodes. Basically, I want to make TVirtualStringTree act as much like TListView as possible, as far as its virtualization is concerned. I have seen that TVirtualStringTree has a ResetNode() method, but I encounter various errors whenever I try to use it. I must be using it wrong. I also thought of just storing a data pointer inside each node to my record buffers, and I allocate and free memory, update those pointers accordingly. The end effect does not work so well, either. Worse, my largest test log file has ~5 million records in it. If I initialize the TVirtualStringTree with that many nodes at one time (when the log display is unfiltered), the tree's internal overhead for its nodes takes up a whopping 260MB of memory (without any records being allocated yet). Whereas with the TListView, loading the same log file and all the memory logic behind it, I can get away with using just a few MBs. Any ideas?

    Read the article

  • perl one liner alternative to this bash "chain"?

    - by Michael Mao
    Hello everyone: I am trying to comprehend Perl following the way describe in the book "Minimal Perl". I've uploaded all source txt files onto my own server : results folder I got the output from using several bash commands in a "chain" like this: cat run*.txt | grep '^Bank[[:space:]]Balance'| cut -d ':' -f2 | grep -E '\$[0-9]+' I know this is far from the most concise and efficient, but at least it works... As our uni subject now moves onto the Perl part, I'd like to know if there is a way to get the same results in one line? I am trying something like the following code but stuck in the middle: Chenxi Mao@chenxi-a6b123bb /cygdrive/c/eMarket/output $ perl -wlne 'print; if $n=~/^Bank Balance/' syntax error at -e line 1, near "if $n" Execution of -e aborted due to compilation errors.

    Read the article

  • Cannot call SAPI from dll

    - by Quandary
    Question: The below code works fine as long as it is in an executable. It uses the msft (text-to-)speech API (SAPI). But as soon as I put it in a dll and load it with loadlibrary from an executable, it doesn't work. I've also tried to change CoInitialize(NULL); to CoInitializeEx(NULL,COINIT_MULTITHREADED); and I tried with all possible flags ( COINIT_APARTMENTTHREADED, COINIT_MULTITHREADED, COINIT_DISABLE_OLE1DDE, COINIT_SPEED_OVER_MEMORY) But it's always stuck at hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); I also tried those flags here: CLSCTX_INPROC_SERVER,CLSCTX_SERVER, CLSCTX_ALL, but nothing seems to help... There are no errors, it doesn't crash, it just sleeps forever at CoCreateInstance... This is the code as single exe (working) #include <windows.h> #include <sapi.h> #include <iostream> #include <cstdlib> int main(int argc, char* argv[]) { ISpVoice * pVoice = NULL; //CoInitializeEx(NULL,COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if( FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"),0); printf("Failed!\n"); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_exe.txt" , "w" ); fwrite (buffer , 1 , sizeof(buffer) , pFile ); fclose (pFile); } else { //CoGetClassObject(CLSID_SpVoice, CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory, (void**) &pClsF); //hr = CoGetClassObject(CLSID_SpVoice, CLSCTX_INPROC_SERVER, NULL, IID_IClassFactory, (void**) &pClsF); hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { hr = pVoice->Speak(L"Test Test", 0, NULL); hr = pVoice->Speak(L"This sounds normal <pitch middle = '-10'/> but the pitch drops half way through", SPF_IS_XML, NULL ); pVoice->Release(); pVoice = NULL; } else { MessageBox(NULL, TEXT("Failed To Create a COM instance..."), TEXT("Error"),0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_exe.txt" , "w" ); fwrite (buffer , 1 , sizeof(buffer) , pFile ); fclose (pFile); } } CoUninitialize(); return EXIT_SUCCESS; } This is the exe loading the dll (stays forever at printf("trying to create instance.\n"); ) #include <windows.h> #include <sapi.h> #include <iostream> #include <cstdlib> int main(int argc, char* argv[]) { // C:\Windows\System32\Speech\Common\sapi.dll //LoadLibraryA("sapi.dll"); LoadLibraryA("Sapidll2.dll"); return EXIT_SUCCESS; // Frankly, that would be nice... } And this is Sapidll2.dll // dllmain.cpp : Defines the entry point for the DLL application. #include "stdafx.h" #include <iostream> #include <cstdlib> #include <string> #include <windows.h> #include <sapi.h> int init_engine() { ISpVoice * pVoice = NULL; //HRESULT hr = CoInitializeEx(NULL, COINIT_MULTITHREADED); HRESULT hr = CoInitialize(NULL); if(FAILED(hr) ) { MessageBox(NULL, TEXT("Failed To Initialize"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoInitialize_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } else { printf("trying to create instance.\n"); //HRESULT hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //hr = CoCreateInstance(CLSID_SpVoice, NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); //HRESULT hr = CoCreateInstance(__uuidof(ISpVoice), NULL, CLSCTX_INPROC_SERVER, IID_ISpVoice, (void **) &pVoice); HRESULT hr = CoCreateInstance(__uuidof(SpVoice), NULL, CLSCTX_ALL, IID_ISpVoice, (void **) &pVoice); if( SUCCEEDED( hr ) ) { printf("Succeeded\n"); //hr = pVoice->Speak(L"The text to speech engine has been successfully initialized.", 0, NULL); } else { printf("failed\n"); MessageBox(NULL, TEXT("Failed To Create COM instance"), TEXT("Error"), 0); char buffer[2000] ; sprintf(buffer, "An error occured: 0x%08X.\n", hr); FILE * pFile = fopen ( "c:\\temp\\CoCreateInstance_dll.txt" , "w" ); fwrite (buffer , 1 , strlen(buffer) , pFile ); fclose (pFile); } } if(pVoice != NULL) { pVoice->Release(); pVoice = NULL; } CoUninitialize(); return true ; } BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { switch (ul_reason_for_call) { case DLL_PROCESS_ATTACH: init_engine(); break; case DLL_THREAD_ATTACH: case DLL_THREAD_DETACH: case DLL_PROCESS_DETACH: break; } return TRUE; }

