Search Results

Search found 2490 results on 100 pages for 'matching'.

Page 14/100 | < Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >

  • Python: list and string matching

    - by pete
    Hi All, I have following: temp = "aaaab123xyz@+" lists = ["abc", "123.35", "xyz", "AND+"] for list in lists if re.match(list, temp, re.I): print "The %s is within %s." % (list,temp) The re.match is only match the beginning of the string, How to I match substring in between too.

    Read the article

  • Java Regex for matching quoted string with escaped quotes

    - by kayahr
    I know there are already many questions like mine but I found no answer which works in Java. So I write a new question. I have text files with content like this: key1 = "This is a \"test\" text with escapes using '\\' characters"; key2 = 'It must work with \'single\' quotes and "double" quotes'; I need a regular expression which matches the values in the double-quotes (or single-quotes). This regular expression must support the escaped quotes and escaped backslashes. The regular expression must work with Java standard Pattern/Matcher classes.

    Read the article

  • Matching day in datetime field from sqlite

    - by 99miles
    In Ruby on Rails I'm doing something like: Appointment.find( :first, :conditions => "staff_id = #{staff_id} AND datetimefield = #{datetime}") ... where datetimefield is of course, a datetime field. But, I only want rows where the date is equal to a given day, say 2/12/2011. I don't care about the time. What's an easy way to do this? Thanks!

    Read the article

  • Brackets matching using BIT

    - by amit.codename13
    edit: I was trying to solve a spoj problem. Here is the link to the problem : http://spoj.pl/problems/BRCKTS I can think of two possible data structures for solving the problem one using segment tree and the other using a BIT. I have already implemented the solution using a segment tree. I have read about BIT but i can't figure out how to do a particular thing with it(which i have mentioned below) I am trying to check if brackets are balanced in a given string containing only ('s or )'s. I am using a BIT(Binary indexed tree) for solving the problem. The procedure i am following is as follows: I am taking an array of size equal to the number of characters in the string. I am assigning -1 for ) and 1 for ( to the corresponding array elements. Brackets are balanced in the string only if the following two conditions are true. The cumulative sum of the whole array is zero. Minimum cumulative sum is non negative. i.e the minimum of cumulative sums of all the prefixes of the array is non-negative. Checking condition 1 using a BIT is trivial. I am facing problem in checking condition 2.

    Read the article

  • ASP.Net MVC Outbound Route Matching Problem When Using ActionLink

    - by Godders
    Hi there, Hoping for some help after reading into MVC routing and not coming up with the answer myself. I have the following routes registered: public static void RegisterRoutes(RouteCollection routes) { routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.MapRoute( null, "YourFeedback/Article/{resourceId}", new { controller = "YourFeedback", action = "Index", contentTypeId = new Guid(ConfigurationManager.AppSettings["ArticleLibraryId"]) }); routes.MapRoute( "Default", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = "" } // Parameter defaults ); } I have the following ActionLink in an aspx view: <%=Html.ActionLink("Your Feedback", "Article", "YourFeedback", new { resourceId = Model.ContentId.ResourceId }, new { @class = "yourFeedback" })%> My understanding of MVC routing is that this would render a anchor link with href of "/YourFeedback/Article/101" where 101 comes from Model.ContentId.ResourceId. Yet the anchor link href is rendered as "YourFeedback/Article/resourceId=101". Any ideas where I'm going wrong? Thanks in advance.

    Read the article

  • Regex matching wrong strings

    - by Joe Smalley
    I have this PHP/SQL query: $sql = sprintf("SELECT * FROM %sCubeCart_filemanager WHERE filepath REGEXP '%s[\\/\\\\][^\\/\\\\]+$' AND type = '%d' AND disabled = '0' ORDER BY filepath ASC %s", $this->_config['dbprefix'], str_replace(array('\\','/'),'.',$folder), $type, $limit); if '$folder' == 'iha9' it is finding results like 'iha91' and 'iha99' too. Something is wrong with the regular expression, but I don't know how they work, can anyone help?!

    Read the article

  • Regex Help matching quotes

    - by Farhan
    Hi Guys, I havin a reg ex problemm i would like to have a reg ex that will match the '\nGO at the end of my file(see below.) I have got the following so far: ^\'*GO but its match the quote sysbol? EOF: WHERE (dbo.Property.Archived <> 1) ' GO

    Read the article

  • Regular expression either/or not matching everything

    - by dwatransit
    I'm trying to parse an HTTP GET request to determine if the url contains any of a number of file types. If it does, I want to capture the entire request. There is something I don't understand about ORing. The following regular expression only captures part of it, and only if .flv is the first int the list of ORd values. (I've obscured the urls with spaces because Stackoverflow limits hyperlinks) regex: GET.?(.flv)|(.mp4)|(.avi).? test text: GET http: // foo.server.com/download/0/37/3000016511/.flv?mt=video/xy match output: GET http: // foo.server.com/download/0/37/3000016511/.flv I don't understand why the .*? at the end of the regex isnt callowing it to capture the entire text. If I get rid of the ORing of file types, then it works. Here is the test code in case my explanation doesn't make sense: public static void main(String[] args) { // TODO Auto-generated method stub String sourcestring = "GET http: // foo.server.com/download/0/37/3000016511/.flv?mt=video/xy"; Pattern re = Pattern.compile("GET .?\.flv."); // this works //output: // [0][0] = GET http :// foo.server.com/download/0/37/3000016511/.flv?mt=video/xy // the match from the following ends with the ".flv", not the entire url. // also it only works if .flv is the first of the 3 ORd options //Pattern re = Pattern.compile("GET .?(\.flv)|(\.mp4)|(\.avi).?"); // output: //[0][0] = GET http: // foo.server.com/download/0/37/3000016511/.flv // [0][1] = .flv // [0][2] = null // [0][3] = null Matcher m = re.matcher(sourcestring); int mIdx = 0; while (m.find()){ for( int groupIdx = 0; groupIdx < m.groupCount()+1; groupIdx++ ){ System.out.println( "[" + mIdx + "][" + groupIdx + "] = " + m.group(groupIdx)); } mIdx++; } } }

    Read the article

  • SED: Matching on 2 patterns on the same line

    - by Brian Knott
    Hi I want to delete a line using sed if it matches 2 regular expressions in the same line. EG the line starts with /* and end with */ (comment). The following script will do most of that. sed -e '/^\/*/ d' -e '/*\/$/ d' filename This script will remove all lines that start with * and end with */. I want it to remove the line only if is meets both criteria not one.

    Read the article

  • Why aren't my coordinates matching my JFrame size?

    - by AsLanFromNarnia
    I want to do some drawing in a JPanel but the enclosing JFrame size doesn't seem to match where I've asked the coordinates to be drawn. In my example code, the JFrame size is set to (700, 700) and the last point is drawn at (600, 600). I would expect this point to be drawn 100 pixels away from the right and bottom edges but it isn't (please see screenshot). Here's the code I'm using: import java.awt.Graphics; import javax.swing.JFrame; import javax.swing.JPanel; public class Scratch extends JPanel { static int frameWidth = 700; static int frameHeight = 700; public static void main(String[] args) { JFrame frame = new JFrame(); frame.setSize(frameWidth, frameHeight); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); Scratch scratch = new Scratch(); frame.getContentPane().add(scratch); frame.setVisible(true); } @Override public void paintComponent(Graphics g) { g.drawRect(100, 100, 1, 1); g.drawString("100", 100, 100); g.drawRect(200, 200, 1, 1); g.drawString("200", 200, 200); g.drawRect(300, 300, 1, 1); g.drawString("300", 300, 300); g.drawRect(400, 400, 1, 1); g.drawString("400", 400, 400); g.drawRect(500, 500, 1, 1); g.drawString("500", 500, 500); g.drawRect(600, 600, 1, 1); g.drawString("600", 600, 600); } }

    Read the article

  • predicate subquery to return items by matching tags

    - by user3411663
    I have a many-to-many relationship between two entities; Item and Tag. I'm trying to create a predicate to take the selectedItem and return a ranking of items based on how many similar tags they have. So far I've tried: NSPredicate *predicate = [NSPredicate predicateWithFormat:@"SUBQUERY(itemToTag, $item, $item in %@).@count > 0", selectedItem.itemToTag]; Any other iterations that have failed. It currently only returns the selectedItem in the list. I've found little on Subquery. Is there a guru out there that can help me refine this? Thanks in advance for the help!

    Read the article

  • multi-line pattern matching in pyhon

    - by Horace Ho
    A periodic computer generated message (simplified): Hello user123, - (604)7080900 - 152 - minutes Regards Using python, how can I extract "(604)7080900", "152", "minutes" (i.e. any text following a leading "- " pattern) between the two empty lines (empty line is the \n\n after "Hello user123" and the \n\n before "Regards"). Even better if the result string list are stored in an array. Thanks!

    Read the article

  • Matching .NET References to Namespaces

    - by maxp
    This seems confusing to me - im creating a class library, and adding all the necessary references for the source files contained in it. Now, off the bat, there were over 300 compiler errors complaining about missing namespaces. The library will now compile after i just added all of the System.* references, however this is obviously not the best way. I.e. if a classes needs using System.Web.Script;, there is no System.Web.Script reference, how would i find out which one of these references contained it? System.Web didnt.

    Read the article

  • Finding matching submatrics inside a matrix

    - by DaveO
    I have a 100x200 2D array expressed as a numpy array consisting of black (0) and white (255) cells. It is a bitmap file. I then have 2D shapes (it's easiest to think of them as letters) that are also 2D black and white cells. I know I can naively iterate through the matrix but this is going to be a 'hot' portion of my code so speed is an concern. Is there a fast way to perform this in numpy/scipy? I looked briefly at Scipy's correlate function. I am not interested in 'fuzzy matches', only exact matches. I also looked at some academic papers but they are above my head.

    Read the article

  • strstr matching first occurrence in c

    - by lex0273
    I was wondering how could I match the string "just" in str1 if str1 contains the strings as: "this is just\2323 a test" // "just" will always be the same I'm trying to match it using strstr but so far it won't match because of the \xxxx Any suggestions on how to match it? Thanks

    Read the article

  • MySQL - Return number of rows matching query data?

    - by Keir Simmons
    I have a query as follows: SELECT 1 FROM shop_inventory a JOIN shop_items b ON b.id=a.iid AND b.szbid=3362169 AND b.cid=a.cid WHERE a.cid=1 GROUP BY a.bought The only thing I need to do with this data is work out the number of rows returned (which I could do with mysqli -> num_rows;. However, I would like to know if there is a method to return the number of rows that match the query, without having to run num_rows? For example, the query should return one row, with one result, number_of_rows. I hope this makes sense!

    Read the article

  • Fluid Columns with matching height and background image

    - by JamesArmes
    I'm working on a new layout for my site that uses a header, footer and two column center region. The two columns consist of the main content area which is fluid height and width and a right sidebar which is fluid height and fixed width. I have done similar layouts before, but this one depends on using two different background images (one for the sidebar and one for the content area). Is there any way to implement this, using proper HTML & CSS, so that the background images of the two columns are always the same height, regardless of which columns content is longer? I've tried using JavaScript to simulate this, but it doesn't work so well if there are images in the content area. I would really prefer not to use this method any way. Any help is greatly appreciated. I have setup a staging environment at http://staging.jamesarmes.net/jimmyssandbox to provide an example. This environment is not my finished product, but I want to get the containers under control before I move any further

    Read the article

  • Matching 'weird' characters in PHP regex

    - by Bill X
    I have some strings that need a-strippin': ÜT: 9.996636,76.294363 Tons of long strings of location codes. A literal regex in PHP won't match them, IE $pattern = /ÜT:/; echo preg_replace($pattern, "", $row['location']); Won't match/strip anything. (To know it's working, /T:/ does strip the last bit of that string). What's the encoding error doing on here? Alternately, I would accept a concise way to take out just the numbers.

