Search Results

Search found 626 results on 26 pages for 'wildcard'.

Page 14/26 | < Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >

  • SSL Returning Blank Page, No Catalina Errors

    - by Mr.Peabody
    This is my second, maybe third, time configuring SSL with Tomcat. Earlier I had created a self signed, which worked, and now using my signed is proving fruitless. I am using Tomcat, operating from the Amazon Linux API. When using the signed cert/keystore, my server is starting normally without errors. However, when trying to navigate to the domain it is giving me an "ERR_SSL_VERSION_OR_CIPHER_MISMATCH" error. My server.xml file looks as follows: <Connector port="8443" maxHttpHeaderSize="8192" maxThreads="150" minSpareThreads="25" maxSpareThreads="75" enableLookups="false" disableUploadTimeout="true" acceptCount="100" scheme="https" secure="true" SSLEnabled="true" clientAuth="false" sslProtocol="TLS" keystoreFile="/home/ec2-user/.keystore/starchild.jks" keystorePass="d6b5385812252f180b961aa3630df504" /> It couldn't hurt to also mention that I'm using a wildcard certificate. Please let me know if anything looks amiss! EDIT: After looking more into this, I've determined there may be nothing is wrong with the Server.xml, or the listening ports. This is becoming more of an actual certificate error, as the curl request is giving me this error: curl: (35) Unknown SSL protocol error in connection to jira.mywebsite.com:-9824 Though, I can't seem to figure out what the "-9824" is. When comparing this curl to another similar setup (using the same Wildcard Certificate) it's turning up the full handshake, which is to be expected. I believe this is now between the protocol/cypher set default on JIRA servers.

    Read the article

  • Using %v in Apache LogFormat definition matches ServerName instead of specific vhost requested

    - by Graeme Donaldson
    We have an application which uses a DNS wildcard, i.e. *.app.example.com. We're using Apache 2.2 on Ubuntu Hardy. The relevant parts of the Apache config are as follows. In /etc/apache2/httpd.conf: LogFormat "%v %h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" vlog In /etc/apache2/sites-enabled/app.example.com: ServerName app.example.com ServerAlias *.app.example.com ... CustomLog "|/usr/sbin/vlogger -s access.log /var/log/apache2/vlogger" vlog Clients access this application using their own URL, e.g. company1.app.example.com, company2.app.example.com, etc. Previously, the %v in the LogFormat directive would match the hostname of the client request, and we'd get several subdirectories under /var/log/apache2/vlogger corresponding to the various client URLs in use. Now, %v appears to be matching the ServerName value, so we only get one log under /var/log/apache2/vlogger/app.example.com. This breaks our logfile analysis because the log file has no indication of which client the log relates to. I can fix this easily by changing the LogFormat to this: LogFormat "%{Host}i %h %l %u %t \"%r\" %>s %b \"%{Referer}i\" \"%{User-Agent}i\"" vlog This will use the HTTP Host: header to tell vlogger which subdirectory to create the logs in and everything will be fine. The only concern I have is that this has worked in the past and I can't find any indication that this has changed recently. Is anyone else using a similar config, i.e. wildcard + vlogger and using %v? Is it working fine?

    Read the article

  • Dynamic subdomain routing

    - by Nader
    Hi everyone, I asked this question over at stackoverflow, but got very few views: http://stackoverflow.com/questions/2284917/route-web-requests-to-different-servers-based-on-subdomain Perhaps it's more applicable to this crowd. Here it is again for convenience: I have a platform where a user can create a new website using a subdomain. There will be thousands of these, eg abc.mydomain.com, def.mydomain.com . Hopefully if we are successful hundreds of thousands. I need to be able to route these domains to a different IPs to point at a particular app server. I have this mapping in a database right now. What are the best practices and recommended technologies here? I see a couple options: Have DNS setup with a wildcard CNAME entry so that all requests go to a single IP where perhaps two machines using heartbeat (for failover) know how to look up the IP in the database and then do an http redirect to the appropriate app server. This seems clunky and slow to me. Run my own DNS server that can be programatically managed such that when a new site is created a DNS entry is added. We also move sites around to different app servers, so I would need to be able to update DNS entries in close to real time. Thoughts anyone? Thanks. Update2: I've setup external wildcard DNS pointing at an HAProxy web server whose job it is to route requests to backend servers. The mapping is stored in our internal PowerDNS server. Question now is how to get the HAProxy server (or another) to use the value of the internal DNS and not some config file or access list? – Update: Based on some suggestions below, it seems like reverse-proxy server(s) is the way to go. As I'll be rebalancing the domain-server mapping, these need to work instantly and the TTL on a DNS solution could be a problem. Any recommendations on software to use considering this domain-IP data is stored in a DB, and I'll need this to be performant?