    Read the article

  • Disposables, Using & Try/Catch Blocks

    - by Aren B
    Having a mental block today, need a hand verifying my logic isn't fubar'ed. Traditionally I would do file i/o similar to this: FileStream fs = null; // So it's visible in the finally block try { fs = File.Open("Foo.txt", FileMode.Open); /// Do Stuff } catch(IOException) { /// Handle Stuff } finally { if (fs != null) fs.Close(); } However, this isn't very elegant. Ideally I'd like to use the using block to dispose of the filestream when I'm done, however I am unsure about the synergy between using and try/catch. This is how i'd like to implement the above: try { using(FileStream fs = File.Open("Foo.txt", FileMode.Open)) { /// Do Stuff } } catch(Exception) { /// Handle Stuff } However, I'm worried that a premature exit (via thrown exception) from within the using block may not allow the using block to complete execution and clean up it's object. Am I just paranoid, or will this actually work the way I intend it to?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • How to create a folder for each item in a directory?

    - by Adrian Andronic
    I'm having trouble making folders that I create go where I want them to go. For each file in a given folder, I want to create a new folder, then put that file in the new folder. My problem is that the new folders I create are being put in the parent directory, not the one I want. My example: def createFolder(): dir_name = 'C:\\Users\\Adrian\\Entertainment\\Coding\\Test Folder' files = os.listdir(dir_name) for i in files: os.mkdir(i) Let's say that my files in that directory are Hello.txt and Goodbye.txt. When I run the script, it makes new folders for these files, but puts them one level above, in 'C:\Users\Adrian\Entertainment\Coding. How do I make it so they are created in the same place as the files, AKA 'C:\Users\Adrian\Entertainment\Coding\Test Folder'?

    Read the article

  • Sorting a file with 55K rows and varying Columns

    - by Prasad
    Hi I want to find a programmatic solution using C++. I have a 900 files each of 27MB size. (just to inform about the enormity ). Each file has 55K rows and Varying columns. But the header indicates the columns I want to sort the rows in an order w.r.t to a Column Value. I wrote the sorting algorithm for this (definitely my newbie attempts, you may say). This algorithm is working for few numbers, but fails for larger numbers. Here is the code for the same: basic functions I defined to use inside the main code: int getNumberOfColumns(const string& aline) { int ncols=0; istringstream ss(aline); string s1; while(ss>>s1) ncols++; return ncols; } vector<string> getWordsFromSentence(const string& aline) { vector<string>words; istringstream ss(aline); string tstr; while(ss>>tstr) words.push_back(tstr); return words; } bool findColumnName(vector<string> vs, const string& colName) { vector<string>::iterator it = find(vs.begin(), vs.end(), colName); if ( it != vs.end()) return true; else return false; } int getIndexForColumnName(vector<string> vs, const string& colName) { if ( !findColumnName(vs,colName) ) return -1; else { vector<string>::iterator it = find(vs.begin(), vs.end(), colName); return it - vs.begin(); } } ////////// I like the Recurssive functions - I tried to create a recursive function ///here. This worked for small values , say 20 rows. But for 55K - core dumps void sort2D(vector<string>vn, vector<string> &srt, int columnIndex) { vector<double> pVals; for ( int i = 0; i < vn.size(); i++) { vector<string>meancols = getWordsFromSentence(vn[i]); pVals.push_back(stringToDouble(meancols[columnIndex])); } srt.push_back(vn[max_element(pVals.begin(), pVals.end())-pVals.begin()]); if (vn.size() > 1 ) { vn.erase(vn.begin()+(max_element(pVals.begin(), pVals.end())-pVals.begin()) ); vector<string> vn2 = vn; //cout<<srt[srt.size() -1 ]<<endl; sort2D(vn2 , srt, columnIndex); } } Now the main code: for ( int i = 0; i < TissueNames.size() -1; i++) { for ( int j = i+1; j < TissueNames.size(); j++) { //string fname = path+"/gse7307_Female_rma"+TissueNames[i]+"_"+TissueNames[j]+".txt"; //string fname2 = sortpath2+"/gse7307_Female_rma"+TissueNames[i]+"_"+TissueNames[j]+"Sorted.txt"; string fname = path+"/gse7307_Male_rma"+TissueNames[i]+"_"+TissueNames[j]+".txt"; string fname2 = sortpath2+"/gse7307_Male_rma"+TissueNames[i]+"_"+TissueNames[j]+"4Columns.txt"; //vector<string>AllLinesInFile; BioInputStream fin(fname); string aline; getline(fin,aline); replace (aline.begin(), aline.end(), '"',' '); string headerline = aline; vector<string> header = getWordsFromSentence(aline); int pindex = getIndexForColumnName(header,"p-raw"); int xcindex = getIndexForColumnName(header,"xC"); int xeindex = getIndexForColumnName(header,"xE"); int prbindex = getIndexForColumnName(header,"X"); string newheaderline = "X\txC\txE\tp-raw"; BioOutputStream fsrt(fname2); fsrt<<newheaderline<<endl; int newpindex=3; while ( getline(fin, aline) ){ replace (aline.begin(), aline.end(), '"',' '); istringstream ss2(aline); string tstr; ss2>>tstr; tstr = ss2.str().substr(tstr.length()+1); vector<string> words = getWordsFromSentence(tstr); string values = words[prbindex]+"\t"+words[xcindex]+"\t"+words[xeindex]+"\t"+words[pindex]; AllLinesInFile.push_back(values); } vector<string>SortedLines; sort2D(AllLinesInFile, SortedLines,newpindex); for ( int si = 0; si < SortedLines.size(); si++) fsrt<<SortedLines[si]<<endl; cout<<"["<<i<<","<<j<<"] = "<<SortedLines.size()<<endl; } } can some one suggest me a better way of doing this? why it is failing for larger values. ? The primary function of interest for this query is Sort2D function. thanks for the time and patience. prasad.

    Read the article

  • Need to compare blobs in firebird

    - by Michael Beck
    Hey guys, I need to check on the contents of blobs in my databases (yes, plural, but one problem at a time). In one database, I have about 900 images of potentially varying sizes. I need to check to see if the versioning system that's built into our application is actually correctly replicating the image data from the previous version to the new version of a record. How do I compare values en masse so I don't have to pick through each record one at a time and open up the blob using FlameRobin or Firebird Maestro and visually compare these images? Thanks for any assistance.