    Read the article

  • Pattern Matching in Columns

    - by Chronicles
    File 1 A11;F1;BMW A23;F2;BMW B12;F3;BMW H11;F4;JBW File 2 P01;A1;0;0--00 ;123;456;150 P01;A11;0;0--00 ;123;444;208 P01;B12;0;0--00 ;123;111;36 P01;V11;0;0--00 ;123;787;33.9 Output -;-;-;P01;A1;0;0--00 ;123;456;150 A11;F1;BMW;P01;A11;0;0--00 ;123;444;208 B12;F3;BMW;P01;B12;0;0--00 ;123;111;36 -;-;-;P01;V11;0;0--00 ;123;787;33.9 I TRIED awk 'FNR==NR {a[$2] = $0; next }{ if($1 in a) {p=$1;$1="";print a[p],$0}}' File1 File2 But didnt work. Basically I want to get the details from FILE 1 and compare with FILE2 (master list) . Example : A1 in FILE2 was not available in FILE1 , so in output file we have “-“ for 1st three fields and rest from FILE2 . Now, we have A11 and we got the detail in FILE1. So we write details of A11 from both File 1 & 2

    Read the article

  • PHP matching a string

    - by John Jones
    Hi, I have an Indian company data set and need to extract the City and Zip from the address field: Address Field Example: Gowripuram West, Sengunthapuram Post, Near L.G.B., Karur, Tamilnadu, Karur - 639 002, India As you can see the City is Karur and the zip is followed after the - (hyphen). I need the PHP code to match [city] - [zip] Not sure how to do this I can find the Zip after the Hypen but not sure how to find the City, please note the City can be 2 words. Cheers for your time./ J

    Read the article

  • Regular expressions and matching URLs with metacharacters

    - by James P.
    I'm having trouble finding a regular expression that matches the following String. Korben;http://feeds.feedburner.com/KorbensBlog-UpgradeYourMind?format=xml;1 One problem is escaping the question mark. Java's pattern matcher doesn't seem to accept \? as a valid escape sequence but it also fails to work with the tester at myregexp.com. Here's what I have so far: ([a-zA-Z0-9])+;http://([a-zA-Z0-9./-]+);[0-9]+ Any suggestions? Edit: The original intent was to match all URLs that could be found after the first semi colon.

    Read the article

  • php error reporting - having trouble matching local & web server settings

    - by Andrew Heath
    I'm trying to add a custom error handler to my site, but in doing so have discovered that my webhost's PHP error reporting settings and those of my localhost (default XAMPP) vary considerably. While I thought I was programming to E_STRICT like a good little boy, adding the error handler to my webhost revealed craploads of Runtime Notices. Example: Runtime notice strtotime() [function.strtotime]: It is not safe to rely on the system's timezone settings. Please use the date.timezone setting, the TZ environment variable or the date_default_timezone_set() function. In case you used any of those methods and you are still getting this warning, you most likely misspelled the timezone identifier. We selected 'America/Chicago' for 'CST/-6.0/no DST' instead In /home/... Clearly this isn't a red-alert, showstopping error. But what bothers me is that it doesn't show up on my localhost. I'd certainly like to improve my code by addressing these sorts of issues if I could see them! I've looked through both php.ini files, and my webhost's setting is error_reporting = E_ALL & ~E_NOTICE whereas mine was error_reporting = E_STRICT, which I had thought was better. However, changing mine to match and rebooting the server doesn't seem to have accomplished anything. Could someone please point me in the right direction?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Matching tuples in Prolog

    - by milosz
    Why does Prolog match (X, Xs) with a tuple containing more elements? An example: test2((X, Xs)) :- write(X), nl, test2(Xs). test2((X)) :- write(X), nl. test :- read(W), test2(W). ?- test. |: a, b(c), d(e(f)), g. a b(c) d(e(f)) g yes Actually this is what I want to achieve but it seems suspicious. Is there any other way to treat a conjunction of terms as a list in Prolog?

    Read the article

< Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >