Search Results

Search found 3849 results on 154 pages for 'execution'.

Page 138/154 | < Previous Page | 134 135 136 137 138 139 140 141 142 143 144 145  | Next Page >

  • Parameters not being passed into template when using the .Net transform classes

    - by Chris F
    I am using the .Net XslCompiledTranform to run some simple XSLT (see below for a simplified example). The example XSLT is meant to do simply show the value of the parameter that is passed in to the template. The output is what I expect it to be (i.e. <result xmlns:p1="http://www.doesnotexist.com"> <valueOfParamA>valueA</valueOfParamA> </result> when I use Saxon 9.0, but when I use XslCompiledTransform (XslTransform) in .net I get <result xmlns:p1="http://www.doesnotexist.com"> <valueOfParamA></valueOfParamA> </result> The problem is that that the parameter value of paramA is not being passed into the template when I use the .Net classes. I completely stumped as to why. when I step through in Visual Studio, the debugger says that the template will be called with paramA='valueA' but when execution switches to the template the value of paramA is blank. Can anyone explain why this is happening? Is this a bug in the MS implementation or (more likely) am I doing something that is forbidden in XSLT? Any help greatly appreciated. This is the XSLT that I am using <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:extfn="http://exslt.org/common" exclude-result-prefixes="extfn" xmlns:p1="http://www.doesnotexist.com"> <!-- Replace msxml with xmlns:extfn="http://exslt.org/common" xmlns:extfn="urn:schemas-microsoft-com:xslt" --> <xsl:output method="xml" indent="yes"/> <xsl:template match="/"> <xsl:variable name="resultTreeFragment"> <p1:foo> </p1:foo> </xsl:variable> <xsl:variable name="nodeset" select="extfn:node-set($resultTreeFragment)"/> <result> <xsl:apply-templates select="$nodeset" mode="AParticularMode"> <xsl:with-param name="paramA" select="'valueA'"/> </xsl:apply-templates> </result> </xsl:template> <xsl:template match="@* | node()" mode="AParticularMode"> <xsl:param name="paramA"/> <valueOfParamA> <xsl:value-of select="$paramA"/> </valueOfParamA> </xsl:template> </xsl:stylesheet>

    Read the article

  • Is there anyway to exclude artifacts inherited from a parent POM?

    - by Miguel
    Artifacts from dependencies can be excluded by declaring an <exclusions> element inside a <dependency> But in this case it's needed to exclude an artifact inherited from a parent project. An excerpt of the POM under discussion follows: <project> <modelVersion>4.0.0</modelVersion> <groupId>test</groupId> <artifactId>jruby</artifactId> <version>0.0.1-SNAPSHOT</version> <parent> <artifactId>base</artifactId> <groupId>es.uniovi.innova</groupId> <version>1.0.0</version> </parent> <dependencies> <dependency> <groupId>com.liferay.portal</groupId> <artifactId>ALL-DEPS</artifactId> <version>1.0</version> <scope>provided</scope> <type>pom</type> </dependency> </dependencies> </project> base artifact, depends on javax.mail:mail-1.4.jar, and ALL-DEPS depends on another version of the same library. Due to the fact that mail.jar from ALL-DEPS exist on the execution environment, although not exported, collides with the mail.jar that exists on the parent, which is scoped as compile. A solution could be to rid off mail.jar from the parent POM, but most of the projects that inherit base, need it (as is a transtive dependency for log4j). So What I would like to do is to simply exclude parent's library from the child project, as it could be done if base was a dependency and not the parent pom: ... <dependency> <artifactId>base</artifactId> <groupId>es.uniovi.innova</groupId> <version>1.0.0</version> <type>pom<type> <exclusions> <exclusion> <groupId>javax.mail</groupId> <artifactId>mail</artifactId> </exclusion> </exclusions> </dependency> ...

    Read the article

  • Inline HTML Syntax for Helpers in ASP.NET MVC

    - by kouPhax
    I have a class that extends the HtmlHelper in MVC and allows me to use the builder pattern to construct special output e.g. <%= Html.FieldBuilder<MyModel>(builder => { builder.Field(model => model.PropertyOne); builder.Field(model => model.PropertyTwo); builder.Field(model => model.PropertyThree); }) %> Which outputs some application specific HTML, lets just say, <ul> <li>PropertyOne: 12</li> <li>PropertyTwo: Test</li> <li>PropertyThree: true</li> </ul> What I would like to do, however, is add a new builder methid for defining some inline HTML without having to store is as a string. E.g. I'd like to do this. <% Html.FieldBuilder<MyModel>(builder => { builder.Field(model => model.PropertyOne); builder.Field(model => model.PropertyTwo); builder.ActionField(model => %> Generated: <%=DateTime.Now.ToShortDate()%> (<a href="#">Refresh</a>) <%); }).Render(); %> and generate this <ul> <li>PropertyOne: 12</li> <li>PropertyTwo: Test</li> <li>Generated: 29/12/2008 <a href="#">Refresh</a></li> </ul> Essentially an ActionExpression that accepts a block of HTML. However to do this it seems I need to execute the expression but point the execution of the block to my own StringWriter and I am not sure how to do this. Can anyone advise?