    Read the article

  • FileSystemWatcher Changed event is raised twice

    - by user214707
    I have an application where I am looking for a text file and if there are any changes made to the file I am using the OnChanged eventhandler to handle the event. I am using the NotifyFilters.LastWriteTime but still the event is getting fired twice. Here is the code. public void Initialize() { FileSystemWatcher _fileWatcher = new FileSystemWatcher(); _fileWatcher.Path = "C:\\Folder"; _fileWatcher.NotifyFilter = NotifyFilters.LastWrite; _fileWatcher.Filter = "Version.txt"; _fileWatcher.Changed += new FileSystemEventHandler(OnChanged); _fileWatcher.EnableRaisingEvents = true; } private void OnChanged(object source, FileSystemEventArgs e) { ....... } In my case the OnChanged is called twice, when I change the text file version.txt and save it.

    Read the article

  • Html index page and files in that directory

    - by Frank
    On my web site, there is an index page, but if I take out that index page, users will see the files in that directory, for instance my site is : XYZ.com and I have a directory called "My_Dir", so when a user typed in "XYZ.com/My_Dir" he will see the index.html if there is one, but if it's not there, he will see a list of all my files inside "My_Dir", so is it safe to assume that with an index page in any of my sub directories, I can hide all the files in those directories from users, in other words if I have "123.txt, abc.html and index.html" in "My_Dir", users won't be able to see "123.txt, abc.html" because of the existence of "index.html" [ unless of course I mention those two files inside index.html ] ? Frank

    Read the article

  • Sound Effects/Manipulation?

    - by Adam
    Hello, I am creating an android app that basically records an applies an "Effect" on the audio track then plays it back. I got my app to record an play back but I am stuck an not sure where do go from here. I have been Googling for days now trying to find a open source audio library or some way to change the audio after I record it. I currently have it setup to play back using SoundPool an I't lets me speed up an slow down the audio. I would like to do things like change pitch an add echo etc. I will appreciate any responses because I am totally stumped right now. Thanks Adam

    Read the article

  • Sparse checkout in Git 1.7.0?

    - by davr
    With the new sparse checkout feature in Git 1.7.0, is it possible to just get the contents of a subdirectory like how you can in SVN? I found this example, but it preserves the full directory structure. Imagine that I just wanted the contents of the 'perl' directory, without an actual directory named 'perl'. -- EDIT -- Example: My git repository contains the following paths repo/.git/ repo/perl/ repo/perl/script1.pl repo/perl/script2.pl repo/images/ repo/images/image1.jpg repo/images/image2.jpg repo/doc/ repo/doc/readme.txt repo/doc/help.txt What I want is to be able to produce from the above repository this layout: repo/.git/ repo/script1.pl repo/script2.pl However with the current sparse checkout feature, it seems like it is only possible to get repo/.git/ repo/perl/script1.pl repo/perl/script2.pl which is NOT what I want. Thanks.

    Read the article

  • C# bluetooth file send.

    - by cheesebunz
    i'm new to bluetooth development and i found the 32netfeet . Right now i'm able to search for bluetooth devices nearby and connect to them but how do i send a file e.g SendTest.txt? I tried buttonclick event using the OBEX but i don't understand this is my example code: using InTheHand.Net; using InTheHand.Net.Sockets; using InTheHand.Net.Bluetooth; namespace BluetoothIntheHand { public partial class Form2 : Form { private Guid service = BluetoothService.DialupNetworking; private BluetoothClient bluetoothClient; public Form2() { InitializeComponent(); } private void btnSearch_Click(object sender, EventArgs e) { BluetoothRadio.PrimaryRadio.Mode = RadioMode.Discoverable; BluetoothRadio myRadio = BluetoothRadio.PrimaryRadio; lblSearch.Text = "" + myRadio.LocalAddress.ToString(); bluetoothClient = new BluetoothClient(); Cursor.Current = Cursors.WaitCursor; BluetoothDeviceInfo[] bluetoothDeviceInfo = { }; bluetoothDeviceInfo = bluetoothClient.DiscoverDevices(10); comboBox1.DataSource = bluetoothDeviceInfo; comboBox1.DisplayMember = "DeviceName"; comboBox1.ValueMember = "DeviceAddress"; comboBox1.Focus(); Cursor.Current = Cursors.Default; } private void btnConnect_Click(object sender, EventArgs e) { if (comboBox1.SelectedValue != null) { try { bluetoothClient.Connect(new BluetoothEndPoint((BluetoothAddress)comboBox1.SelectedValue, service)); MessageBox.Show("Connected"); } catch (Exception ex) { MessageBox.Show(ex.Message); } } } private void btnSend_Click(object sender, EventArgs e) { bluetoothClient.Connect(new BluetoothEndPoint((BluetoothAddress)comboBox1.SelectedValue, service)); String addr = "112233445566"; Uri uri = new Uri("obex://"+@"SendTest.txt"); ObexWebRequest req= new ObexWebRequest(uri); ObexWebResponse rsp; } I found the guide but don't really knw hw to convert to C# ' The host part of the URI is the device address, e.g. IrDAAddress.ToString(), ' and the file part is the OBEX object name. Dim addr As String = "112233445566" Dim uri As New Uri("obex://" & addr & "/HelloWorld2.txt") Dim req As New ObexWebRequest(uri) Using content As Stream = req.GetRequestStream() ' Using a StreamWriter to write text to the stream... Using wtr As New StreamWriter(content) wtr.WriteLine("Hello World GetRequestStream") wtr.WriteLine("Hello World GetRequestStream 2") wtr.Flush() ' Set the Length header value req.ContentLength = content.Length End Using ' In this case closing the StreamWriter also closed the Stream, but ... End Using Dim rsp As ObexWebResponse = CType(req.GetResponse(),ObexWebResponse) Console.WriteLine("Response Code: {0} (0x{0:X})", rsp.StatusCode)

    Read the article

  • What is purpuse of T4 Generator in T4toolbox

    - by Fred Yang
    I am using T4toolbox, I am confused what the generator is for. I can run the following public class Generator1 : Generator { protected override void RunCore() { Template1 t = new Template1(); t.Output.File = "t3.txt"; t.Render(); } } or I can run t4 script directly like the following. Template1 t = new Template1(); t.Output.File = "t3.txt"; t.Render(); But I can do the same using t4 script without generator as well. So I mean can do the same thing with two approach "script -- generator -- template" and "script -- template", am I missing something? Thanks

    Read the article

  • Accessing unbound DetailsView cell values when Detailsview DefaultMode is Edit

    - by Nickson
    i have a DetailsView that is populated by a Linq to Entities query. Example query is below. Dim Record = From L In db.MyRecords _ Where L.RecordID = 100 _ Select ID = L.RecordID, L.column1, L.column2, L.column3, L.column4 DetailsView2.DataSource = Record DetailsView2.DataBind() The defaultMode for the DetailsView is Edit. Now if this Detailsview was bound to a datasource control, i would convert a column to a templateColumn and programatically access cell values like so Dim NameTextBox As System.Web.UI.WebControls.TextBox = CType(DetailsView2.Rows(1).Cells(1).FindControl("TextBox1"), System.Web.UI.WebControls.TextBox) such that i can then say NameTextBox.Text to get the Name value. But the problem i have is, with this detailsview which is unbound, i have no column at design time to convert to a template, and yet i want to access its cell values. help is appreciated.

    Read the article

  • cancel update in datacontext = LInq

    - by Garcia Julien
    Hi, I would like to know if its possible to discard changes of only one record of only one table in datacontext. I use databind to bind my controls on a form. I modify one record at a time. after the modification, the user have to hit save button to validate. But he can hit cancel. I would like that the cancel button discard all the changes that the user has done. Is it possible? Ju

    Read the article

  • Match multiline regex in file object

    - by williamx
    How can I extract the groups from this regex from a file object (data.txt)? import numpy as np import re import os ifile = open("data.txt",'r') # Regex pattern pattern = re.compile(r""" ^Time:(\d{2}:\d{2}:\d{2}) # Time: 12:34:56 at beginning of line \r{2} # Two carriage return \D+ # 1 or more non-digits storeU=(\d+\.\d+) \s uIx=(\d+) \s storeI=(-?\d+.\d+) \s iIx=(\d+) \s avgCI=(-?\d+.\d+) """, re.VERBOSE | re.MULTILINE) time = []; for line in ifile: match = re.search(pattern, line) if match: time.append(match.group(1)) The problem in the last part of the code, is that I iterate line by line, which obviously doesn't work with multiline regex. I have tried to use pattern.finditer(ifile) like this: for match in pattern.finditer(ifile): print match ... just to see if it works, but the finditer method requires a string or buffer. I have also tried this method, but can't get it to work matches = [m.groups() for m in pattern.finditer(ifile)] Any idea?

    Read the article

  • getting a blank data report vb6

    - by arvind
    Hi, I am new to vb6. I am working to create the invoice generation application. I am using data report to show the generated invoice. The step by step working of process is Entering the data in to Invoice and ItemsInvoice tables. Then getting the maxId using (Adodc) from the data base to show the last generated Invoice. Then passing the max Id as parameter to the data report which is showing the invoice according to the invoice id. It is working fine when I first time generate invoice. Now for 2nd invoice withou closing application I am getting a blank data report. For data report I am using dataenvironment. I am guessing the reason of blank data report is blank because there was no record for that Id. But actually the record is inserting in the database. Please help me.

    Read the article

  • Creating <li> with JavaScript in an XUL Application

    - by echox
    Hi! I try to create some li elements in my XUL Application. Theres only the text of the elements shown, but no list typical bullets and linebreaks. Example: text text text text text text text Heres the JS Code I use to create the list: var li = document.createElement('html:li'); var txt = document.createTextNode("only shown as simple text"); li.appendChild(txt); document.getElementById('someList').appendChild(li); HTML: <html:ul id="someList"> <html:li>this is shown in correct list style</html:li> </html:ul> I tried 'html:li' and also 'li' but nothing worked. Any suggestions?

    Read the article

  • RIA Services Repository Save does not work!?

    - by Savvas Sopiadis
    Hello everybody! Doing my first SL4 MVVM RIA based application and i ran into the following situation: updating a record (EF4,NO-POCOS!!) in the SL-client seems to take place, but values in the dbms are unchanged. Debugging with Fiddler the message on save is (amongst others): EntityActions.nil? b9http://schemas.microsoft.com/2003/10/Serialization/Arrays^HasMemberChanges?^Id?^ Operation?Update I assume that this says only: hey! the dbms should do an update on this record, AND nothing more! Is that right?! I 'm using a generic repository like this: public class Repository<T> : IRepository<T> where T : class { IObjectSet<T> _objectSet; IObjectContext _objectContext; public Repository(IObjectContext objectContext) { this._objectContext = objectContext; _objectSet = objectContext.CreateObjectSet<T>(); } public IQueryable<T> AsQueryable() { return _objectSet; } public IEnumerable<T> GetAll() { return _objectSet.ToList(); } public IEnumerable<T> Find(Expression<Func<T, bool>> where) { return _objectSet.Where(where); } public T Single(Expression<Func<T, bool>> where) { return _objectSet.Single(where); } public T First(Expression<Func<T, bool>> where) { return _objectSet.First(where); } public void Delete(T entity) { _objectSet.DeleteObject(entity); } public void Add(T entity) { _objectSet.AddObject(entity); } public void Attach(T entity) { _objectSet.Attach(entity); } public void Save() { _objectContext.SaveChanges(); } } The DomainService Update Method is the following: [Update] public void UpdateCulture(Culture currentCulture) { if (currentCulture.EntityState == System.Data.EntityState.Detached) { this.cultureRepository.Attach(currentCulture); } this.cultureRepository.Save(); } I know that the currentCulture-Entity is detached. What confuses me (amongst other things) is this: is the _objectContext still alive? (which means it "will be"??? aware of the changes made to record, so simply calling Attach() and then Save() should be enough!?!?) What am i missing? Development Environment: VS2010RC - Entity Framework 4 (no POCOs) Thanks in advance

    Read the article

< Previous Page | 133 134 135 136 137 138 139 140 141 142 143 144  | Next Page >