    Read the article

  • How can I add subdomains of default accepted domain of Exchange 2010

    - by Christoph
    I have an Exchange 2010 that has several accepted domains. Now I want this server to accept - besides the default SMTP domain - all subdomains of the default domain. The documentation in Technet states When you create an accepted domain, you can use a wildcard character (*) in the address space to indicate that all subdomains of the SMTP address space are also accepted by the Exchange organization. For example, to configure Contoso.com and all its subdomains as accepted domains, enter *.Contoso.com as the SMTP address space. It is, however not possible to add e. g. *.contoso.com if contoso.com is already configured. Exchange complains in this case that the domain is already configured. It is also not possible to edit the "value", i. e. the domain name of an accepted domain. I know that I cannot modify the default accepted domain, but changing it to another does not help either, because the domain name itself can never be edited. The last idea was deleting the accepted domain and re-creating it with "*." prepended. This is, however, also impossible because it is of course not possible to delete or modify the default address policy and if a domain name is used in an address template it cannot be removed from the accepted domains. The question is: How can I make my Exchange 2010 server accept any subdomain of its default accepted domain with a wildcard?

    Read the article

  • Apache virtual server httpd-vhosts undocumented issue

    - by Ethon Bridges
    I have read the Apache documentation on the https-vhosts.conf file and after a couple of hours fighting this problem, figured it out on my own. Here's the situation: We have a domain that ends in a .ws Apparently you can't do this in the conf file. You MUST use the ? wildcard or it will not work. The * wildcard will not work either. Further, in the ServerAlias directive, anything past the first entry will not work if the first entry in the ServerAlias directive is not correct. Here is an example of an entry that does NOT work. Note that anotherdomain.com and yetanotherdomain.com will fail because thedomain.ws is not configured correctly: <VirtualHost *:80> DocumentRoot /opt/local/apache2/sites/ourdomain ServerName www.thedomain.ws ServerAlias thedomain.ws another domain.com yetanotherdomain.com <Directory /opt/local/apache2/sites/ourdomain> allow from all </Directory> </VirtualHost> Here is an example of our working entry: <VirtualHost *:80> DocumentRoot /opt/local/apache2/sites/ourdomain ServerName www.thedomain.ws? ServerAlias thedomain.ws? another domain.com yetanotherdomain.com <Directory /opt/local/apache2/sites/ourdomain> allow from all </Directory> </VirtualHost> If there is documentation of this, I sure didn't see it.

    Read the article

  • Removing trailing slashes in WordPress blog hosted on IIS

    - by Zishan
    I have a WordPress blog hosted in my IIS virtual directory that has all URLs ending with a forward slash. For example: http://www.example.com/blog/ I have the following rules defined in my web.config: <rule name="wordpress" patternSyntax="Wildcard"> <match url="*" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Rewrite" url="index.php" /> </rule> <rule name="Redirect-domain-to-www" patternSyntax="Wildcard" stopProcessing="true"> <match url="*" /> <conditions> <add input="{HTTP_HOST}" pattern="example.com" /> </conditions> <action type="Redirect" url="http://www.example.com/blog/{R:0}" /> </rule> In addition, I tried adding the following rule for removing trailing slashes: <rule name="Remove trailing slash" stopProcessing="true"> <match url="(.*)/$" /> <conditions> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> </conditions> <action type="Redirect" redirectType="Permanent" url="{R:1}" /> </rule> It seems that the last rule doesn't work at all. Anyone around here who has attempted to remove trailing slashes from WordPress blogs hosted on IIS?

    Read the article

  • Freebsd jail for an small company - checklist - what shouldn't forget

    - by cajwine
    Looking for an checklist for an "small company freebsd/jail server". Having pretty common starting point: FreeBSD jail (remote/headless) for the company: public web, email, ftp server, and private (maybe in the future partially public) wiki (foswiki) 4 physical persons, (6 email addresses) + one admin - others will never use ssh) have already done usual hardening on the host side (like pf, sshguard etc). my major components are: dovecot, exim, apache22, proftpd, perl5.14. Looking for an checklist, what I shouldn't forget. My plan: openssl self-signed certificates for exim, dovecot and proftpd (wildcard keys) openssl self-signed certificate for apache (later will go for "trusted-signed" key) My questions are: is is an "good practice" having one pair of wildcard SSL-certificates for many programs? (exim, dovecot, proftpd) - or should I generate one key for each service? should I add all 4 persons as standard (unix) users, or I should go with virtual users? Asking because: have only small count of users, and it is more simple to configure everything (exim, dovecot) for local users ($HOME/Maildir), plus ability to set $HOME/.forward/vacation and etc. is here some (special) things what I should consider? (e.g. maybe, in the future we want setup our own webmail - will make this any difference?) any other recommendation? Thank you, hoping that this question fit into the http://serverfault.com/faq under the: Server and Business Workstation operating systems, hardware, software Operations, maintenance, and monitoring Looking for an checklist, but please explain why you're recommending it. See Good Subjective, Bad Subjective. related: What's your suggested mail server configuration for a FreeBSD server?

    Read the article

  • Routes for IIS Classic and Integrated Mode

    - by imran_ku07
         Introduction:             ASP.NET MVC Routing feature makes it very easy to provide clean URLs. You just need to configure routes in global.asax file to create an application with clean URLs. In most cases you define routes works in IIS 6, IIS 7 (or IIS 7.5) Classic and Integrated mode. But in some cases your routes may only works in IIS 7 Integrated mode, like in the case of using extension less URLs in IIS 6 without a wildcard extension map. So in this article I will show you how to create different routes which works in IIS 6 and IIS 7 Classic and Integrated mode.       Description:             Let's say that you need to create an application which must work both in Classic and Integrated mode. Also you have no control to setup a wildcard extension map in IIS. So you need to create two routes. One with extension less URL for Integrated mode and one with a URL with an extension for Classic Mode.   routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults );               Now you have set up two routes, one for Integrated mode and one for Classic mode. Now you only need to ensure that Integrated mode route should only match if the application is running in Integrated mode and Classic mode route should only match if the application is running in Classic mode. For making this work you need to create two custom constraint for Integrated and Classic mode. So replace the above routes with these routes,     routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new ClassicModeConstraint() }// Constraints ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new IntegratedModeConstraint() }// Constraints );            The first route which is for Classic mode adds a ClassicModeConstraint and second route which is for Integrated mode adds a IntegratedModeConstraint. Next you need to add the implementation of these constraint classes.     public class ClassicModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return !HttpRuntime.UsingIntegratedPipeline; } } public class IntegratedModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return HttpRuntime.UsingIntegratedPipeline; } }             HttpRuntime.UsingIntegratedPipeline returns true if the application is running on Integrated mode; otherwise, it returns false. So routes for Integrated mode only matched when the application is running on Integrated mode and routes for Classic mode only matched when the application is not running on Integrated mode.       Summary:             During developing applications, sometimes developers are not sure that whether this application will be host on IIS 6 or IIS 7 (or IIS 7.5) Integrated mode or Classic mode. So it's a good idea to create separate routes for both Classic and Integrated mode so that your application will use extension less URLs where possible and use URLs with an extension where it is not possible to use extension less URLs. In this article I showed you how to create separate routes for IIS Integrated and Classic mode. Hope you will enjoy this article too.   SyntaxHighlighter.all()

    Read the article

  • SQL SERVER – Query Hint – Contest Win Joes 2 Pros Combo (USD 198) – Day 1 of 5

    - by pinaldave
    August 2011 we ran a contest where every day we give away one book for an entire month. The contest had extreme success. Lots of people participated and lots of give away. I have received lots of questions if we are doing something similar this month. Absolutely, instead of running a contest a month long we are doing something more interesting. We are giving away USD 198 worth gift every day for this week. We are giving away Joes 2 Pros 5 Volumes (BOOK) SQL 2008 Development Certification Training Kit every day. One copy in India and One in USA. Total 2 of the giveaway (worth USD 198). All the gifts are sponsored from the Koenig Training Solution and Joes 2 Pros. The books are available here Amazon | Flipkart | Indiaplaza How to Win: Read the Question Read the Hints Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India residents only) 2 Winners will be randomly selected announced on August 20th. Question of the Day: Which of the following queries will return dirty data? a) SELECT * FROM Table1 (READUNCOMMITED) b) SELECT * FROM Table1 (NOLOCK) c) SELECT * FROM Table1 (DIRTYREAD) d) SELECT * FROM Table1 (MYLOCK) Query Hints: BIG HINT POST Most SQL people know what a “Dirty Record” is. You might also call that an “Intermediate record”. In case this is new to you here is a very quick explanation. The simplest way to describe the steps of a transaction is to use an example of updating an existing record into a table. When the insert runs, SQL Server gets the data from storage, such as a hard drive, and loads it into memory and your CPU. The data in memory is changed and then saved to the storage device. Finally, a message is sent confirming the rows that were affected. For a very short period of time the update takes the data and puts it into memory (an intermediate state), not a permanent state. For every data change to a table there is a brief moment where the change is made in the intermediate state, but is not committed. During this time, any other DML statement needing that data waits until the lock is released. This is a safety feature so that SQL Server evaluates only official data. For every data change to a table there is a brief moment where the change is made in this intermediate state, but is not committed. During this time, any other DML statement (SELECT, INSERT, DELETE, UPDATE) needing that data must wait until the lock is released. This is a safety feature put in place so that SQL Server evaluates only official data. Additional Hints: I have previously discussed various concepts from SQL Server Joes 2 Pros Volume 1. SQL Joes 2 Pros Development Series – Dirty Records and Table Hints SQL Joes 2 Pros Development Series – Row Constructors SQL Joes 2 Pros Development Series – Finding un-matching Records SQL Joes 2 Pros Development Series – Efficient Query Writing Strategy SQL Joes 2 Pros Development Series – Finding Apostrophes in String and Text SQL Joes 2 Pros Development Series – Wildcard – Querying Special Characters SQL Joes 2 Pros Development Series – Wildcard Basics Recap Next Step: Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India) Bonus Winner Leave a comment with your favorite article from the “additional hints” section and you may be eligible for surprise gift. There is no country restriction for this Bonus Contest. Do mention why you liked it any particular blog post and I will announce the winner of the same along with the main contest. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Joes 2 Pros, PostADay, SQL, SQL Authority, SQL Puzzle, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • html5 cache -> "network: *" doesn't work

    - by Greg
    Hello all, I am trying a simple test with the html 5 cache. Here is a simple web page : <!DOCTYPE html> <html manifest="test.manifest"> <head> </head> <body> <img src="http://www.somewebsite.com/picture.jpg"/> </body> </html> With the following manifest : CACHE MANIFEST #v0.1 NETWORK: http://www.somewebsite.com/ This work fine, the picture is displayed. My problem is that I won't be able to know from where the picture will come. Here comes the online whitelist wildcard flag, that is supposed to solve my problem. But with the manifest : CACHE MANIFEST #v0.1 NETWORK: * The image is not displayed (tested on safari / safari mobile / firefox). What is not working ? Is there another way to turn the online whitelist wildcard flag on ?

    Read the article

  • how to insert many similar records in mysql at a time using phpmyadmin?

    - by Networker
    we know that we can insert multiple records at a time using this query: INSERT INTO `TABLE1` (`First`,`Last`) VALUES ('name1','surname1'), ('name2','surname2'), ('name3','surname3'), ('name4','surname4'); but what if we want to add 1000 similar records as above (name*,surname*) do we have to write down all the records or we can use something like wildcard? or is there any other solution using mysql?

    Read the article

  • NTPD issue - syncs then slowly loses ground

    - by ethrbunny
    RHEL 5 workstation. Has been running smoothly for years. I did a 'pup' recently and followed with a nice, cleansing reboot. Afterwards the system had some startup issues: namely MySQL refused to start. It just went "...." for 5-10 minutes before I did another boot and skipped that step (using 'interactive'). This was the only service that didn't wan't to start normally. So now that the system is booted I've found that it doesn't want to stay in sync with the NTP master and after 48 hours is refusing any SSH other than root. NTPD: this service starts normally and gets a lock on 4 servers. Almost immediately it starts to lose ground and now (after 3 days) is almost 40 hours behind. If I stop/start the service it gets the lock, resets the system clock and starts losing ground again. The 'hwclock' is set properly and maintains its time. Login: when I (re)start the ntp server I am able to login normally. I assume this problem is due to losing sync with LDAP. This appears to be verified by LDAP errors in /var/log/messages. Suggestions on where to look? ADDENDA: Tried deleting the 'drift' file. After a bit it gets recreated with 0.000. from /var/log/messages: Jan 17 06:54:01 aeolus ntpdate[5084]: step time server 129.95.96.10 offset 30.139216 sec Jan 17 06:54:01 aeolus ntpd[5086]: ntpd [email protected] Tue Oct 25 12:54:17 UTC 2011 (1) Jan 17 06:54:01 aeolus ntpd[5087]: precision = 1.000 usec Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface wildcard, 0.0.0.0#123 Disabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface wildcard, ::#123 Disabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface lo, ::1#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface eth0, fe80::213:72ff:fe20:4080#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface lo, 127.0.0.1#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface eth0, 10.127.24.81#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: kernel time sync status 0040 Jan 17 06:54:02 aeolus ntpd[5087]: frequency initialized 0.000 PPM from /var/lib/ntp/drift Jan 17 06:54:02 aeolus ntpd[5087]: system event 'event_restart' (0x01) status 'sync_alarm, sync_unspec, 1 event, event_unspec' (0xc010) You can see the 30 second offset. This was after about one minute of operation.

    Read the article

  • Rsync and wildcards

    - by Jay White
    I am trying to back up both the "Last Session" and "Current Session" files for Google Chrome in one command, but using a wildcard doesn't seem to work. I am trying with the following command rsync -e "ssh -i new.key" -r --verbose -tz --stats --progress --delete '/cygdrive/c/Users/jay/AppData/Local/Google/Chrome/User Data/Default/*Session' user@host:"/chrome\ sessions/" and get the following error rsync: link_stat "/cygdrive/c/Users/jay/AppData/Local/Google/Chrome/User Data/Default/*Session" failed: No such file or directory (2) What am I doing wrong?

    Read the article

  • MySQL keeps adding additional user without rights from specific IP

    - by Niels B.
    I'm running MySQL Server 5.5.29 on Ubuntu Server 13.04 I have a created a user with a wildcard host access % and given him various privileges. However, whenever this user connects from 194.182.245.61, a new user account is created for that specific IP address with no rights and he is unable to exercise his privileges. When he connects from other internet connections, such as his home IP, it works just as it should. Why does this happen and how can I stop it from happening?

    Read the article

  • taskkill - end tasks with window titles ending with a specific string

    - by DBZ_A
    I need to write a batch program to end all MS office communicator tasks with window titles (usually ending with pattern "- Conversation" . I tried taskkill /FI "WINDOWTITLE eq *Conversation" /IM communicator.exe but the wildcard pattern starting with a '*' does not seem to work. Gives the folowing error ERROR: The search filter cannot be recognized. any suggestions for a workaround would be greatly appreciated!

    Read the article

  • How to configure ASP.NET MVC 3 on IIS 6 (Windows 2003 R2)

    - by Nedcode
    I am getting 403 Directory Listing Denied for the root and 404 for an action that I know should exist. Background: I have build and deployed an ASP.NET MVC 2 applcation a long time ago. Later I upgraded it to MVC 3 and it is still working with not configuration changes. Setting it up on a windows 2003 R2 (Standard) initialy was a pain, but after a couple of days(yes, days) struggling it started working. Now I have to do the same with the same application on a different server (2003 R2 Standard again) on a different network. .Net 4 is installed and allowed ASP.NET MVC 3 is also installed By default IIS is set to use .net 4 I verify aspnet_isapi.dll used in application extension are from version 4.0.30319 .NET asemblies folder. I also added the wildcard mapping to aspnet_isapi.dll and unchecked verify file exists. Under Directory Security in Authentication Methods I have disabled anonymos access and enabled Integrated Windows authentication(same as the one on the server that it works) I have copied the same web.config with the <authentication mode="Windows" /> <authorization> <deny users="?" /> </authorization> I have set Read & Execute, List Folder Contents, and Read for the Networkservice account(under which the app pool is working). Also I have set the same for Network account, IIS_WPG, ASPNET and IUSR_MAchineName. I do not have an EnableExte??nsionlessUrls but even if I create it and set it to true or false it does not help. I also tried http://haacked.com/archive/2010/12/22/asp-net-mvc-3-extensionless-urls-on-iis-6.aspx and it did not help. But I kept getting 403 Directory Listing Denied for the root and 404 for an action that I know should exist. Web Platform installer was then used to re-install and possibly update .net, asp.net etc. I then noticed IIS was reset to default. So I added the wildcard mapping again. No, luck still 403. I exported configuration files from the working server setup and created new default app pool and new default website using those configurations. Still I get 403 Directory Listing Denied for the / and 404 for any action I try.

    Read the article

  • Word Find - find any highlighted text that starts with a squared bracket

    - by user2953311
    Is there a way to Find highlighted text that ONLY begins with a open square bracket? I've tried using the square bracket as a wildcard, but it won't find any adjoining words. For example, I have a document containing conditional paragraphs, in squared brackets, with the "name" of the paragraph highlighted at the beginning: "[Document to return Thank you for sending the documents requested earlier.]" (the section in bold is highlighted in blue in Word) Is there a way to find "[Document to return"? I hope this makes sense Thanks in advance

    Read the article

< Previous Page | 10 11 12 13 14 15 16 17 18 19 20 21  | Next Page >