    Read the article

  • Choosing a distributed shared memory solution

    - by mindas
    I have a task to build a prototype for a massively scalable distributed shared memory (DSM) app. The prototype would only serve as a proof-of-concept, but I want to spend my time most effectively by picking the components which would be used in the real solution later on. The aim of this solution is to take data input from an external source, churn it and make the result available for a number of frontends. Those "frontends" would just take the data from the cache and serve it without extra processing. The amount of frontend hits on this data can literally be millions per second. The data itself is very volatile; it can (and does) change quite rapidly. However the frontends should see "old" data until the newest has been processed and cached. The processing and writing is done by a single (redundant) node while other nodes only read the data. In other words: no read-through behaviour. I was looking into solutions like memcached however this particular one doesn't fulfil all our requirements which are listed below: The solution must at least have Java client API which is reasonably well maintained as the rest of app is written in Java and we are seasoned Java developers; The solution must be totally elastic: it should be possible to add new nodes without restarting other nodes in the cluster; The solution must be able to handle failover. Yes, I realize this means some overhead, but the overall served data size isn't big (1G max) so this shouldn't be a problem. By "failover" I mean seamless execution without hardcoding/changing server IP address(es) like in memcached clients when a node goes down; Ideally it should be possible to specify the degree of data overlapping (e.g. how many copies of the same data should be stored in the DSM cluster); There is no need to permanently store all the data but there might be a need of post-processing of some of the data (e.g. serialization to the DB). Price. Obviously we prefer free/open source but we're happy to pay a reasonable amount if a solution is worth it. In any way, paid 24hr/day support contract is a must. The whole thing has to be hosted in our data centers so SaaS offerings like Amazon SimpleDB are out of scope. We would only consider this if no other options would be available. Ideally the solution would be strictly consistent (as in CAP); however, eventual consistence can be considered as an option. Thanks in advance for any ideas.

    Read the article

  • How to access controller dynamic properties within a base controller's constructor in Grails?

    - by 4h34d
    Basically, I want to be able to assign objects created within filters to members in a base controller from which every controller extends. Any possible way to do that? Here's how I tried, but haven't got to make it work. What I'm trying to achieve is to have all my controllers extend a base controller. The base controller's constructor would be used to assign values to its members, those values being pulled from the session map. Example below. File grails-app/controllers/HomeController.groovy: class HomeController extends BaseController { def index = { render username } } File grails-app/controllers/BaseController.groovy: abstract class BaseController { public String username public BaseController() { username = session.username } } When running the app, the output shown is: 2010-06-15 18:17:16,671 [main] ERROR [localhost].[/webapp] - Exception sending context initialized event to listener instance of class org.codehaus.groovy.grails.web.context.GrailsContextLoaderListener org.springframework.beans.factory.BeanCreationException: Error creating bean with name 'pluginManager' defined in ServletContext resource [/WEB-INF/applicationContext.xml]: Invocation of init method failed; nested exception is java.lang.RuntimeException: Unable to locate constructor with Class parameter for class org.codehaus.groovy.grails.commons.DefaultGrailsControllerClass ... Caused by: java.lang.RuntimeException: Unable to locate constructor with Class parameter for class org.codehaus.groovy.grails.commons.DefaultGrailsControllerClass ... Caused by: java.lang.reflect.InvocationTargetException ... Caused by: org.codehaus.groovy.grails.exceptions.NewInstanceCreationException: Could not create a new instance of class [com.my.package.controller.HomeController]! ... Caused by: groovy.lang.MissingPropertyException: No such property: session for class: com.my.package.controller.HomeController at com.my.package.controller.BaseController.<init>(BaseController.groovy:16) at com.my.package.controller.HomeController.<init>(HomeController.groovy) ... 2010-06-15 18:17:16,687 [main] ERROR core.StandardContext - Error listenerStart 2010-06-15 18:17:16,687 [main] ERROR core.StandardContext - Context [/webapp] startup failed due to previous errors And the app won't run. This is just an example as in my case I wouldn't want to assign a username to a string value, but rather a few objects pulled from the session map. The objects pulled from the session map are being set within filters. The alternative I see is being able to access the controller's instance within the filter's execution. Is that possible? Please help! Thanks a bunch!

    Read the article

  • VB6 ADO Command to SQL Server

    - by Emtucifor
    I'm getting an inexplicable error with an ADO command in VB6 run against a SQL Server 2005 database. Here's some code to demonstrate the problem: Sub ADOCommand() Dim Conn As ADODB.Connection Dim Rs As ADODB.Recordset Dim Cmd As ADODB.Command Dim ErrorAlertID As Long Dim ErrorTime As Date Set Conn = New ADODB.Connection Conn.ConnectionString = "Provider=SQLOLEDB.1;Integrated Security=SSPI;Initial Catalog=database;Data Source=server" Conn.CursorLocation = adUseClient Conn.Open Set Rs = New ADODB.Recordset Rs.CursorType = adOpenStatic Rs.LockType = adLockReadOnly Set Cmd = New ADODB.Command With Cmd .Prepared = False .CommandText = "ErrorAlertCollect" .CommandType = adCmdStoredProc .NamedParameters = True .Parameters.Append .CreateParameter("@ErrorAlertID", adInteger, adParamOutput) .Parameters.Append .CreateParameter("@CreateTime", adDate, adParamOutput) Set .ActiveConnection = Conn Rs.Open Cmd ErrorAlertID = .Parameters("@ErrorAlertID").Value ErrorTime = .Parameters("@CreateTime").Value End With Debug.Print Rs.State ' Shows 0 - Closed Debug.Print Rs.RecordCount ' Of course this fails since the recordset is closed End Sub So this code was working not too long ago but now it's failing on the last line with the error: Run-time error '3704': Operation is not allowed when the object is closed Why is it closed? I just opened it and the SP returns rows. I ran a trace and this is what the ADO library is actually submitting to the server: declare @p1 int set @p1=1 declare @p2 datetime set @p2=''2010-04-22 15:31:07:770'' exec ErrorAlertCollect @ErrorAlertID=@p1 output,@CreateTime=@p2 output select @p1, @p2 Running this as a separate batch from my query editor yields: Msg 102, Level 15, State 1, Line 4 Incorrect syntax near '2010'. Of course there's an error. Look at the double single quotes in there. What the heck could be causing that? I tried using adDBDate and adDBTime as data types for the date parameter, and they give the same results. When I make the parameters adParamInputOutput, then I get this: declare @p1 int set @p1=default declare @p2 datetime set @p2=default exec ErrorAlertCollect @ErrorAlertID=@p1 output,@CreateTime=@p2 output select @p1, @p2 Running that as a separate batch yields: Msg 156, Level 15, State 1, Line 2 Incorrect syntax near the keyword 'default'. Msg 156, Level 15, State 1, Line 4 Incorrect syntax near the keyword 'default'. What the heck? SQL Server doesn't support this kind of syntax. You can only use the DEFAULT keyword in the actual SP execution statement. I should note that removing the extra single quotes from the above statement makes the SP run fine. ... Oh my. I just figured it out. I guess it's worth posting anyway.

    Read the article

  • Python: Script works, but seems to deadlock after some time

    - by sberry2A
    I have the following script, which is working for the most part Link to PasteBin The script's job is to start a number of threads which in turn each start a subprocess with Popen. The output from each subprocess is as follows: 1 2 3 . . . n Done Bascially the subprocess is transferring 10M records from tables in one database to different tables in another db with a lot of data massaging/manipulation in between because of the different schemas. If the subprocess fails at any time in it's execution (bad records, duplicate primary keys, etc), or it completes successfully, it will output "Done\n". If there are no more records to select against for transfer then it will output "NO DATA\n" My intent was to create my script "tableTransfer.py" which would spawn a number of these processes, read their output, and in turn output information such as number of updates completed, time remaining, time elapsed, and number of transfers per second. I started running the process last night and checked in this morning to see it had deadlocked. There were not subprocceses running, there are still records to be updated, and the script had not exited. It was simply sitting there, no longer outputting the current information because no subprocces were running to update the total number complete which is what controls updates to the output. This is running on OS X. I am looking for three things: I would like to get rid of the possibility of this deadlock occurring so I don't need to check in on it as frequently. Is there some issue with locking? Am I doing this in a bad way (gThreading variable to control looping of spawning additional thread... etc.) I would appreciate some suggestions for improving my overall methodology. How should I handle ctrl-c exit? Right now I need to kill the process, but assume I should be able to use the signal module or other to catch the signal and kill the threads, is that right? I am not sure whether I should be pasting my entire script here, since I usually just paste snippets. Let me know if I should paste it here as well.

    Read the article

  • ArithmeticException thrown during BigDecimal.divide

    - by polygenelubricants
    I thought java.math.BigDecimal is supposed to be The Answer™ to the need of performing infinite precision arithmetic with decimal numbers. Consider the following snippet: import java.math.BigDecimal; //... final BigDecimal one = BigDecimal.ONE; final BigDecimal three = BigDecimal.valueOf(3); final BigDecimal third = one.divide(three); assert third.multiply(three).equals(one); // this should pass, right? I expect the assert to pass, but in fact the execution doesn't even get there: one.divide(three) causes ArithmeticException to be thrown! Exception in thread "main" java.lang.ArithmeticException: Non-terminating decimal expansion; no exact representable decimal result. at java.math.BigDecimal.divide It turns out that this behavior is explicitly documented in the API: In the case of divide, the exact quotient could have an infinitely long decimal expansion; for example, 1 divided by 3. If the quotient has a non-terminating decimal expansion and the operation is specified to return an exact result, an ArithmeticException is thrown. Otherwise, the exact result of the division is returned, as done for other operations. Browsing around the API further, one finds that in fact there are various overloads of divide that performs inexact division, i.e.: final BigDecimal third = one.divide(three, 33, RoundingMode.DOWN); System.out.println(three.multiply(third)); // prints "0.999999999999999999999999999999999" Of course, the obvious question now is "What's the point???". I thought BigDecimal is the solution when we need exact arithmetic, e.g. for financial calculations. If we can't even divide exactly, then how useful can this be? Does it actually serve a general purpose, or is it only useful in a very niche application where you fortunately just don't need to divide at all? If this is not the right answer, what CAN we use for exact division in financial calculation? (I mean, I don't have a finance major, but they still use division, right???).

    Read the article

  • System.MissingMemberException was unhandled by user code

    - by AmRoSH
    I'm using this code: Dim VehiclesTable1 = dsVehicleList.Tables(0) Dim VT1 = (From d In VehiclesTable1.AsEnumerable _ Select VehicleTypeName = d.Item("VehicleTypeName") _ , VTypeID = d.Item("VTypeID") _ , ImageURL = d.Item("ImageURL") _ , DailyRate = d.Item("DailyRate") _ , RateID = d.Item("RateID")).Distinct its linq to dataset and I Take Data on THis Rotator: <telerik:RadRotator ID="RadRotatorVehicleType" runat="server" Width="620px" Height="145" ItemWidth="155" ItemHeight="145" ScrollDirection="Left" FrameDuration="1" RotatorType="Buttons"> <ItemTemplate> <div style="text-align: center; cursor: pointer; width: 150px"> <asp:Image ID="ImageVehicleType" runat="server" Width="150" ImageUrl='<%# Container.DataItem("ImageURL") %>' /> <asp:Label ID="lblVehicleType" runat="server" Text='<%# Container.DataItem("VehicleTypeName") %>' Font-Bold="true"></asp:Label> <br /> <asp:Label ID="lblDailyRate" runat="server" Text='<%# Container.DataItem("DailyRate") %>' Visible="False"></asp:Label> <input id="HiddenVehicleTypeID" type="hidden" value='<%# Container.DataItem("VTypeID") %>' name="HiddenVehicleTypeID" runat="server" /> <input id="HiddenRateID" type="hidden" value='<%# Container.DataItem("RateID") %>' name="HiddenRateID" runat="server" /> </div> </ItemTemplate> <ControlButtons LeftButtonID="img_left" RightButtonID="img_right" /> </telerik:RadRotator> and I got this Exception: No default member found for type 'VB$AnonymousType_0(Of Object,Object,Object,Object,Object)'. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.MissingMemberException: No default member found for type 'VB$AnonymousType_0(Of Object,Object,Object,Object,Object)'. I don't know whats up ? Any help please. Thanks for who tried to solve this but I got solution: using '<%# DataBinder.Eval(Container.DataItem,"ImageURL") %>' instead of '<%# Container.DataItem("RateID") %>' Thanks,

    Read the article

  • CRM2011 - "The given key was not present in the dictionary"

    - by DJZorrow
    I am what you call a "n00b" in CRM plugin development. I am trying to write a plugin for Microsoft's Dynamics CRM 2011 that will create a new activity entity when you create a new contact. I want this activity entity to be associated with the contact entity. This is my current code: using System; using System.Collections.Generic; using System.Linq; using System.Text; using Microsoft.Xrm.Sdk; namespace ITPH_CRM_Deactivate_Account_SSP_Disable { public class SSPDisable_Plugin: IPlugin { public void Execute(IServiceProvider serviceProvider) { // Obtain the execution context from the service provider. IPluginExecutionContext context = (IPluginExecutionContext) serviceProvider.GetService(typeof(IPluginExecutionContext)); IOrganizationServiceFactory serviceFactory = (IOrganizationServiceFactory)serviceProvider.GetService(typeof(IOrganizationServiceFactory)); IOrganizationService service = serviceFactory.CreateOrganizationService(context.UserId); if (context.InputParameters.Contains("Target") && context.InputParameters["target"] is Entity) { Entity entity = context.InputParameters["Target"] as Entity; if (entity.LogicalName != "account") { return; } Entity followup = new Entity(); followup.LogicalName = "activitypointer"; followup.Attributes = new AttributeCollection(); followup.Attributes.Add("subject", "Created via Plugin."); followup.Attributes.Add("description", "This is generated by the magic of C# ..."); followup.Attributes.Add("scheduledstart", DateTime.Now.AddDays(3)); followup.Attributes.Add("actualend", DateTime.Now.AddDays(5)); if (context.OutputParameters.Contains("id")) { Guid regardingobjectid = new Guid(context.OutputParameters["id"].ToString()); string regardingobjectidType = "account"; followup["regardingobjectid"] = new EntityReference(regardingobjectidType, regardingobjectid); } service.Create(followup); } } } But when i try to run this code: I get an error when i try to create a new contact in the CRM environment. The error is: "The given key was not present in the dictionary" (Link *1). The error pops up right as i try to save the new contact. Link *1: http://puu.sh/4SXrW.png (Translated bold text: "Error on business process") Thanks for any help or suggestions :)

    Read the article

  • If array is thread safe, what the issue with this function?

    - by Ajay Sharma
    I am totally lost with the things that is happening with my code.It make me to think & get clear with Array's thread Safe concept. Is NSMutableArray OR NSMutableDictionary Thread Safe ? While my code is under execution, the values for the MainArray get's changes although, that has been added to Array. Please try to execute this code, onyour system its very much easy.I am not able to get out of this Trap. It is the function where it is returning Array. What I am Looking to do is : -(Array) (Main Array) --(Dictionary) with Key Value (Multiple Dictionary in Main Array) ----- Above dictionary has 9 Arrays in it. This is the structure I am developing for Array.But even before #define TILE_ROWS 3 #define TILE_COLUMNS 3 #define TILE_COUNT (TILE_ROWS * TILE_COLUMNS) -(NSArray *)FillDataInArray:(int)counter { NSMutableArray *temprecord = [[NSMutableArray alloc] init]; for(int i = 0; i <counter;i++) { if([temprecord count]<=TILE_COUNT) { NSMutableDictionary *d1 = [[NSMutableDictionary alloc]init]; [d1 setValue:[NSString stringWithFormat:@"%d/2011",i+1] forKey:@"serial_data"]; [d1 setValue:@"Friday 13 Sep 12:00 AM" forKey:@"date_data"]; [d1 setValue:@"Description Details " forKey:@"details_data"]; [d1 setValue:@"Subject Line" forKey:@"subject_data"]; [temprecord addObject:d1]; d1= nil; [d1 release]; if([temprecord count]==TILE_COUNT) { NSMutableDictionary *holderKey = [[NSMutableDictionary alloc]initWithObjectsAndKeys:temprecord,[NSString stringWithFormat:@"%d",[casesListArray count]+1],nil]; [self.casesListArray addObject:holderKey]; [holderKey release]; holderKey =nil; [temprecord removeAllObjects]; } } else { [temprecord removeAllObjects]; NSMutableDictionary *d1 = [[NSMutableDictionary alloc]init]; [d1 setValue:[NSString stringWithFormat:@"%d/2011",i+1] forKey:@"serial_data"]; [d1 setValue:@"Friday 13 Sep 12:00 AM" forKey:@"date_data"]; [d1 setValue:@"Description Details " forKey:@"details_data"]; [d1 setValue:@"Subject Line" forKey:@"subject_data"]; [temprecord addObject:d1]; d1= nil; [d1 release]; } } return temprecord; [temprecord release]; } What is the problem with this Code ? Every time there are 9 records in Array, it just replaces the whole Array value instead of just for specific key Value.

    Read the article

  • Need Help with Consolidating RoR Google Map Results

    - by Kevin
    I have a project that returns geocoded results within 20 miles of the user. I want these results grouped on the map by zip code, then within the info window show the individual results. The code posted below works, but for some reason it only displays the 1.png rather than looking at the results and using the correct .png icon associated with the number. When I look at the infowindows, it displays the correct png like "/images/2.png" or "/images/5.png" but the actual image is always 1. @ziptickets = Ticket.find(:all, :origin => coords, :select => 'DISTINCT zip, lat, lng', :within => @user.distance_to_travel, :conditions => "status_id = 1") for t in @ziptickets zips = Ticket.find(:all, :conditions => ["zip = ?", t.zip]) currentzip = t.zip.to_s tixinzip = zips.size.to_s imagelocation = "/images/" + tixinzip + ".png" shadowlocation = "/images/" + tixinzip + "s.png" @map.icon_global_init(GIcon.new(:image => imagelocation, :shadow => shadowlocation, :shadow_size => GSize.new(60,40), :icon_anchor => GPoint.new(20,20), :info_window_anchor => GPoint.new(9,2)), "test") newicon = Variable.new("test") new_marker = GMarker.new([t.lat, t.lng], :icon => newicon, :title => imagelocation, :info_window => currentzip) @map.overlay_init(new_marker) end I tried changing the last part of the mapicon from: :info_window_anchor => GPoint.new(9,2)), "test") newicon = Variable.new("test") to: :info_window_anchor => GPoint.new(9,2)), currentzip) newicon = Variable.new(currentzip) but the strangest thing is that any string that has numbers in it causes the map to fail to render in the view and just show a blank screen... same if I replace it with :info_window_anchor => GPoint.new(9,2)), "123") newicon = Variable.new("123") Any advice would be helpful... also it runs a bit slower than my previous code which just set up 4 standard icons and used them outside of the loop so any hints as to speed up execution would be appreciated greatly. Thanks!

    Read the article

  • Why is my producer-consumer blocking?

    - by User007
    My code is here: http://pastebin.com/Fi3h0E0P Here is the output 0 Should we take order today (y or n): y Enter order number: 100 More customers (y or n): n Stop serving customers right now. Passing orders to cooker: There are total of 1 order(s) 1 Roger, waiter. I am processing order #100 The goal is waiter must take orders and then give them to the cook. The waiter has to wait cook finishes all pizza, deliver the pizza, and then take new orders. I asked how P-V work in my previous post here. I don't think it has anything to do with \n consuming? I tried all kinds of combination of wait(), but none work. Where did I make a mistake? The main part is here: //Producer process if(pid > 0) { while(1) { printf("0"); P(emptyShelf); // waiter as P finds no items on shelf; P(mutex); // has permission to use the shelf waiter_as_producer(); V(mutex); // cooker now can use the shelf V(orderOnShelf); // cooker now can pickup orders wait(); printf("2"); P(pizzaOnShelf); P(mutex); waiter_as_consumer(); V(mutex); V(emptyShelf); printf("3 "); } } if(pid == 0) { while(1) { printf("1"); P(orderOnShelf); // make sure there is an order on shelf P(mutex); //permission to work cooker_as_consumer(); // take order and put pizza on shelf printf("return from cooker"); V(mutex); //release permission printf("just released perm"); V(pizzaOnShelf); // pizza is now on shelf printf("after"); wait(); printf("4"); } } So I imagine this is the execution path: enter waiter_as_producer, then go to child process (cooker), then transfer the control back to parent, finish waiter_as_consumer, switch back to child. The two waits switch back to parent (like I said I tried all possible wait() combination...).

    Read the article

  • Reliable session faulting for unknown reason

    - by Scarfman007
    I am trying to achieve the following - one client-side proxy instance (kept open) accessed by multiple threads using a reliable session. What I have managed so far is to have either A) a reliable session with a client-side proxy which is created and disposed per call or B) what I aim for, but without a reliable session. When I enable reliable sessions on my binding however, the following behaviour is exhibited: Client-side Upon application startup everything appears to work fine until roughly 18 messages in to the WCF session. I firstly get the proxy.InnerChannel.Faulted event raised, then an exception is caught at the point where I am calling the method on the proxy. The exception is a System.TimeoutException, with message: "The request channel timed out while waiting for a reply after 00:00:59.9062512. Increase the timeout value passed to the call to Request or increase the SendTimeout value on the Binding. The time allotted to this operation may have been a portion of a longer timeout." The inner exception has a similar message: "The request operation did not complete within the allotted timeout of 00:01:00. The time allotted to this operation may have been a portion of a longer timeout." With the method at the top of the inner stack trace being: System.ServiceModel.Channels.ReliableRequestSessionChannel.SyncRequest.WaitForReply(TimeSpan timeout) I then call proxy.Close followed by proxy.Abort (catching and ignoring exceptions). If I utilize the default settings (i.e. have simply <reliableSession/>), then calling proxy. Close results in another System.Timeout exception (although this time the allotted timeout is 00:00:00), however if I override the defaults as specified above no exception is thrown. Service-side Utilizing WCF tracing I get a System.ServiceModel.CommunicationException, with message: "The sequence has been terminated by the remote endpoint. The session has stopped waiting for a particular reply. Because of this the reliable session cannot continue. The reliable session was faulted." And a stack trace ending at: System.ServiceModel.AsyncResult.End[TAsyncResult](IAsyncResult result) When remotely attaching to the server I get the same message, which occurs when code execution steps over the return statement of my service in the service call which causes the error. The puzzling thing to me is that the service is stable and runs with options A) or B) as decribed at the beginning of my post, and occurs after a varying number of messages (around 18). The former fact points to there being nothing wrong with the code (indeed I have checked that no exceptions are thrown), and the latter just serves to confuse me and is why I modified the settings on the reliable session binding. I am quite stuck on this. Can anyone suggest why the reliable session would fault in such a way?

    Read the article

  • sharepoint custom aspx page with database connection

    - by Megini
    hi there i have created a custom aspx page whithin my sharepoint site with a sql server connection to a database on that server to select data when i view the page it works but when another user tries to view it it gives the following error : Server Error in '/' Application. Login failed for user 'GRINCOR\GuguK'. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Data.SqlClient.SqlException: Login failed for user 'GRINCOR\GuguK'. Source Error: The source code that generated this unhandled exception can only be shown when compiled in debug mode. To enable this, please follow one of the below steps, then request the URL: Add a "Debug=true" directive at the top of the file that generated the error. Example: <%@ Page Language="C#" Debug="true" % or: 2) Add the following section to the configuration file of your application: Note that this second technique will cause all files within a given application to be compiled in debug mode. The first technique will cause only that particular file to be compiled in debug mode. Important: Running applications in debug mode does incur a memory/performance overhead. You should make sure that an application has debugging disabled before deploying into production scenario. Stack Trace: [SqlException (0x80131904): Login failed for user 'GRINCOR\GuguK'.] System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) +248 System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) +245 System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) +2811 System.Data.SqlClient.SqlInternalConnectionTds.CompleteLogin(Boolean enlistOK) +53 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, Int64 timerExpire, SqlConnection owningObject) +327 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(String host, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, Int64 timerStart) +2445370 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +2445224 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +354 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +703 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +54 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +2414776 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +92 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +1657 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +84 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +1645767 System.Data.SqlClient.SqlConnection.Open() +258 ASP.d7922f0d_ac20_4f87_91a2_a99a52c2b2fa__233736835.DisplayData() in C:\inetpub\wwwroot\wss\VirtualDirectories\80\sites\hrportal2\tester.aspx:151 ASP.d7922f0d_ac20_4f87_91a2_a99a52c2b2fa_233736835._RenderMain(HtmlTextWriter __w, Control parameterContainer) in C:\inetpub\wwwroot\wss\VirtualDirectories\80\sites\hrportal2\tester.aspx:346 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +115 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +42 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlForm.RenderChildren(HtmlTextWriter writer) +253 System.Web.UI.HtmlControls.HtmlForm.Render(HtmlTextWriter output) +87 System.Web.UI.HtmlControls.HtmlForm.RenderControl(HtmlTextWriter writer) +53 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.HtmlControls.HtmlContainerControl.Render(HtmlTextWriter writer) +42 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +240 System.Web.UI.Page.Render(HtmlTextWriter writer) +38 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +4240 Version Information: Microsoft .NET Framework Version:2.0.50727.3603; ASP.NET Version:2.0.50727.3601 can someone give me a solution to this problem ? i am using sharepoint services 3.0

    Read the article

  • Neo4j 1.9.4 (REST Server,CYPHER) performance issue

    - by user2968943
    I have Neo4j 1.9.4 installed on 24 core 24Gb ram (centos) machine and for most queries CPU usage spikes goes to 200% with only few concurrent requests. Domain: some sort of social application where few types of nodes(profiles) with 3-30 text/array properties and 36 relationship types with at least 3 properties. Most of nodes currently has ~300-500 relationships. Current data set footprint(from console): LogicalLogSize=4294907 (32MB) ArrayStoreSize=1675520 (12MB) NodeStoreSize=1342170 (10MB) PropertyStoreSize=1739548 (13MB) RelationshipStoreSize=6395202 (48MB) StringStoreSize=1478400 (11MB) which is IMHO really small. most queries looks like this one(with more or less WITH .. MATCH .. statements and few queries with variable length relations but the often fast): START targetUser=node({id}), currentUser=node({current}) MATCH targetUser-[contact:InContactsRelation]->n, n-[:InLocationRelation]->l, n-[:InCategoryRelation]->c WITH currentUser, targetUser,n, l,c, contact.fav is not null as inFavorites MATCH n<-[followers?:InContactsRelation]-() WITH currentUser, targetUser,n, l,c,inFavorites, COUNT(followers) as numFollowers RETURN id(n) as id, n.name? as name, n.title? as title, n._class as _class, n.avatar? as avatar, n.avatar_type? as avatar_type, l.name as location__name, c.name as category__name, true as isInContacts, inFavorites as isInFavorites, numFollowers it runs in ~1s-3s(for first run) and ~1s-70ms (for consecutive and it depends on query) and there is about 5-10 queries runs for each impression. Another interesting behavior is when i try run query from console(neo4j) on my local machine many consecutive times(just press ctrl+enter for few seconds) it has almost constant execution time but when i do it on server it goes slower exponentially and i guess it somehow related with my problem. Problem: So my problem is that neo4j is very CPU greedy(for 24 core machine its may be not an issue but its obviously overkill for small project). First time i used AWS EC2 m1.large instance but over all performance was bad, during testing, CPU always was over 100%. Some relevant parts of configuration: neostore.nodestore.db.mapped_memory=1280M wrapper.java.maxmemory=8192 note: I already tried configuration where all memory related parameters where HIGH and it didn't worked(no change at all). Question: Where to digg? configuration? scheme? queries? what i'm doing wrong? if need more info(logs, configs) just ask ;)

    Read the article

  • Java Socket Connection is flooding network OR resulting in high ping

    - by user1461100
    i have a little problem with my java socket code. I'm writing an android client application which is sending data to a java multithreaded socket server on my pc through direct(!) wireless connection. It works fine but i want to improve it for mobile applications as it is very power consuming by now. When i remove two special lines in my code, the cpu usage of my mobile device (htc one x) is totally okay but then my connection seems to have high ping rates or something like that... Here is a server code snippet where i receive the clients data: while(true) { try { .... Object obj = in.readObject(); if(obj != null) { Class clazz = obj.getClass(); String className = clazz.getName(); if(className.equals("java.lang.String")) { String cmd = (String)obj; if(cmd.equals("dc")) { System.out.println("Client "+id+" disconnected!"); Server.connectedClients[id-1] = false; break; } if(cmd.substring(0,1).equals("!")) { robot.keyRelease(PlayerEnum.getKey(cmd,id)); } else { robot.keyPress(PlayerEnum.getKey(cmd,id)); } } } } catch .... Heres the client part, where i send my data in a while loop: private void networking() { try { if(client != null) { .... out.writeObject(sendQueue.poll()); .... } } catch .... when i write it this why, i send data everytime the while loop gets executed.. when sendQueue is empty, a null "Object" will be send. this results in "high" network traffic and in "high" cpu usage. BUT: all send comments are received nearly immediately. when i change the code to following: while(true) ... if(sendQueue.peek() != null) { out.writeObject(sendQueue.poll()); } ... the cpu usage is totally okay but i'm getting some laggs.. the commands do not arrive fast enough.. as i said, it works fine (besides cpu usage) if i'm sending data(with that null objects) every while execution. but i'm sure that this is very rough coding style because i'm kind of flooding the network. any hints? what am i doing wrong?? Thanks for your Help! Sincerly yours, maaft

    Read the article

  • SQL Server CTE referred in self joins slow

    - by Kharlos Dominguez
    Hello, I have written a table-valued UDF that starts by a CTE to return a subset of the rows from a large table. There are several joins in the CTE. A couple of inner and one left join to other tables, which don't contain a lot of rows. The CTE has a where clause that returns the rows within a date range, in order to return only the rows needed. I'm then referencing this CTE in 4 self left joins, in order to build subtotals using different criterias. The query is quite complex but here is a simplified pseudo-version of it WITH DataCTE as ( SELECT [columns] FROM table INNER JOIN table2 ON [...] INNER JOIN table3 ON [...] LEFT JOIN table3 ON [...] ) SELECT [aggregates_columns of each subset] FROM DataCTE Main LEFT JOIN DataCTE BananasSubset ON [...] AND Product = 'Bananas' AND Quality = 100 LEFT JOIN DataCTE DamagedBananasSubset ON [...] AND Product = 'Bananas' AND Quality < 20 LEFT JOIN DataCTE MangosSubset ON [...] GROUP BY [ I have the feeling that SQL Server gets confused and calls the CTE for each self join, which seems confirmed by looking at the execution plan, although I confess not being an expert at reading those. I would have assumed SQL Server to be smart enough to only perform the data retrieval from the CTE only once, rather than do it several times. I have tried the same approach but rather than using a CTE to get the subset of the data, I used the same select query as in the CTE, but made it output to a temp table instead. The version referring the CTE version takes 40 seconds. The version referring the temp table takes between 1 and 2 seconds. Why isn't SQL Server smart enough to keep the CTE results in memory? I like CTEs, especially in this case as my UDF is a table-valued one, so it allowed me to keep everything in a single statement. To use a temp table, I would need to write a multi-statement table valued UDF, which I find a slightly less elegant solution. Did some of you had this kind of performance issues with CTE, and if so, how did you get them sorted? Thanks, Kharlos

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • Having trouble wrapping functions in the linux kernel

    - by Corey Henderson
    I've written a LKM that implements Trusted Path Execution (TPE) into your kernel: https://github.com/cormander/tpe-lkm I run into an occasional kernel OOPS (describe at the end of this question) when I define WRAP_SYSCALLS to 1, and am at my wit's end trying to track it down. A little background: Since the LSM framework doesn't export its symbols, I had to get creative with how I insert the TPE checking into the running kernel. I wrote a find_symbol_address() function that gives me the address of any function I need, and it works very well. I can call functions like this: int (*my_printk)(const char *fmt, ...); my_printk = find_symbol_address("printk"); (*my_printk)("Hello, world!\n"); And it works fine. I use this method to locate the security_file_mmap, security_file_mprotect, and security_bprm_check functions. I then overwrite those functions with an asm jump to my function to do the TPE check. The problem is, the currently loaded LSM will no longer execute the code for it's hook to that function, because it's been totally hijacked. Here is an example of what I do: int tpe_security_bprm_check(struct linux_binprm *bprm) { int ret = 0; if (bprm->file) { ret = tpe_allow_file(bprm->file); if (IS_ERR(ret)) goto out; } #if WRAP_SYSCALLS stop_my_code(&cs_security_bprm_check); ret = cs_security_bprm_check.ptr(bprm); start_my_code(&cs_security_bprm_check); #endif out: return ret; } Notice the section between the #if WRAP_SYSCALLS section (it's defined as 0 by default). If set to 1, the LSM's hook is called because I write the original code back over the asm jump and call that function, but I run into an occasional kernel OOPS with an "invalid opcode": invalid opcode: 0000 [#1] SMP RIP: 0010:[<ffffffff8117b006>] [<ffffffff8117b006>] security_bprm_check+0x6/0x310 I don't know what the issue is. I've tried several different types of locking methods (see the inside of start/stop_my_code for details) to no avail. To trigger the kernel OOPS, write a simple bash while loop that endlessly starts a backgrounded "ls" command. After a minute or so, it'll happen. I'm testing this on a RHEL6 kernel, also works on Ubuntu 10.04 LTS (2.6.32 x86_64). While this method has been the most successful so far, I have tried another method of simply copying the kernel function to a pointer I created with kmalloc but when I try to execute it, I get: kernel tried to execute NX-protected page - exploit attempt? (uid: 0). If anyone can tell me how to kmalloc space and have it marked as executable, that would also help me solve the above problem. Any help is appreciated!

    Read the article

  • Poor performance / speed of regex with lookahead

    - by Hugo Zaragoza
    I have been observing extremely slow execution times with expressions with several lookaheads. I suppose that this is due to underlying data structures, but it seems pretty extreme and I wonder if I do something wrong or if there are known work-arounds. The problem is determining if a set of words are present in a string, in any order. For example we want to find out if two terms "term1" AND "term2" are somewhere in a string. I do this with the expresion: (?=.*\bterm1\b)(?=.*\bterm2\b) But what I observe is that this is an order of magnitude slower than checking first just \bterm1\b and just then \bterm2\b This seems to indicate that I should use an array of patterns instead of a single pattern with lookaheads... is this right? it seems wrong... Here is an example test code and resulting times: public static void speedLookAhead() { Matcher m, m1, m2; boolean find; int its = 1000000; // create long non-matching string char[] str = new char[2000]; for (int i = 0; i < str.length; i++) { str[i] = 'x'; } String test = str.toString(); // First method: use one expression with lookaheads m = Pattern.compile("(?=.*\\bterm1\\b)(?=.*\\bterm2\\b)").matcher(test); long time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m.reset(test); find = m.find(); } time = System.currentTimeMillis() - time; System.out.println(time); // Second method: use two expressions and AND the results m1 = Pattern.compile("\\bterm1\\b").matcher(test); m2 = Pattern.compile("\\bterm2\\b").matcher(test); time = System.currentTimeMillis(); ; for (int i = 0; i < its; i++) { m1.reset(test); m2.reset(test); find = m1.find() && m2.find(); } time = System.currentTimeMillis() - time; System.out.println(time); } This outputs in my computer: 1754 150

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • dynamic module creation

    - by intuited
    I'd like to dynamically create a module from a dictionary, and I'm wondering if adding an element to sys.modules is really the best way to do this. EG context = { a: 1, b: 2 } import types test_context_module = types.ModuleType('TestContext', 'Module created to provide a context for tests') test_context_module.__dict__.update(context) import sys sys.modules['TestContext'] = test_context_module My immediate goal in this regard is to be able to provide a context for timing test execution: import timeit timeit.Timer('a + b', 'from TestContext import *') It seems that there are other ways to do this, since the Timer constructor takes objects as well as strings. I'm still interested in learning how to do this though, since a) it has other potential applications; and b) I'm not sure exactly how to use objects with the Timer constructor; doing so may prove to be less appropriate than this approach in some circumstances. EDITS/REVELATIONS/PHOOEYS/EUREKAE: I've realized that the example code relating to running timing tests won't actually work, because import * only works at the module level, and the context in which that statement is executed is that of a function in the testit module. In other words, the globals dictionary used when executing that code is that of main, since that's where I was when I wrote the code in the interactive shell. So that rationale for figuring this out is a bit botched, but it's still a valid question. I've discovered that the code run in the first set of examples has the undesirable effect that the namespace in which the newly created module's code executes is that of the module in which it was declared, not its own module. This is like way weird, and could lead to all sorts of unexpected rattlesnakeic sketchiness. So I'm pretty sure that this is not how this sort of thing is meant to be done, if it is in fact something that the Guido doth shine upon. The similar-but-subtly-different case of dynamically loading a module from a file that is not in python's include path is quite easily accomplished using imp.load_source('NewModuleName', 'path/to/module/module_to_load.py'). This does load the module into sys.modules. However this doesn't really answer my question, because really, what if you're running python on an embedded platform with no filesystem? I'm battling a considerable case of information overload at the moment, so I could be mistaken, but there doesn't seem to be anything in the imp module that's capable of this. But the question, essentially, at this point is how to set the global (ie module) context for an object. Maybe I should ask that more specifically? And at a larger scope, how to get Python to do this while shoehorning objects into a given module?

    Read the article

  • How can a C/C++ program put itself into background?

    - by Larry Gritz
    What's the best way for a running C or C++ program that's been launched from the command line to put itself into the background, equivalent to if the user had launched from the unix shell with '&' at the end of the command? (But the user didn't.) It's a GUI app and doesn't need any shell I/O, so there's no reason to tie up the shell after launch. But I want a shell command launch to be auto-backgrounded without the '&' (or on Windows). Ideally, I want a solution that would work on any of Linux, OS X, and Windows. (Or separate solutions that I can select with #ifdef.) It's ok to assume that this should be done right at the beginning of execution, as opposed to somewhere in the middle. One solution is to have the main program be a script that launches the real binary, carefully putting it into the background. But it seems unsatisfying to need these coupled shell/binary pairs. Another solution is to immediately launch another executed version (with 'system' or CreateProcess), with the same command line arguments, but putting the child in the background and then having the parent exit. But this seems clunky compared to the process putting itself into background. Edited after a few answers: Yes, a fork() (or system(), or CreateProcess on Windows) is one way to sort of do this, that I hinted at in my original question. But all of these solutions make a SECOND process that is backgrounded, and then terminate the original process. I was wondering if there was a way to put the EXISTING process into the background. One difference is that if the app was launched from a script that recorded its process id (perhaps for later killing or other purpose), the newly forked or created process will have a different id and so will not be controllable by any launching script, if you see what I'm getting at. Edit #2: fork() isn't a good solution for OS X, where the man page for 'fork' says that it's unsafe if certain frameworks or libraries are being used. I tried it, and my app complains loudly at runtime: "The process has forked and you cannot use this CoreFoundation functionality safely. You MUST exec()." I was intrigued by daemon(), but when I tried it on OS X, it gave the same error message, so I assume that it's just a fancy wrapper for fork() and has the same restrictions. Excuse the OS X centrism, it just happens to be the system in front of me at the moment. But I am indeed looking for a solution to all three platforms.

    Read the article

< Previous Page | 134 135 136 137 138 139 140 141 142 143 144 145  | Next Page >