Search Results

Search found 5064 results on 203 pages for 'automatic ref counting'.

Page 14/203 | < Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >

  • Counting Sublist Elements in Prolog

    - by idea_
    How can I count nested list elements in prolog? I have the following predicates defined, which will count a nested list as one element: length([ ], 0). length([H|T],N) :- length(T,M), N is M+1. Usage: ?- length([a,b,c],Out). Out = 3 This works, but I would like to count nested elements as well i.e. length([a,b,[c,d,e],f],Output). ?- length([a,b,[c,d,e],f],Output). Output = 6

    Read the article

  • Counting array in API JSON Response

    - by bryan
    I'm trying to do a simple count of how many refunds are in my Stripe Response but count() isn't working and I don't really know any other way of achieving this. Could anyone point me in the right direction? $retrieve_event = Stripe_Event::retrieve("evt_00000000000000"); $event_json_id = json_decode($retrieve_event); $refund_array = $event_json_id->{'data'}->{'object'}->{'refunds'}; die(count($refund_array)); This is the response of $retrieve_event { "created": 1326853478, "livemode": false, "id": "evt_00000000000000", "type": "charge.refunded", "object": "event", "request": null, "data": { "object": { "id": "ch_00000000000000", "object": "charge", "created": 1402433517, "livemode": false, "paid": true, "amount": 1000, "currency": "usd", "refunded": true, "card": { "id": "card_00000000000000", "object": "card", "last4": "0028", "type": "Visa", "exp_month": 8, "exp_year": 2015, "fingerprint": "a5KWlTcrmCYk5DIYa", "country": "US", "name": "First Last", "address_line1": "null", "address_line2": null, "address_city": "null", "address_state": "null", "address_zip": "null", "address_country": "US", "cvc_check": null, "address_line1_check": "fail", "address_zip_check": "pass", "customer": "cus_00000000000000" }, "captured": true, "refunds": [ { "id": "re_104CKt4uGeYuVLAahMwLA2TK", "amount": 100, "currency": "usd", "created": 1402433533, "object": "refund", "charge": "ch_104CKt4uGeYuVLAazSyPqqLV", "balance_transaction": "txn_104CKt4uGeYuVLAaSNZCR867", "metadata": {} }, { "id": "re_104CKt4uGeYuVLAaDIMHoIos", "amount": 200, "currency": "usd", "created": 1402433539, "object": "refund", "charge": "ch_104CKt4uGeYuVLAazSyPqqLV", "balance_transaction": "txn_104CKt4uGeYuVLAaqSwkNKPO", "metadata": {} }, { "id": "re_4CL6n1r91dY5ME", "amount": 700, "currency": "usd", "created": 1402434306, "object": "refund", "charge": "ch_4CL6FNWhGzVuAV", "balance_transaction": "txn_4CL6qa4vwlVaDJ" } ], "balance_transaction": "txn_00000000000000", "failure_message": null, "failure_code": null, "amount_refunded": 1000, "customer": "cus_00000000000000", "invoice": null, "description": "this is a description", "dispute": null, "metadata": {}, "statement_description": "this is a description", "fee": 0 } } }

    Read the article

  • problem in counting two fields in one query

    - by Mac Taylor
    hey guys i need to count new private messages and old one from a table so first thing come to mind is using mysql_num_rows and easy thing to do // check new pms $user_id = $userinfo['user_id']; $sql = "SELECT author_id FROM bb3privmsgs_to WHERE user_id='$user_id' AND (pm_new='1' OR pm_unread='1')"; $result = $db->sql_query($sql) ; $new_pms = $db->sql_numrows($result); $db->sql_freeresult($result); // check old pms $sql = "SELECT author_id FROM bb3privmsgs_to WHERE user_id='$user_id' AND (pm_new='0' OR pm_unread='0')"; $result = $db->sql_query($sql) ; $old_pms = $db->sql_numrows($result); $db->sql_freeresult($result); but how can i count these two fields just in one statement and shorter lines ?~

    Read the article

  • Excel - Counting unique values that meet multiple criteria

    - by wotaskd
    I'm trying to use a function to count the number of unique cells in a spreadsheet that, at the same time, meet multiple criteria. Given the following example: A B C QUANT STORE# PRODUCT 1 75012 banana 5 orange 6 56089 orange 3 89247 orange 7 45321 orange 2 apple 4 45321 apple In the example above, I need to know how many unique stores with a valid STORE# have received oranges OR apples. In the case above, the result should be 3 (stores 56089, 89247 and 45321). This is how I started to try solving the problem: =SUM(IF(FREQUENCY(B2:B9,B2:B9)>0,1)) The above formula will yield the number of unique stores with a valid store#, but not just the ones that have received oranges or bananas. How can I add that extra criteria?

    Read the article

  • Counting vowels

    - by user74283
    Can anyone please tell me what is wrong with this script. I am a python newb but i cant seem to figure out what might be causing it not to function. def find_vowels(sentence): """ >>> find_vowels(test) e """ count = 0 vowels = "aeiuoAEIOU" for letter in sentence: if letter in vowels: count += 1 print count if __name__ == '__main__': import doctest doctest.testmod()

    Read the article

  • Java Counting # of occurrences of a word in a string

    - by Doug
    I have a large text file I am reading from and I need to find out how many times some words come up. For example, the word "the". I'm doing this line by line each line is a string. I need to make sure that I only count legit "the"'s the the in other would not count. This means I know I need to use regular expressions in some way. What I was trying so far is this: numSpace += line.split("[^a-z]the[^a-z]").length; I realize the regular expression may not be correct at the moment but I tried without that and just tried to find occurrences of the word the and I get wrong numbers to. I was under the impression this would split the string up into an array and how many times that array was split up was how many times the word is in the string. Any ideas I would be grateful.

    Read the article

  • data structure for counting frequencies in a database table-like format

    - by user373312
    i was wondering if there is a data structure optimized to count frequencies against data that is stored in a database table-like format. for example, the data comes in a (comma) delimited format below. col1, col2, col3 x, a, green x, b, blue ... y, c, green now i simply want to count the frequency of col1=x or col1=x and col2=green. i have been storing the data in a database table, but in my profiling and from empirical observation, database connection is the bottle-neck. i have tried using in-memory database solutions too, and that works quite well; the only problem is memory requirements and quirky init/destroy calls. also, i work mainly with java, but have experience with .net, and was wondering if there was any api to work with "tabular" data in a linq way using java. any help is appreciated.

    Read the article

  • Code Golf: Counting XML elements in file on Android

    - by CSharperWithJava
    Take a simple XML file formatted like this: <Lists> <List> <Note/> ... <Note/> </List> <List> <Note/> ... <Note/> </List> </Lists> Each node has some attributes that actually hold the data of the file. I need a very quick way to count the number of each type of element, (List and Note). Lists is simply the root and doesn't matter. I can do this with a simple string search or something similar, but I need to make this as fast as possible. Design Parameters: Must be in java (Android application). Must AVOID allocating memory as much as possible. Must return the total number of Note elements and the number of List elements in the file, regardless of location in file. Number of Lists will typically be small (1-4), and number of notes can potentially be very large (upwards of 1000, typically 100) per file. I look forward to your suggestions.

    Read the article

  • Counting point size based on chart area during zooming/unzoomin

    - by Gacek
    Hi folks. I heave a quite simple task. I know (I suppose) it should be easy, but from the reasons I cannot understand, I try to solve it since 2 days and I don't know where I'm making the mistake. So, the problem is as follows: - we have a chart with some points - The chart starts with some known area and points have known size - we would like to "emulate" the zooming effect. So when we zoom to some part of the chart, the size of points is getting proportionally bigger. In other words, the smaller part of the chart we select, the bigger the point should get. So, we have something like that. We know this two parameters: initialArea; // Initial area - area of the whole chart, counted as width*height initialSize; // initial size of the points Now lets assume we are handling some kind of OnZoom event. We selected some part of the chart and would like to count the current size of the points float CountSizeOnZoom() { float currentArea = CountArea(...); // the area is counted for us. float currentSize = initialSize * initialArea / currentArea; return currentSize; } And it works. But the rate of change is too fast. In other words, the points are getting really big too soon. So I would like the currentSize to be invertly proportional to currentArea, but with some scaling coefficient. So I created the second function: float CountSizeOnZoom() { float currentArea = CountArea(...); % the area is counted for us. // Lets assume we want the size of points to change ten times slower, than area of the chart changed. float currentSize = initialSize + 0.1f* initialSize * ((initialArea / currentArea) -1); return currentSize; } Lets do some calculations in mind. if currentArea is smaller than initialArea, initialArea/currentArea > 1 and then we add "something" small and postive to initialSize. Checked, it works. Lets check what happens if we would un-zoom. currentArea will be equal to initialArea, so we would have 0 at the right side (1-1), so new size should be equal to initialSize. Right? Yeah. So lets check it... and it doesn't work. My question is: where is the mistake? Or maybe you have any ideas how to count this scaled size depending on current area in some other way?

    Read the article

  • jQuery Grouping Similar Items and Counting When Repeated

    - by NessDan
    So I have this structure setup: <ul> <li>http://www.youtube.com/watch?v=dw1Vh9Yzryo</li> (Vid1) <li>http://www.youtube.com/watch?v=bOF3o8B292U</li> (Vid2) <li>http://www.youtube.com/watch?v=yAY4vNJd7A8</li> (Vid3) <li>http://www.youtube.com/watch?v=yAY4vNJd7A8</li> <li>http://www.youtube.com/watch?v=dw1Vh9Yzryo</li> <li>http://www.youtube.com/watch?v=bOF3o8B292U</li> <li>http://www.youtube.com/watch?v=yAY4vNJd7A8</li> <li>http://www.youtube.com/watch?v=dw1Vh9Yzryo</li> </ul> Vid1 is repeated 3 times, Vid2 is repeated 3 times, and Vid3 is repeated 2 times. I want to put them into a structure where I can reference them like this: Vid1 - 3 (Repeated), http://www.youtube.com/get_video?video_id=dw1Vh9Yzryo&fmt=36 (Download) Vid2 - 3 (Repeated), http://www.youtube.com/get_video?video_id=bOF3o8B292U&fmt=36 (Download) Vid3 - 2 (Repeated), http://www.youtube.com/get_video?video_id=yAY4vNJd7A8&fmt=36 (Download) "This video was repeated " + [Vid1][Repeated] + " times and you can download it here: " + [Vid1][Download]; How can I set this structure up? I think I should be using an array to achieve the above but I'm not sure how I would set it up or how to reference certain things in the array. The other question is how can I get how many times something was repeated? The URL I have no problem with. Can anyone help me out?

    Read the article

  • Ruby: counters, counting and incrementing

    - by Shyam
    Hi, If you have seen my previous questions, you'd already know I am a big nuby when it comes to Ruby. So, I discovered this website which is intended for C programming, but I thought whatever one can do in C, must be possible in Ruby (and more readable too). The challenge is to print out a bunch of numbers. I discovered this nifty method .upto() and I used a block (and actually understanding its purpose). However, in IRb, I got some unexpected behavior. class MyCounter def run 1.upto(10) { |x| print x.to_s + " " } end end irb(main):033:0> q = MyCounter.new => #<MyCounter:0x5dca0> irb(main):034:0> q.run 1 2 3 4 5 6 7 8 9 10 => 1 I have no idea where the = 1 comes from :S Should I do this otherwise? I am expecting to have this result: 1 2 3 4 5 6 7 8 9 10 Thank you for your answers, comments and feedback!

    Read the article

  • Counting vowels in a string using recursion

    - by Daniel Love Jr
    In my python class we are learning about recursion. I understand that it's when a function calls itself, however for this particular assignment I can't figure out how exactly to get my function to call it self to get the desired results. I need to simply count the vowels in the string given to the function. def recVowelCount(s): 'return the number of vowels in s using a recursive computation' vowelcount = 0 vowels = "aEiou".lower() if s[0] in vowels: vowelcount += 1 else: ??? I'm really not sure where to go with this, it's quite frustrating. I came up with this in the end, thanks to some insight from here. def recVowelCount(s): 'return the number of vowels in s using a recursive computation' vowels = "aeiouAEIOU" if s == "": return 0 elif s[0] in vowels: return 1 + recVowelCount(s[1:]) else: return 0 + recVowelCount(s[1:])

    Read the article

  • Tracking/Counting Word Frequency

    - by Joel Martinez
    I'd like to get some community consensus on a good design to be able to store and query word frequency counts. I'm building an application in which I have to parse text inputs and store how many times a word has appeared (over time). So given the following inputs: "To Kill a Mocking Bird" "Mocking a piano player" Would store the following values: Word Count ------------- To 1 Kill 1 A 2 Mocking 2 Bird 1 Piano 1 Player 1 And later be able to quickly query for the count value of a given arbitrary word. My current plan is to simply store the words and counts in a database, and rely on caching word count values ... But I suspect that I won't get enough cache hits to make this a viable solution long term. Can anyone suggest algorithms, or data structures, or any other idea that might make this a well-performing solution?

    Read the article

  • Java - Counting how many characters show up in another string

    - by Vu Châu
    I am comparing two strings, in Java, to see how many characters from the first string show up in the second string. The following is some expectations: matchingChars("AC", "BA") ? 1 matchingChars("ABBA", "B") ? 2 matchingChars("B", "ABBA") ? 1 My approach is as follows: public int matchingChars(String str1, String str2) { int count = 0; for (int a = 0; a < str1.length(); a++) { for (int b = 0; b < str2.length(); b++) { char str1Char = str1.charAt(a); char str2Char = str2.charAt(b); if (str1Char == str2Char) { count++; str1 = str1.replace(str1Char, '0'); } } } return count; } I know my approach is not the best, but I think it should do it. However, for matchingChars("ABBA", "B") ? 2 My code yields "1" instead of "2". Does anyone have any suggestion or advice? Thank you very much.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Creating LINQ to SQL for counting a parameter

    - by Matt
    I'm trying to translate a sql query into LINQ to SQL. I keep getting an error "sequence operators not supported for type 'system.string'" If I take out the distinct count part, it works. Is it not because I'm using the GROUP BY? SELECT COUNT(EpaValue) AS [Leak Count], Location, EpaValue AS [Leak Desc.] FROM ChartMes.dbo.RecourceActualEPA_Report WHERE (EpaName = N'LEAK1') AND (Timestamp) '20100429030000' GROUP BY EpaValue, Location ORDER BY Location, [Leak Count] DESC Dim temp = (From p In db2.RecourceActualEPA_Reports _ Where (p.Timestamp = str1stShiftStart) And (p.Timestamp < str2ndShiftCutoff) _ And (p.EpaName = "Leak1") _ Select p.EpaName.Distinct.Count(), p.Location, p.EpaValue)

    Read the article

  • Counting number of GC cleanups on an object

    - by tsps
    How do I keep a count of the number of times that objects of a specific class (type?) are getting disposed in the lifetime of my application. Imagine I have a class A, now, I want to count how many times the objects of A get collected by the GC. I hope I am phrasing this right because I was asked this in an interview today and the answer I gave did not satisfy the interviewer. And this is what I imagine he was trying to ask. What I said was that one could keep a static field called count in the class A and increment it in the Finalize() call of that object. The answer he was expecting was something called a static block. I've never heard of this in .NET/C#. Can someone explain what's this static block?

    Read the article

  • jquery parent/children selector for counting <li>

    - by Kreker
    Hi. I have this piece of HTML <div id="fileTreeInviati"> <ul class="php-file-tree"> <li class="pft-directory"> <a href="#" class="" name="101">A006 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-png"> <a href="javascript:getInfoFile('4');" class="" id="4">cut.png</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('27');" class="new" id="27">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="102">A012 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-jpg"> <a href="javascript:getInfoFile('19');" class="new" id="19">04.jpg</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('24');" class="new" id="24">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="103">A014 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-txt"> <a href="javascript:getInfoFile('17');" class="new" id="17">acu.txt</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('22');" class="new" id="22">Safari.dll</a> </li> </ul> </li> </ul> I'm working on a js snippet that cycle through all "a" of the "li" and checks if it has the class "new" if yes increment a counter by one. This counter now has to be printed on the relative "li" "span" 3 level before. So I have the number of the element with the "new" class. The js snippet is this $("#fileTreeInviati .php-file-tree .pft-directory li").each(function(){ $(this).children("a").each(function(i,e){ if ($(e).hasClass("new")){ cont++; console.log($(e).text()); $(this).parent().parent().parent().children("a").children("span").text(cont); } }) cont = 0; }); I think I'm almost there but the counter is always 1. I think there is something mess with .children, maybe it can handle only the first occurrence? Thanks for help

    Read the article

  • Counting unique values in a column with a shell script

    - by Lilly Tooner
    Hello. I have a tab delimited file with 5 columns and need to retrieve a count of just the number of unique lines from column 2. I would normally do this with Perl/Python but I am forced to use the shell for this one. I have successfully in the past used *nix uniq function piped to wc but it looks like I am going to have to use awk in here. Any advice would be greatly appreciated. (I have asked a similar question previously about column checks using awk but this is a little different and I wanted to separate it so if someone in the future has this question this will be here) Many many thanks! Lilly

    Read the article

  • Powershell - remote folder availability while counting files

    - by ziklop
    I´m trying to make a Powershell script that reports if there´s a file older than x minutes on remote folder. I make this: $strfolder = 'folder1 ..................' $pocet = (Get-ChildItem \\server1\edi1\folder1\*.* ) | where-object {($_.LastWriteTime -lt (Get-Date).AddDays(-0).AddHours(-0).AddMinutes(-20))} | Measure-Object if($pocet.count -eq 0){Write-Host $strfolder "OK" -foreground Green} else {Write-Host $strfolder "ERROR" -foreground Red} But there´s one huge problem. The folder is often unavailable for me bacause of the high load and I found out when there is no connection it doesn´t report an error but continues with zero in $pocet.count. It means it reports everything is ok when the folder is unavailable. I was thinking about using if(Test-Path..) but what about it became unavailable just after passing Test-Path? Does anyone has a solution please? Thank you in advance

    Read the article

  • Overriding form submit based on counting elements with jquery.each

    - by MrGrigg
    I am probably going about this all wrong, but here's what I'm trying to do: I have a form that has approximately 50 select boxes that are generated dynamically based on some database info. I do not have control over the IDs of the text boxes, but I can add a class to each of them. Before the form is submitted, the user needs to select at least one item from the select box, but no more than four. I'm a little bit sleepy, and I'm unfamiliar with jQuery overall, but I'm trying to override $("form").submit, and here's what I'm doing. Any advice or suggestions are greatly appreciated. $("form").submit(function() { $('.sportsCoachedValidation').each(function() { if ($('.sportsCoachedValidation :selected').text() != 'N/A') { sportsSelected++ } }); if (sportsSelected >= 1 && sportsSelected <= 4) { return true; } else if (sportsSelected > 4) { alert('You can only coach up to four sports.'); sportsSelected = 0; return false; } else { alert('Please select at least one coached sport.'); sportsSelected = 0; return false; } });

    Read the article

  • Counting arrays in loop

    - by Ivory Santos
    I have a loop... while($rows=mysql_fetch_array($result)) { $staff[] = $rows['staff']; $a = array_count_values($staff); $b = count($a); echo"$b<br>"; } that output 1 1 1 2 2 2 3 3 4 5 5 on my research, it must be and I wanted the result to be this way 3 (is equal to three 1's) 3 (is equal to three 2's) 2 (is equal to two 3) 1 (is equal to one 4) 2 (is equal to two 5's) any help? what I want is to get the number of same element in an array

    Read the article

  • Counting the number of occurrences of characters in an array

    - by Anthony Pittelli
    This is what I have but it is not working, this is confusing for me. If you scroll down I commented on someones post the exact problem I am having and what I am trying to do. I was thinking maybe the problem is my code to generate the random characters: public void add (char fromChar, char toChar){ Random r = new Random(); //creates a random object int randInt; for (int i=0; i<charArray.length; i++){ randInt = r.nextInt((toChar-fromChar) +1); charArray[i] = (char) randInt; //casts these integers as characters } }//end add public int[] countLetters() { int[] count = new int[26]; char current; for (int b = 0; b <= 26; b++) { for (int i = 97; i <= 123; i++) { char a = (char) i; for (int ch = 0; ch < charArray.length; ch++) { current = charArray[ch]; if (current == a) { count[b]++; } } } } return count; }

    Read the article

  • Counting XML elements in file on Android

    - by CSharperWithJava
    Take a simple XML file formatted like this: <Lists> <List> <Note/> ... <Note/> </List> <List> <Note/> ... <Note/> </List> </Lists> Each node has some attributes that actually hold the data of the file. I need a very quick way to count the number of each type of element, (List and Note). Lists is simply the root and doesn't matter. I can do this with a simple string search or something similar, but I need to make this as fast as possible. Design Parameters: Must be in java (Android application). Must AVOID allocating memory as much as possible. Must return the total number of Note elements and the number of List elements in the file, regardless of location in file. Number of Lists will typically be small (1-4), and number of notes can potentially be very large (upwards of 1000, typically 100) per file. I look forward to your suggestions.

    Read the article

  • Sorting in Lua, counting number of items

    - by Josh
    Two quick questions (I hope...) with the following code. The script below checks if a number is prime, and if not, returns all the factors for that number, otherwise it just returns that the number prime. Pay no attention to the zs. stuff in the script, for that is client specific and has no bearing on script functionality. The script itself works almost wonderfully, except for two minor details - the first being the factor list doesn't return itself sorted... that is, for 24, it'd return 1, 2, 12, 3, 8, 4, 6, and 24 instead of 1, 2, 3, 4, 6, 8, 12, and 24. I can't print it as a table, so it does need to be returned as a list. If it has to be sorted as a table first THEN turned into a list, I can deal with that. All that matters is the end result being the list. The other detail is that I need to check if there are only two numbers in the list or more. If there are only two numbers, it's a prime (1 and the number). The current way I have it does not work. Is there a way to accomplish this? I appreciate all the help! function get_all_factors(number) local factors = 1 for possible_factor=2, math.sqrt(number), 1 do local remainder = number%possible_factor if remainder == 0 then local factor, factor_pair = possible_factor, number/possible_factor factors = factors .. ", " .. factor if factor ~= factor_pair then factors = factors .. ", " .. factor_pair end end end factors = factors .. ", and " .. number return factors end local allfactors = get_all_factors(zs.param(1)) if zs.func.numitems(allfactors)==2 then return zs.param(1) .. " is prime." else return zs.param(1) .. " is not prime, and its factors are: " .. allfactors end

    Read the article

< Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >