Search Results

Search found 18489 results on 740 pages for 'key'.

Page 141/740 | < Previous Page | 137 138 139 140 141 142 143 144 145 146 147 148  | Next Page >

  • CouchDB: accessing nested structutes in map function

    - by Vegar
    I have a document based on a xml structure that I have stored in a CouchDB database. Some of the keys contains namespaces and are on the form "namespace:key": {"mykey":{nested:key":"nested value"}} In the map function, I want to emit the nested value as a key, but the colon inside the name makes it hard... emit(doc.mykey.nested:key, doc) <-- will not work. Does anyone know how this can be solved?

    Read the article

  • Vim syntax highlighting for ruby 1.9

    - by Peter
    Ruby 1.9 has a few new syntax elements, such as the {key: value} hash literal syntax. Has anyone written or seen an updated syntax/ruby.vim highlighting file that will highlight key: just like it highlights :key in {:key => value}?

    Read the article

  • Have Javascript insert a backspace within ContentEditable Div.

    - by DavidR
    An odd request, I know. I want Javascript to pretend the user just pressed the backspace. That's all I really want, if you want more info: My last topic here, gives more explaination. In short: I press a key, javascript converts the key to the greek equivalent, then puts that key in instead. The problem is, when onKeyUp is activated, it starts a function which looks for combinable character pairs put together (for accents) and inserts that key.

    Read the article

  • mysql error #1452 appearing when trying to add a constraint

    - by user1701484
    I am trying to alter a table so That I can add a foreign key constraint in mysql database: ALTER TABLE `Question` ADD CONSTRAINT `FK_question` FOREIGN KEY (`QuestionId`) REFERENCES `Image_Question` (`QuestionId`) ON DELETE CASCADE ; Problem is that it is giving me this error: 1452 - Cannot add or update a child row: a foreign key constraint fails (mobile_app. '#sql-4517_15241', CONSTRAINT FK_question FOREIGN KEY (QuestionId) REFERENCES Image_Question (QuestionId) ON DELETE CASCADE) What does this error actually mean and what are the possible solutions I might have to undertake in order to fix this?

    Read the article

  • Loop through a Map with JSTL

    - by Dean
    I'm looking to have JSTL loop through a Map and output the value of the key and it's value. For example I have a Map which can have any number of entries, i'd like to loop through this map using JSTL and output both the key and it's value. I know how to access the value using the key, ${myMap['keystring']}, but how do I access the key?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • How to use HTTP method DELETE on Google App Engine?

    - by Jader Dias
    I can use this verb in the Python Windows SDK. But not in production. Why? What am I doing wrong? The error message includes (only seen via firebug or fiddler) Malformed request or something like that My code looks like: from google.appengine.ext import db from google.appengine.ext import webapp class Handler(webapp.RequestHandler): def delete(self): key = self.request.get('key') item = db.get(key) item.delete() self.response.out.write(key)

    Read the article

  • Security review of an authenticated Diffie Hellman variant

    - by mtraut
    EDIT I'm still hoping for some advice on this, i tried to clarify my intentions... When i came upon device pairing in my mobile communication framework i studied a lot of papers on this topic and and also got some input from previous questions here. But, i didn't find a ready to implement protocol solution - so i invented a derivate and as i'm no crypto geek i'm not sure about the security caveats of the final solution: The main questions are Is SHA256 sufficient as a commit function? Is the addition of the shared secret as an authentication info in the commit string safe? What is the overall security of the 1024 bit group DH I assume at most 2^-24 bit probability of succesful MITM attack (because of 24 bit challenge). Is this plausible? What may be the most promising attack (besides ripping the device out off my numb, cold hands) This is the algorithm sketch For first time pairing, a solution proposed in "Key agreement in peer-to-peer wireless networks" (DH-SC) is implemented. I based it on a commitment derived from: A fix "UUID" for the communicating entity/role (128 bit, sent at protocol start, before commitment) The public DH key (192 bit private key, based on the 1024 bit Oakley group) A 24 bit random challenge Commit is computed using SHA256 c = sha256( UUID || DH pub || Chall) Both parties exchange this commitment, open and transfer the plain content of the above values. The 24 bit random is displayed to the user for manual authentication DH session key (128 bytes, see above) is computed When the user opts for persistent pairing, the session key is stored with the remote UUID as a shared secret Next time devices connect, commit is computed by additionally hashing the previous DH session key before the random challenge. For sure it is not transfered when opening. c = sha256( UUID || DH pub || DH sess || Chall) Now the user is not bothered authenticating when the local party can derive the same commitment using his own, stored previous DH session key. After succesful connection the new DH session key becomes the new shared secret. As this does not exactly fit the protocols i found so far (and as such their security proofs), i'd be very interested to get an opinion from some more crypto enabled guys here. BTW. i did read about the "EKE" protocol, but i'm not sure what the extra security level is.

    Read the article

  • Is it possible to use pure Encrypting and Decrypting keys in asymmetric cryptography instead of priv

    - by macropas
    Is it possible to use pure Encrypting and Decrypting keys instead of private and public keys? As I know in .Net asymmetric RSA implementation private key RSAParameters parameters = (new RSACryptoServiceProvider()).ExportParameters(true) is a superset of public key. And using private key we can both encrypt and decrypt our data. But I need key only for decrypting data. How to do it? I experimented on nulling RSAParameters fields, but RSACryptoServiceProvider object can't import such parameters.

    Read the article

  • Is HashMap in Java collision safe

    - by changed
    Hi I am developing a parser that needs to put key value pairs in hashmap. But a key can have multiple values which i can do in this way HashMap<String,ArrayList<String>> . But what happens if number of keys are very large and it start matching with other key's hashcode. Will that rewrite previous key's value ? thanks -devSunday

    Read the article

  • Change|Assign parent for the Model instance on Google App Engine Datastore

    - by Vladimir Prudnikov
    Is it possible to change or assign new parent to the Model instance that already in datastore? For example I need something like this task = db.get(db.Key(task_key)) project = db.get(db.Key(project_key)) task.parent = project task.put() but it doesn't works this way because task.parent is built-in method. I was thinking about creating a new Key instance for the task but there is no way to change key as well. Any thoughts?

    Read the article

  • C# Keyboard Input (Beginner Help)

    - by ThickBook
    I am trying to ask user "enter any key and when that key is pressed it shows that "You Pressed "Key". Can you help what's wrong in this code? This is what I have written using System; class Program { public static void Main(string[] args) { Console.Write("Enter any Key: "); char name = Console.Read(); Console.WriteLine("You pressed {0}", name); } }

    Read the article

  • Foreign Keys in SQLITE in the Google Gears framework

    - by Maxim Gershkovich
    Hi all, Could someone please tell me why the following foreign key constraint (although executes fine) is not enforced by SQLITE? Could someone pleasse provide an example of how I can go about enforcing the relationship? CREATE TABLE User (UserID TEXT Unique NOT NULL PRIMARY KEY, FirstName TEXT NOT NULL, LastName TEXT NOT NULL, Username TEXT NOT NULL, Password TEXT NOT NULL, Email TEXT NOT NULL, SignupDate TEXT NOT NULL) CREATE TABLE Category (CategoryID TEXT Unique NOT NULL PRIMARY KEY, UserID TEXT, FOREIGN KEY(UserID) REFERENCES User(UserID))

    Read the article

  • Adding keys to superglobals in php

    - by gautam kumar
    Is there any way by which I can add keys to superglobals in php without defining the corresponding values to those key? For example: $_SESSION['key']='set';//key` automatically gets defined. But I want to do something like this add_key($_SESSION,'key')//key is added to $_SESSION array. Is it possible?

    Read the article

  • Basic question about encryption - what exactly are keys?

    - by Tomas
    Hi, I was browsing and found good articles about encryption. However, none of them described why the key lenght is important and what exactly the key is used for. My guess is that could work this way: 0101001101010101010 Key: 01010010101010010101 //the longer the key, the longer unique sequence XOR or smth: //result Is this at least a bit how it works or I am missing something? Thanks

    Read the article

  • MySql Alter Syntax error with mulitple FK

    - by acidzombie24
    If i do the first one i have no problem. When i do addition i get a syntax error. What is wrong with the syntax? The error says syntax error near [entire 2nd line] alter table `ban_Status` add FOREIGN KEY (`banned_user`) REFERENCES `user_data`(`id`) alter table `ban_Status` add FOREIGN KEY (`banned_user`) REFERENCES `user_data`(`id`), FOREIGN KEY (`banning_user`) REFERENCES `user_data`(`id`), FOREIGN KEY (`unban_user`) REFERENCES `user_data`(`id`)

    Read the article

  • Does UNIQ constraint mean also an index on that field(s)?

    - by Gremo
    As title, should i defined a separate index on email column (for searching purposes) or the index is "automatically" added along with UNIQ_EMAIL_USER constraint? CREATE TABLE IF NOT EXISTS `customer` ( `id` int(11) NOT NULL AUTO_INCREMENT, `user_id` int(11) NOT NULL, `first` varchar(255) NOT NULL, `last` varchar(255) NOT NULL, `slug` varchar(255) NOT NULL, `email` varchar(255) NOT NULL, `created_at` datetime NOT NULL, `updated_at` datetime NOT NULL, PRIMARY KEY (`id`), UNIQUE KEY `UNIQ_SLUG` (`slug`), UNIQUE KEY `UNIQ_EMAIL_USER` (`email`,`user_id`), KEY `IDX_USER` (`user_id`) ) ENGINE=InnoDB;

    Read the article

  • Replace a method call

    - by deV
    Hi, I want to achieve below task: 1. I need to search Html.Resource("key") in my application and replace it with GetResource("key",object) 2. The GetResource method has two parameters: the first parameter should be the same as the original method,"key" in this case, and I need to pass in the second parameter which is variable. 3. I need to replace only when the Html.Resource("key") occurs inside certain tags like td and div else I need not replace it. Thanks in advance

    Read the article

  • How can I map a String to a function in Java?

    - by Bears will eat you
    Currently, I have a bunch of Java classes that implement a Processor interface, meaning they all have a processRequest(String key) method. The idea is that each class has a few (say, <10) member Strings, and each of those maps to a method in that class via the processRequest method, like so: class FooProcessor implements Processor { String key1 = "abc"; String key2 = "def"; String key3 = "ghi"; // and so on... String processRequest(String key) { String toReturn = null; if (key1.equals(key)) toReturn = method1(); else if (key2.equals(key)) toReturn = method2(); else if (key3.equals(key)) toReturn = method3(); // and so on... return toReturn; } String method1() { // do stuff } String method2() { // do other stuff } String method3() { // do other other stuff } // and so on... } You get the idea. This was working fine for me, but now I need a runtime-accessible mapping from key to function; not every function actually returns a String (some return void) and I need to dynamically access the return type (using reflection) of each function in each class that there's a key for. I already have a manager that knows about all the keys, but not the mapping from key to function. My first instinct was to replace this mapping using if-else statements with a Map<String, Function>, like I could do in Javascript. But, Java doesn't support first-class functions so I'm out of luck there. I could probably dig up a third-party library that lets me work with first-class functions, but I haven't seen any yet, and I doubt that I need an entire new library. I also thought of putting these String keys into an array and using reflection to invoke the methods by name, but I see two downsides to this method: My keys would have to be named the same as the method - or be named in a particular, consistent way so that it's easy to map them to the method name. This seems WAY slower than the if-else statements I have right now. Efficiency is something of a concern because these methods will tend to get called pretty frequently, and I want to minimize unnecessary overhead. TL; DR: I'm looking for a clean, minimal-overhead way to map a String to some sort of a Function object that I can invoke and call (something like) getReturnType() on. I don't especially mind using a 3rd-party library if it really fits my needs. I also don't mind using reflection, though I would strongly prefer to avoid using reflection every single time I do a method lookup - maybe using some caching strategy that combines the Map with reflection. Thoughts on a good way to get what I want? Cheers!

    Read the article

  • Why doesn't HashTable.Contains() just simply return false if it is passed a null?

    - by Nate Pinchot
    I understand why passing a null to HashTable.Contains() doesn't work, but I don't understand what the point of it throwing an ArgumentNullException is - instead of just simply returning false? What is the benefit of throwing the exception (other than to make me do null checks before calling .Contains())? Caused By [System.ArgumentNullException] Key cannot be null. Parameter name: key at System.Collections.Hashtable.ContainsKey(Object key) at System.Collections.Hashtable.Contains(Object key)

    Read the article

  • git clone with ssh issue

    - by george
    Hi, I have generated a public key, private key pair. I've set the public key to the site. How to use the console in windows to clone a git repository? What do I do with the private key? I keep getting: the remote end hung up unexp. Thanks

    Read the article

  • Why is Dictionary.First() so slow?

    - by Rotsor
    Not a real question because I already found out the answer, but still interesting thing. I always thought that hash table is the fastest associative container if you hash properly. However, the following code is terribly slow. It executes only about 1 million iterations and takes more than 2 minutes of time on a Core 2 CPU. The code does the following: it maintains the collection todo of items it needs to process. At each iteration it takes an item from this collection (doesn't matter which item), deletes it, processes it if it wasn't processed (possibly adding more items to process), and repeats this until there are no items to process. The culprit seems to be the Dictionary.Keys.First() operation. The question is why is it slow? Stopwatch watch = new Stopwatch(); watch.Start(); HashSet<int> processed = new HashSet<int>(); Dictionary<int, int> todo = new Dictionary<int, int>(); todo.Add(1, 1); int iterations = 0; int limit = 500000; while (todo.Count > 0) { iterations++; var key = todo.Keys.First(); var value = todo[key]; todo.Remove(key); if (!processed.Contains(key)) { processed.Add(key); // process item here if (key < limit) { todo[key + 13] = value + 1; todo[key + 7] = value + 1; } // doesn't matter much how } } Console.WriteLine("Iterations: {0}; Time: {1}.", iterations, watch.Elapsed); This results in: Iterations: 923007; Time: 00:02:09.8414388. Simply changing Dictionary to SortedDictionary yields: Iterations: 499976; Time: 00:00:00.4451514. 300 times faster while having only 2 times less iterations. The same happens in java. Used HashMap instead of Dictionary and keySet().iterator().next() instead of Keys.First().

    Read the article

  • C# - Inserting and Removing from Cache

    - by Nir
    1 - If I insert to Cache by assigning the value: Cache["key"] = value; what's the expiration time? 2 - Removing the same value from Cache: I want to check if the value is in Cache by if(Cache["key"]!=null), is it better to remove it from Cache by Cache.Remove("key") or Cache["key"]=null ?

    Read the article

  • Des Encrypion...

    - by SunilRai86
    i have done Des encryption which requires 64 bit key .the main problem is that when i insert any 64 bit key it decrypted .(the key used in encryption and the key for decryption is not same).

    Read the article

< Previous Page | 137 138 139 140 141 142 143 144 145 146 147 148  | Next Page >