Search Results

Search found 4245 results on 170 pages for 'rookie 22'.

Page 143/170 | < Previous Page | 139 140 141 142 143 144 145 146 147 148 149 150  | Next Page >

  • C++ addition overload ambiguity

    - by Nate
    I am coming up against a vexing conundrum in my code base. I can't quite tell why my code generates this error, but (for example) std::string does not. class String { public: String(const char*str); friend String operator+ ( const String& lval, const char *rval ); friend String operator+ ( const char *lval, const String& rval ); String operator+ ( const String& rval ); }; The implementation of these is easy enough to imagine on your own. My driver program contains the following: String result, lval("left side "), rval("of string"); char lv[] = "right side ", rv[] = "of string"; result = lv + rval; printf(result); result = (lval + rv); printf(result); Which generates the following error in gcc 4.1.2: driver.cpp:25: error: ISO C++ says that these are ambiguous, even though the worst conversion for the first is better than the worst conversion for the second: String.h:22: note: candidate 1: String operator+(const String&, const char*) String.h:24: note: candidate 2: String String::operator+(const String&) So far so good, right? Sadly, my String(const char *str) constructor is so handy to have as an implicit constructor, that using the explicit keyword to solve this would just cause a different pile of problems. Moreover... std::string doesn't have to resort to this, and I can't figure out why. For example, in basic_string.h, they are declared as follows: template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT, _Traits, _Alloc> operator+(const basic_string<_CharT, _Traits, _Alloc>& __lhs, const basic_string<_CharT, _Traits, _Alloc>& __rhs) template<typename _CharT, typename _Traits, typename _Alloc> basic_string<_CharT,_Traits,_Alloc> operator+(const _CharT* __lhs, const basic_string<_CharT,_Traits,_Alloc>& __rhs); and so on. The basic_string constructor is not declared explicit. How does this not cause the same error I'm getting, and how can I achieve the same behavior??

    Read the article

  • .NET AES returns wrong Test Vectors

    - by ralu
    I need to implement some crypto protocol on C# and want to say that this is my first project in C#. After spending some time to get used on C# I found out that I am unable to get compliant AES vectors. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; namespace ConsoleApplication1 { class Program { public static void Main() { try { //test vectors from "ecb_vk.txt" byte[] key = { 0x80, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] data = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] encTest = { 0x0e, 0xdd, 0x33, 0xd3, 0xc6, 0x21, 0xe5, 0x46, 0x45, 0x5b, 0xd8, 0xba, 0x14, 0x18, 0xbe, 0xc8 }; AesManaged aesAlg = new AesManaged(); aesAlg.BlockSize = 128; aesAlg.Key = key; aesAlg.Mode = CipherMode.ECB; ICryptoTransform encryptor = aesAlg.CreateEncryptor(); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); StreamWriter swEncrypt = new StreamWriter(csEncrypt); swEncrypt.Write(data); swEncrypt.Close(); csEncrypt.Close(); msEncrypt.Close(); aesAlg.Clear(); byte[] encr; encr = msEncrypt.ToArray(); string datastr = BitConverter.ToString(data); string encrstr = BitConverter.ToString(encr); string encTestStr = BitConverter.ToString(encTest); Console.WriteLine("data: {0}", datastr); Console.WriteLine("encr: {0}", encrstr); Console.WriteLine("should: {0}", encTestStr); Console.ReadKey(); } catch (Exception e) { Console.WriteLine("Error: {0}", e.Message); } } } } Output is wrong: data: 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 encr: A0-3C-C2-22-A4-32-F7-C9-BA-36-AE-73-66-BD-BB-A3 should: 0E-DD-33-D3-C6-21-E5-46-45-5B-D8-BA-14-18-BE-C8 I am sure that there is a correct AES implementation in .NET, so I need some advice from a .NET wizard to help with this.

    Read the article

  • iPhone Debugger Message -- Weird

    - by Bill Shiff
    Hello, I have an iPhone app that I've been working on and have recently upgraded my version of XCode. Since the upgrade, I can build and debug in the iPhone Simulator just fine, but when I try to debug on an attached device I get the following messages: From Xcode4: GNU gdb 6.3.50-20050815 (Apple version gdb-1510) (Fri Oct 22 04:12:10 UTC 2010) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "--host=i386-apple-darwin --target=arm-apple-darwin".tty /dev/ttys001 sharedlibrary apply-load-rules all warning: Unable to read symbols from "dyld" (prefix __dyld_) (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/MessageUI.framework/MessageUI (file not found). warning: Unable to read symbols from "MessageUI" (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/MapKit.framework/MapKit (file not found). warning: Unable to read symbols from "MapKit" (not yet mapped into memory). warning: Unable to read symbols from "Foundation" (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/UIKit.framework/UIKit (file not found). warning: Unable to read symbols from "UIKit" (not yet mapped into memory). warning: Unable to read symbols for (null)/Library/Frameworks/CoreGraphics.framework/CoreGraphics (file not found). warning: Unable to read symbols from "CoreGraphics" (not yet mapped into memory). warning: Unable to read symbols from "CoreData" (not yet mapped into memory). warning: Unable to read symbols from "QuartzCore" (not yet mapped into memory). warning: Unable to read symbols from "libgcc_s.1.dylib" (not yet mapped into memory). warning: Unable to read symbols from "libSystem.B.dylib" (not yet mapped into memory). warning: Unable to read symbols from "libobjc.A.dylib" (not yet mapped into memory). warning: Unable to read symbols from "CoreFoundation" (not yet mapped into memory). target remote-mobile /tmp/.XcodeGDBRemote-3836-28 Switching to remote-macosx protocol mem 0x1000 0x3fffffff cache mem 0x40000000 0xffffffff none mem 0x00000000 0x0fff none [Switching to thread 11523] [Switching to thread 11523] gdb stack crawl at point of internal error: 0 gdb-arm-apple-darwin 0x0013216e internal_vproblem + 316

    Read the article

  • itertools.product eliminating repeated reversed tuples

    - by genclik27
    I asked a question yesterday and thanks to Tim Peters, it is solved. The question is here; itertools.product eliminating repeated elements The new question is further version of this. This time I will generate tuples inside of tuples. Here is an example; lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]] When I use it in itertools.product function this is what I get, ((1, 2), (5, 2), (2, 1)) ((1, 2), (5, 2), (1, 2)) ((1, 2), (1, 2), (2, 1)) ((1, 2), (1, 2), (1, 2)) ((3, 4), (5, 2), (2, 1)) ((3, 4), (5, 2), (1, 2)) ((3, 4), (1, 2), (2, 1)) ((3, 4), (1, 2), (1, 2)) I want to change it in a way that if a sequence has (a,b) inside of it, then it can not have (b,a). In this example if you look at this sequence ((3, 4), (1, 2), (2, 1)) it has (1,2) and (2,1) inside of it. So, this sequence ((3, 4), (1, 2), (2, 1)) should not be considered in the results. As I said, I asked similar question before, in that case it was not considering duplicate elements. I try to adapt it to my problem. Here is modified code. Changed parts in old version are taken in comments. def reverse_seq(seq): s = [] for i in range(len(seq)): s.append(seq[-i-1]) return tuple(s) def uprod(*seqs): def inner(i): if i == n: yield tuple(result) return for elt in sets[i] - reverse: #seen.add(elt) rvrs = reverse_seq(elt) reverse.add(rvrs) result[i] = elt for t in inner(i+1): yield t #seen.remove(elt) reverse.remove(rvrs) sets = [set(seq) for seq in seqs] n = len(sets) #seen = set() reverse = set() result = [None] * n for t in inner(0): yield t In my opinion this code should work but I am getting error for the input lis = [[(1,2), (3,4)], [(5,2), (1,2)], [(2,1), (1,2)]]. I could not understand where I am wrong. for i in uprod(*lis): print i Output is, ((1, 2), (1, 2), (1, 2)) Traceback (most recent call last): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 39, in <module> for i in uprod(*lis): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 32, in uprod for t in inner(0): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 22, in inner for t in inner(i+1): File "D:\Users\SUUSER\workspace tree\sequence_covering _array\denemeler_buraya.py", line 25, in inner reverse.remove(rvrs) KeyError: (2, 1) Thanks,

    Read the article

  • Drupal how to set session or cookie?

    - by Gobi
    Hi, i jus friend reference function so i pass the user id through url like below www.example.com?fid=22 i need to set this as a session or cookie which access to all modules in drupal 6. if i set session it return for tht particular module . set cookie is not workin at all. $user-new_property works only on particular page where set if i move to another page no new_property in $user variable object list . Thanxs in advance, Gobi

    Read the article

  • due at midnight - program compiles but has logic error(s)

    - by Leslie Laraia
    not sure why this program isn't working. it compiles, but doesn't provide the expected output. the input file is basically just this: Smith 80000 Jones 100000 Scott 75000 Washington 110000 Duffy 125000 Jacobs 67000 Here is the program: import java.io.File; import java.io.FileNotFoundException; import java.util.Scanner; /** * * @author Leslie */ public class Election { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { // TODO code application logic here File inputFile = new File("C:\\Users\\Leslie\\Desktop\\votes.txt"); Scanner in = new Scanner(inputFile); int x = 0; String line = ""; Scanner lineScanner = new Scanner(line); line = in.nextLine(); while (in.hasNextLine()) { line = in.nextLine(); x++; } String[] senatorName = new String[x]; int[] votenumber = new int[x]; double[] votepercent = new double[x]; System.out.printf("%44s", "Election Results for State Senator"); System.out.println(); System.out.printf("%-22s", "Candidate"); //Prints the column headings to the screen System.out.printf("%22s", "Votes Received"); System.out.printf("%22s", "%of Total Votes"); int i; for(i=0; i<x; i++) { while(in.hasNextLine()) { line = in.nextLine(); String candidateName = lineScanner.next(); String candidate = candidateName.trim(); senatorName[i] = candidate; int votevalue = lineScanner.nextInt(); votenumber[i] = votevalue; } } votepercent = percentages(votenumber, x); for (i = 0; i < x; i++) { System.out.println(); System.out.printf("%-22s", senatorName[i]); System.out.printf("%22d", votenumber[i]); System.out.printf("%22.2f", votepercent[i]); System.out.println(); } } public static double [] percentages(int[] votenumber, int z) { double [] percentage = new double [z]; double total = 0; for (double element : votenumber) { total = total + element; } for(int i=0; i < votenumber.length; i++) { int y = votenumber[i]; percentage[i] = (y/total) * 100; } return percentage; } }

    Read the article

  • PHP Parse Error unexpected '{'

    - by Laxmidi
    Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Cell contents changing for rows present outside the height of tableview(to see this cells, we shud s

    - by wolverine
    I have set the size of the tableView that I show as the popoverController as 4*rowheight. And I am using 12cells in the tableView. Each cell contains an image and a label. I can see all the cells by scrolling. Upto 5th cell its ok. After th2 5th cell, the label and the image that I am using in the first four cells are being repeated for the remaining cells. And If I select the cell, the result is accurately shown. But when I again take the tableView, the image and labels are not accurate even for the first 5 cells. All are changed but the selection is giving the correct result. Can anyone help me?? - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [self tableviewCellWithReuseIdentifier:CellIdentifier rowNumber:indexPath.row]; } //tableView.backgroundColor = [UIColor clearColor]; return cell; } - (UITableViewCell *)tableviewCellWithReuseIdentifier:(NSString *)identifier rowNumber:(NSInteger)row { CGRect rect; rect = CGRectMake(0.0, 0.0, 360.0, ROW_HEIGHT); UITableViewCell *cell = [[[UITableViewCell alloc] initWithFrame:rect reuseIdentifier:identifier] autorelease]; UIImageView *myImageView = [[UIImageView alloc] initWithFrame:CGRectMake(10.00, 10.00, 150.00, 100.00)]; myImageView.tag = IMAGE_TAG; [cell.contentView addSubview:myImageView]; [myImageView release]; UILabel *label = [[UILabel alloc] initWithFrame:CGRectMake(170.00, -10.00, 170.00, 80.00)]; label.tag = LABEL_TAG; [label setBackgroundColor:[UIColor clearColor]]; [label setTextColor:[UIColor blackColor]]; [label setFont:[UIFont fontWithName:@"AmericanTypewriter" size:22]]; [label setTextAlignment:UITextAlignmentLeft]; [cell.contentView addSubview:label]; [label release]; if (row == 0) { UIImageView *imageView = (UIImageView *)[cell viewWithTag:IMAGE_TAG]; imageView.image = [UIImage imageNamed:[NSString stringWithFormat:@"cover_v.jpg"]]; UILabel *mylabel = (UILabel *)[cell viewWithTag:LABEL_TAG]; mylabel.text = [NSString stringWithFormat:@"COVER PAGE"]; } }

    Read the article

  • How to select number of lines from large text files?

    - by MiNdFrEaK
    I was wondering how to select number of lines from a certain text file. As an example: I have a text file containing the following lines: branch 27 : rect id 23400 rect: -115.475609 -115.474907 31.393650 31.411301 branch 28 : rect id 23398 rect: -115.474907 -115.472282 31.411301 31.417351 branch 29 : rect id 23396 rect: -115.472282 -115.468033 31.417351 31.427151 branch 30 : rect id 23394 rect: -115.468033 -115.458733 31.427151 31.438181 Non-Leaf Node: level=1 count=31 address=53 branch 0 : rect id 42 rect: -115.768539 -106.251556 31.425039 31.717550 branch 1 : rect id 50 rect: -109.559479 -106.009361 31.296721 31.775299 branch 2 : rect id 51 rect: -110.937401 -106.226143 31.285870 31.771971 branch 3 : rect id 54 rect: -109.584412 -106.069092 31.285240 31.775230 branch 4 : rect id 56 rect: -109.570961 -106.000954 31.296721 31.780769 branch 5 : rect id 58 rect: -115.806213 -106.366188 31.400450 31.687519 branch 6 : rect id 59 rect: -113.173859 -106.244057 31.297440 31.627750 branch 7 : rect id 60 rect: -115.811478 -106.278252 31.400450 31.679470 branch 8 : rect id 61 rect: -109.953888 -106.020111 31.325319 31.775270 branch 9 : rect id 64 rect: -113.070969 -106.015968 31.331841 31.704750 branch 10 : rect id 68 rect: -113.065689 -107.034576 31.326300 31.770809 branch 11 : rect id 71 rect: -112.333344 -106.059860 31.284081 31.662920 branch 12 : rect id 73 rect: -115.071083 -106.309677 31.267879 31.466850 branch 13 : rect id 74 rect: -116.094414 -106.286308 31.236290 31.424770 branch 14 : rect id 75 rect: -115.423264 -106.286308 31.229691 31.415510 branch 15 : rect id 76 rect: -116.111656 -106.313110 31.259390 31.478300 branch 16 : rect id 77 rect: -116.247467 -106.309677 31.240231 31.451799 branch 17 : rect id 78 rect: -116.170792 -106.094543 31.156429 31.391781 branch 18 : rect id 79 rect: -116.225723 -106.292709 31.239960 31.442850 branch 19 : rect id 80 rect: -116.268013 -105.769913 31.157240 31.378111 branch 20 : rect id 82 rect: -116.215424 -105.827202 31.198441 31.383421 branch 21 : rect id 83 rect: -116.095734 -105.826439 31.197460 31.373819 branch 22 : rect id 84 rect: -115.423264 -105.815018 31.182640 31.368891 branch 23 : rect id 85 rect: -116.221527 -105.776512 31.160931 31.389830 branch 24 : rect id 86 rect: -116.203369 -106.473831 31.168350 31.367611 branch 25 : rect id 87 rect: -115.727631 -106.501587 31.189100 31.395941 branch 26 : rect id 88 rect: -116.237289 -105.790756 31.164780 31.358959 branch 27 : rect id 89 rect: -115.791344 -105.990044 31.072620 31.349529 branch 28 : rect id 90 rect: -115.736847 -106.495079 31.187969 31.376900 branch 29 : rect id 91 rect: -115.721710 -106.000130 31.160351 31.354601 branch 30 : rect id 92 rect: -115.792236 -106.000793 31.166620 31.378811 Leaf Node: level=0 count=21 address=42 branch 0 : rect id 18312 rect: -106.412270 -106.401367 31.704750 31.717550 branch 1 : rect id 18288 rect: -106.278252 -106.253387 31.520321 31.548361 I just want those lines which are in between Non-Leaf Node level=1 to Leaf Node Level=0 and also there are a lot of segments like this and I need them all.

    Read the article

  • C++ include statement required if defining a map in a headerfile.

    - by Justin
    I was doing a project for computer course on programming concepts. This project was to be completed in C++ using Object Oriented designs we learned throughout the course. Anyhow, I have two files symboltable.h and symboltable.cpp. I want to use a map as the data structure so I define it in the private section of the header file. I #include <map> in the cpp file before I #include "symboltable.h". I get several errors from the compiler (MS VS 2008 Pro) when I go to debug/run the program the first of which is: Error 1 error C2146: syntax error : missing ';' before identifier 'table' c:\users\jsmith\documents\visual studio 2008\projects\project2\project2\symboltable.h 22 Project2 To fix this I had to #include <map> in the header file, which to me seems strange. Here are the relevant code files: // symboltable.h #include <map> class SymbolTable { public: SymbolTable() {} void insert(string variable, double value); double lookUp(string variable); void init(); // Added as part of the spec given in the conference area. private: map<string, double> table; // Our container for variables and their values. }; and // symboltable.cpp #include <map> #include <string> #include <iostream> using namespace std; #include "symboltable.h" void SymbolTable::insert(string variable, double value) { table[variable] = value; // Creates a new map entry, if variable name already exist it overwrites last value. } double SymbolTable::lookUp(string variable) { if(table.find(variable) == table.end()) // Search for the variable, find() returns a position, if thats the end then we didnt find it. throw exception("Error: Uninitialized variable"); else return table[variable]; } void SymbolTable::init() { table.clear(); // Clears the map, removes all elements. }

    Read the article

  • How do I detect server status in a port scanner java implementation

    - by akz
    I am writing a port scanner in Java and I want to be able to distinct the following 4 use cases: port is open port is open and server banner was read port is closed server is not live I have the following code: InetAddress address = InetAddress.getByName("google.com"); int[] ports = new int[]{21, 22, 23, 80, 443}; for (int i = 0; i < ports.length; i++) { int port = ports[i]; Socket socket = null; try { socket = new Socket(address, port); socket.setSoTimeout(500); System.out.println("port " + port + " open"); BufferedReader reader = new BufferedReader( new InputStreamReader(socket.getInputStream())); String line = reader.readLine(); if (line != null) { System.out.println(line); } socket.close(); } catch (SocketTimeoutException ex) { // port was open but nothing was read from input stream ex.printStackTrace(); } catch (ConnectException ex) { // port is closed ex.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } finally { if (socket != null && !socket.isClosed()) { try { socket.close(); } catch (Exception e) { e.printStackTrace(); } } } } The problem is that I get a ConnectionException both when the port is closed and the server cannot be reached but with a different exception message: java.net.ConnectException: Connection timed out: connect when the connection was never established and java.net.ConnectException: Connection refused: connect when the port was closed so I cannot make the distinction between the two use cases without digging into the actual exception message. Same thing happens when I try a different approach for the socket creation. If I use: socket = new Socket(); socket.setSoTimeout(500); socket.connect(new InetSocketAddress(address, port), 1000); I have the same problem but with the SocketTimeoutException instead. I get a java.net.SocketTimeoutException: Read timed out if port was open but there was no banner to be read and java.net.SocketTimeoutException: connect timed out if server is not live or port is closed. Any ideas? Thanks in advance!

    Read the article

  • Count seconds and minutes with MCU timer/interrupt?

    - by arynhard
    I am trying to figure out how to create a timer for my C8051F020 MCU. The following code uses the value passed to init_Timer2() with the following formula: 65535-(0.1 / (12/2000000)=48868. I set up the timer to count every time it executes and for every 10 counts, count one second. This is based on the above formula. 48868 when passed to init_Timer2 will produce a 0.1 second delay. It would take ten of them per second. However, when I test the timer it is a little fast. At ten seconds the timer reports 11 seconds, at 20 seconds the timer reports 22 seconds. I would like to get as close to a perfect second as I can. Here is my code: #include <compiler_defs.h> #include <C8051F020_defs.h> void init_Clock(void); void init_Watchdog(void); void init_Ports(void); void init_Timer2(unsigned int counts); void start_Timer2(void); void timer2_ISR(void); unsigned int timer2_Count; unsigned int seconds; unsigned int minutes; int main(void) { init_Clock(); init_Watchdog(); init_Ports(); start_Timer2(); P5 &= 0xFF; while (1); } //============================================================= //Functions //============================================================= void init_Clock(void) { OSCICN = 0x04; //2Mhz //OSCICN = 0x07; //16Mhz } void init_Watchdog(void) { //Disable watchdog timer WDTCN = 0xDE; WDTCN = 0xAD; } void init_Ports(void) { XBR0 = 0x00; XBR1 = 0x00; XBR2 = 0x40; P0 = 0x00; P0MDOUT = 0x00; P5 = 0x00; //Set P5 to 1111 P74OUT = 0x08; //Set P5 4 - 7 (LEDs) to push pull (Output) } void init_Timer2(unsigned int counts) { CKCON = 0x00; //Set all timers to system clock divided by 12 T2CON = 0x00; //Set timer 2 to timer mode RCAP2 = counts; T2 = 0xFFFF; //655535 IE |= 0x20; //Enable timer 2 T2CON |= 0x04; //Start timer 2 } void start_Timer2(void) { EA = 0; init_Timer2(48868); EA = 1; } void timer2_ISR(void) interrupt 5 { T2CON &= ~(0x80); P5 ^= 0xF0; timer2_Count++; if(timer2_Count % 10 == 0) { seconds++; } if(seconds % 60 == 0 && seconds != 0) { minutes++; } }

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • scrollTo (jQuery) won't work in firefox

    - by William
    For some reason, firefox seems to ignore my scrollTo function even though it works in chrome and safari. Here's an example link: http://blog.rainbird.me/post/2358248459/blowholes-are-awesome Chrome and Safari will automatically scroll to the top of the image (with an offset of 20 pixels) It doesn't work in firefox. I'm baffled! code: $(document).ready(function() { $(".photoShell img").lazyload({ placeholder: "http://william.rainbird.me/boston-polaroid/white.gif", threshold: 200 }); window.viewport = { height: function() { return $(window).height(); }, width: function() { return $(window).width(); }, scrollTop: function() { return $(window).scrollTop(); }, scrollLeft: function() { return $(window).scrollLeft(); } }; $(".photoShell img").hide(); $(".photoShell .caption").hide(); $(".photoShell img").load(function() { var maxWidth = viewport.width() - 40; // Max width for the image if(maxWidth > 960){ maxWidth = 960; } var maxHeight = viewport.height() - 50; // Max height for the image var ratio = 0; // Used for aspect ratio var width = $(this).width(); // Current image width var height = $(this).height(); // Current image height // Check if the current width is larger than the max if(width > maxWidth){ ratio = maxWidth / width; // get ratio for scaling image $(this).css("width", maxWidth); // Set new width $(this).css("height", height * ratio); // Scale height based on ratio height = height * ratio; // Reset height to match scaled image width = width * ratio; // Reset width to match scaled image } // Check if current height is larger than max if(height > maxHeight){ ratio = maxHeight / height; // get ratio for scaling image $(this).css("height", maxHeight); // Set new height $(this).css("width", width * ratio); // Scale width based on ratio width = width * ratio; // Reset width to match scaled image } $(this).parents('div.photoShell').css("width", $(this).width() + 22); $(this).parents('div.photoShell').addClass('loaded'); $(this).next(".caption").show(); var scrollNum = $(this).parents('div.photoShell').offset().top; $.scrollTo(scrollNum - 20, {duration: 700, axis:"y"}); $(this).fadeIn("slow"); }).each(function() { // trigger the load event in case the image has been cached by the browser if(this.complete) $(this).trigger('load'); });

    Read the article

  • MongoDB with OR and Range Indexes

    - by LMH
    I have a query: {"$query"=>{"user_id"=>"512f7960534dcda22b000491", "$or"=>[{"when_tz"=>{"$gte"=>2010-06-24 04:00:00 UTC, "$lt"=>2010-06-25 04:00:00 UTC}}, {"when_tz"=>{"$gte"=>2011-06-24 04:00:00 UTC, "$lt"=>2011-06-25 04:00:00 UTC}}, {"when_tz"=>{"$gte"=>2012-06-24 04:00:00 UTC, "$lt"=>2012-06-25 04:00:00 UTC}}], "_type"=>{"$in"=>["FacebookImageItem", "FoursquareImageItem", "InstagramItem", "TwitterImageItem", "Image"]}}, "$explain"=>true, "$orderby"=>{"when_tz"=>1}} And an index: { user_id: 1, _type: 1, when_tz: 1 } Explain: {"cursor"="BtreeCursor user_id_1__type_1_facebook_id_1 multi", "isMultiKey"=false, "n"=28, "nscannedObjects"=15094, "nscanned"=15098, "nscannedObjectsAllPlans"=181246, "nscannedAllPlans"=241553, "scanAndOrder"=true, "indexOnly"=false, "nYields"=12, "nChunkSkips"=0, "millis"=2869, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "facebook_id"=[[{"$minElement"=1}, {"$maxElement"=1}]]}, "allPlans"=[{"cursor"="BtreeCursor user_id_1__type_1_facebook_id_1 multi", "n"=28, "nscannedObjects"=15094, "nscanned"=15098, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "facebook_id"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1__type_1_twitter_id_1 multi", "n"=28, "nscannedObjects"=15094, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "twitter_id"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1__type_1_instagram_id_1 multi", "n"=28, "nscannedObjects"=15094, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "instagram_id"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1__type_1_foursquare_id_1 multi", "n"=28, "nscannedObjects"=15094, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "foursquare_id"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_phash_1", "n"=21, "nscannedObjects"=15097, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "phash"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_aperature_1_shutter_speed_1_when_tz_1", "n"=25, "nscannedObjects"=35, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "aperature"=[[{"$minElement"=1}, {"$maxElement"=1}]], "shutter_speed"=[[{"$minElement"=1}, {"$maxElement"=1}]], "when_tz"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_image_hash_1", "n"=22, "nscannedObjects"=15097, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "image_hash"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_time_zone_guessed_1_when_tz_-1", "n"=23, "nscannedObjects"=32, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "time_zone_guessed"=[[{"$minElement"=1}, {"$maxElement"=1}]], "when_tz"=[[{"$maxElement"=1}, {"$minElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_time_zone_guessed_1_when_tz_1", "n"=24, "nscannedObjects"=33, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "time_zone_guessed"=[[{"$minElement"=1}, {"$maxElement"=1}]], "when_tz"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_time_zone_guessed_1_when_utc_-1", "n"=23, "nscannedObjects"=15097, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "time_zone_guessed"=[[{"$minElement"=1}, {"$maxElement"=1}]], "when_utc"=[[{"$maxElement"=1}, {"$minElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_time_zone_guessed_1_when_utc_1", "n"=24, "nscannedObjects"=15097, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "time_zone_guessed"=[[{"$minElement"=1}, {"$maxElement"=1}]], "when_utc"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1_original_shared_item_id_1", "n"=24, "nscannedObjects"=15097, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "original_shared_item_id"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1__type_1_s3_tmp_file_1 multi", "n"=28, "nscannedObjects"=15094, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "s3_tmp_file"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1__type_1_processed_-1_uploaded_-1_image_device_1 multi", "n"=28, "nscannedObjects"=15094, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "processed"=[[{"$maxElement"=1}, {"$minElement"=1}]], "uploaded"=[[{"$maxElement"=1}, {"$minElement"=1}]], "image_device"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BtreeCursor user_id_1__type_1_when_tz_1 multi", "n"=28, "nscannedObjects"=28, "nscanned"=15097, "indexBounds"={"user_id"=[["512f7960534dcda22b000491", "512f7960534dcda22b000491"]], "_type"=[["FacebookImageItem", "FacebookImageItem"], ["FoursquareImageItem", "FoursquareImageItem"], ["Image", "Image"], ["InstagramItem", "InstagramItem"], ["TwitterImageItem", "TwitterImageItem"]], "when_tz"=[[{"$minElement"=1}, {"$maxElement"=1}]]}}, {"cursor"="BasicCursor", "n"=0, "nscannedObjects"=15097, "nscanned"=15097, "indexBounds"={}}], "server"=""} Any idea how to get it to hit the indexes?

    Read the article

  • Performance issues in android game

    - by user1446632
    I am making an android game, but however, the game is functioning like it should, but i am experiencing some performance issues. I think it has something to do with the sound. Cause each time i touch the screen, it makes a sound. I am using the standard MediaPlayer. The method is onTouchEvent() and onPlaySound1(). Could you please help me with an alternate solution for playing the sound? Thank you so much in advance! It would be nice if you also came up with some suggestions on how i can improve my code. Take a look at my code here: package com.mycompany.mygame; import java.util.ArrayList; import android.content.Context; import android.content.Intent; import android.graphics.Bitmap; import android.graphics.BitmapFactory; import android.graphics.Canvas; import android.graphics.Color; import android.graphics.Paint; import android.media.MediaPlayer; import android.os.Handler; import android.os.Message; import android.util.Log; import android.view.Menu; import android.view.MenuInflater; import android.view.MenuItem; import android.view.MotionEvent; import android.view.SurfaceHolder; import android.view.SurfaceView; import android.view.View; import android.webkit.WebView; import android.widget.TextView; import android.widget.Toast; public class ExampleView extends SurfaceView implements SurfaceHolder.Callback { class ExampleThread extends Thread { private ArrayList<Parachuter> parachuters; private Bitmap parachuter; private Bitmap background; private Paint black; private boolean running; private SurfaceHolder mSurfaceHolder; private Context mContext; private Context mContext1; private Handler mHandler; private Handler mHandler1; private GameScreenActivity mActivity; private long frameRate; private boolean loading; public float x; public float y; public float x1; public float y1; public MediaPlayer mp1; public MediaPlayer mp2; public int parachuterIndexToResetAndDelete; public int canvasGetWidth; public int canvasGetWidth1; public int canvasGetHeight; public int livesLeftValue; public int levelValue = 1; public int levelValue1; public int parachutersDown; public int difficultySet; public boolean isSpecialAttackAvailible; public ExampleThread(SurfaceHolder sHolder, Context context, Handler handler) { mSurfaceHolder = sHolder; mHandler = handler; mHandler1 = handler; mContext = context; mActivity = (GameScreenActivity) context; parachuters = new ArrayList<Parachuter>(); parachuter = BitmapFactory.decodeResource(getResources(), R.drawable.parachuteman); black = new Paint(); black.setStyle(Paint.Style.FILL); black.setColor(Color.GRAY); background = BitmapFactory.decodeResource(getResources(), R.drawable.gamescreenbackground); running = true; // This equates to 26 frames per second. frameRate = (long) (1000 / 26); loading = true; mp1 = MediaPlayer.create(getContext(), R.raw.bombsound); } @Override public void run() { while (running) { Canvas c = null; try { c = mSurfaceHolder.lockCanvas(); synchronized (mSurfaceHolder) { long start = System.currentTimeMillis(); doDraw(c); long diff = System.currentTimeMillis() - start; if (diff < frameRate) Thread.sleep(frameRate - diff); } } catch (InterruptedException e) { } finally { if (c != null) { mSurfaceHolder.unlockCanvasAndPost(c); } } } } protected void doDraw(Canvas canvas) { canvas.drawRect(0, 0, canvas.getWidth(), canvas.getHeight(), black); //Draw for (int i = 0; i < parachuters.size(); i++) { canvas.drawBitmap(parachuter, parachuters.get(i).getX(), parachuters.get(i).getY(), null); parachuters.get(i).tick(); } //Remove for (int i = 0; i < parachuters.size(); i++) { if (parachuters.get(i).getY() > canvas.getHeight()) { parachuters.remove(i); onPlaySound(); checkLivesLeftValue(); checkAmountOfParachuters(); } else if(parachuters.get(i).isTouched()) { parachuters.remove(i); } else{ //Do nothing } } } public void loadBackground(Canvas canvas) { //Load background canvas.drawBitmap(background, 0, 0, black); } public void checkAmountOfParachuters() { mHandler.post(new Runnable() { @Override public void run() { if(parachuters.isEmpty()) { levelValue = levelValue + 1; Toast.makeText(getContext(), "New level! " + levelValue, 15).show(); if (levelValue == 3) { drawParachutersGroup1(); drawParachutersGroup2(); drawParachutersGroup3(); drawParachutersGroup4(); } else if (levelValue == 5) { drawParachutersGroup1(); drawParachutersGroup2(); drawParachutersGroup3(); drawParachutersGroup4(); drawParachutersGroup5(); } else if (levelValue == 7) { drawParachutersGroup1(); drawParachutersGroup2(); drawParachutersGroup3(); drawParachutersGroup4(); drawParachutersGroup5(); drawParachutersGroup6(); } else if (levelValue == 9) { //Draw 7 groups of parachuters drawParachutersGroup1(); drawParachutersGroup2(); drawParachutersGroup3(); drawParachutersGroup4(); drawParachutersGroup5(); drawParachutersGroup6(); drawParachutersGroup1(); } else if (levelValue > 9) { //Draw 7 groups of parachuters drawParachutersGroup1(); drawParachutersGroup2(); drawParachutersGroup3(); drawParachutersGroup4(); drawParachutersGroup5(); drawParachutersGroup6(); drawParachutersGroup1(); } else { //Draw normal 3 groups of parachuters drawParachutersGroup1(); drawParachutersGroup2(); drawParachutersGroup3(); } } else { //Do nothing } } }); } private void checkLivesLeftValue() { mHandler.post(new Runnable() { @Override public void run() { Log.d("checkLivesLeftValue", "lives = " + livesLeftValue); // TODO Auto-generated method stub if (livesLeftValue == 3) { //Message to display: "You lost! Log.d("checkLivesLeftValue", "calling onMethod now"); parachuters.removeAll(parachuters); onMethod(); } else if (livesLeftValue == 2) { Toast.makeText(getContext(), "Lives left=1", 15).show(); livesLeftValue = livesLeftValue + 1; Log.d("checkLivesLeftValue", "increased lives to " + livesLeftValue); } else if (livesLeftValue == 1) { Toast.makeText(getContext(), "Lives left=2", 15).show(); livesLeftValue = livesLeftValue + 1; Log.d("checkLivesLeftValue", "increased lives to " + livesLeftValue); } else { //Set livesLeftValueText 3 Toast.makeText(getContext(), "Lives left=3", 15).show(); livesLeftValue = livesLeftValue + 1; Log.d("checkLivesLeftValue", "increased lives to " + livesLeftValue); } } }); } public void onMethod() { mHandler.post(new Runnable() { @Override public void run() { try { Toast.makeText(getContext(), "You lost!", 15).show(); livesLeftValue = 0; //Tell the user that he lost: android.content.Context ctx = mContext; Intent i = new Intent(ctx, playerLostMessageActivity.class); i.addFlags(Intent.FLAG_ACTIVITY_NEW_TASK); i.putExtra("KEY","You got to level " + levelValue + " And you shot down " + parachutersDown + " parachuters"); i.putExtra("levelValue", levelValue); ctx.startActivity(i); System.exit(0); } catch (Exception e) { // TODO Auto-generated catch block e.printStackTrace(); //Exit activity and start playerLostMessageActivity Toast.makeText(getContext(), "You lost!", 15).show(); livesLeftValue = 0; //Tell the user that he lost: android.content.Context ctx = mContext; Intent i = new Intent(ctx, playerLostMessageActivity.class); i.addFlags(Intent.FLAG_ACTIVITY_NEW_TASK); i.putExtra("KEY","You got to level " + levelValue + " And you shot down " + parachutersDown + " parachuters"); i.putExtra("levelValue", levelValue); System.exit(0); ctx.startActivity(i); System.exit(0); } } }); } public void onPlaySound() { try { mp1.start(); } catch (Exception e) { e.printStackTrace(); mp1.release(); } } public void onDestroy() { try { parachuters.removeAll(parachuters); mp1.stop(); mp1.release(); } catch (Exception e) { e.printStackTrace(); } } public void onPlaySound1() { try { mp2 = MediaPlayer.create(getContext(), R.raw.airriflesoundeffect); mp2.start(); } catch (Exception e) { e.printStackTrace(); mp2.release(); } } public boolean onTouchEvent(MotionEvent event) { if (event.getAction() != MotionEvent.ACTION_DOWN) releaseMediaPlayer(); x1 = event.getX(); y1 = event.getY(); checkAmountOfParachuters(); removeParachuter(); return false; } public void releaseMediaPlayer() { try { mp1.release(); } catch (Exception e) { e.printStackTrace(); } } public void removeParachuter() { try { for (Parachuter p: parachuters) { if (x1 > p.getX() && x1 < p.getX() + parachuter.getWidth() && y1 > p.getY() && y1 < p.getY() + parachuter.getHeight()) { p.setTouched(true); onPlaySound1(); parachutersDown = parachutersDown + 1; p.setTouched(false); } } } catch (Exception e) { e.printStackTrace(); } } public void initiateDrawParachuters() { drawParachutersGroup1(); } public void drawParachutersGroup1() { // TODO Auto-generated method stub //Parachuter group nr. 1 //Parachuter nr. 2 x = 75; y = 77; Parachuter p1 = new Parachuter(x, y); parachuters.add(p1); //Parachuter nr.1 x = 14; y = 28; Parachuter p = new Parachuter(x, y); parachuters.add(p); //Parachuter nr. 3 x = 250; y = 94; Parachuter p3 = new Parachuter(x, y); parachuters.add(p3); //Parachuter nr. 3 x = 275; y = 80; Parachuter p2 = new Parachuter(x, y); parachuters.add(p2); //Parachuter nr. 5 x = 280; y = 163; Parachuter p5 = new Parachuter(x, y); parachuters.add(p5); x = 125; y = 118; Parachuter p4 = new Parachuter(x, y); parachuters.add(p4); //Parachuter nr. 7 x = 126; y = 247; Parachuter p7 = new Parachuter(x, y); parachuters.add(p7); //Parachuter nr. 6 x = 123; y = 77; Parachuter p6 = new Parachuter(x, y); parachuters.add(p6); } public void drawParachutersGroup2() { // TODO Auto-generated method stub //Parachuter group nr. 2 //Parachuter nr. 5 x = 153; y = 166; Parachuter p5 = new Parachuter(x, y); parachuters.add(p5); x = 133; y = 123; Parachuter p4 = new Parachuter(x, y); parachuters.add(p4); //Parachuter nr. 7 x = 170; y = 213; Parachuter p7 = new Parachuter(x, y); parachuters.add(p7); //Parachuter nr. 6 x = 190; y = 121; Parachuter p6 = new Parachuter(x, y); parachuters.add(p6); } public void drawParachutersGroup3() { // TODO Auto-generated method stub //Parachuter group nr. 3 //Parachuter nr. 2 x = 267; y = 115; Parachuter p1 = new Parachuter(x, y); parachuters.add(p1); //Parachuter nr.1 x = 255; y = 183; Parachuter p = new Parachuter(x, y); parachuters.add(p); //Parachuter nr. 3 x = 170; y = 280; Parachuter p3 = new Parachuter(x, y); parachuters.add(p3); //Parachuter nr. 3 x = 116; y = 80; Parachuter p2 = new Parachuter(x, y); parachuters.add(p2); //Parachuter nr. 5 x = 67; y = 112; Parachuter p5 = new Parachuter(x, y); parachuters.add(p5); x = 260; y = 89; Parachuter p4 = new Parachuter(x, y); parachuters.add(p4); //Parachuter nr. 7 x = 260; y = 113; Parachuter p7 = new Parachuter(x, y); parachuters.add(p7); //Parachuter nr. 6 x = 178; y = 25; Parachuter p6 = new Parachuter(x, y); parachuters.add(p6); } public void drawParachutersGroup4() { // TODO Auto-generated method stub //Parachuter group nr. 1 //Parachuter nr. 2 x = 75; y = 166; Parachuter p1 = new Parachuter(x, y); parachuters.add(p1); //Parachuter nr.1 x = 118; y = 94; Parachuter p = new Parachuter(x, y); parachuters.add(p); //Parachuter nr. 3 x = 38; y = 55; Parachuter p3 = new Parachuter(x, y); parachuters.add(p3); //Parachuter nr. 3 x = 57; y = 18; Parachuter p2 = new Parachuter(x, y); parachuters.add(p2); //Parachuter nr. 5 x = 67; y = 119; Parachuter p5 = new Parachuter(x, y); parachuters.add(p5); x = 217; y = 113; Parachuter p4 = new Parachuter(x, y); parachuters.add(p4); //Parachuter nr. 7 x = 245; y = 234; Parachuter p7 = new Parachuter(x, y); parachuters.add(p7); //Parachuter nr. 6 x = 239; y = 44; Parachuter p6 = new Parachuter(x, y); parachuters.add(p6); } public void drawParachutersGroup5() { // TODO Auto-generated method stub //Parachuter group nr. 1 //Parachuter nr. 2 x = 59; y = 120; Parachuter p1 = new Parachuter(x, y); parachuters.add(p1); //Parachuter nr.1 x = 210; y = 169; Parachuter p = new Parachuter(x, y); parachuters.add(p); //Parachuter nr. 3 x = 199; y = 138; Parachuter p3 = new Parachuter(x, y); parachuters.add(p3); //Parachuter nr. 3 x = 22; y = 307; Parachuter p2 = new Parachuter(x, y); parachuters.add(p2); //Parachuter nr. 5 x = 195; y = 22; Parachuter p5 = new Parachuter(x, y); parachuters.add(p5); x = 157; y = 132; Parachuter p4 = new Parachuter(x, y); parachuters.add(p4); //Parachuter nr. 7 x = 150; y = 183; Parachuter p7 = new Parachuter(x, y); parachuters.add(p7); //Parachuter nr. 6 x = 130; y = 20; Parachuter p6 = new Parachuter(x, y); parachuters.add(p6); } public void drawParachutersGroup6() { // TODO Auto-generated method stub //Parachuter group nr. 1 //Parachuter nr. 2 x = 10; y = 10; Parachuter p1 = new Parachuter(x, y); parachuters.add(p1); //Parachuter nr.1 x = 20; y = 20; Parachuter p = new Parachuter(x, y); parachuters.add(p); //Parachuter nr. 3 x = 30; y = 30; Parachuter p3 = new Parachuter(x, y); parachuters.add(p3); //Parachuter nr. 3 x = 60; y = 60; Parachuter p2 = new Parachuter(x, y); parachuters.add(p2); //Parachuter nr. 5 x = 90; y = 90; Parachuter p5 = new Parachuter(x, y); parachuters.add(p5); x = 120; y = 120; Parachuter p4 = new Parachuter(x, y); parachuters.add(p4); //Parachuter nr. 7 x = 150; y = 150; Parachuter p7 = new Parachuter(x, y); parachuters.add(p7); //Parachuter nr. 6 x = 180; y = 180; Parachuter p6 = new Parachuter(x, y); parachuters.add(p6); } public void drawParachuters() { Parachuter p = new Parachuter(x, y); parachuters.add(p); Toast.makeText(getContext(), "x=" + x + " y=" + y, 15).show(); } public void setRunning(boolean bRun) { running = bRun; } public boolean getRunning() { return running; } } /** Handle to the application context, used to e.g. fetch Drawables. */ private Context mContext; /** Pointer to the text view to display "Paused.." etc. */ private TextView mStatusText; /** The thread that actually draws the animation */ private ExampleThread eThread; public ExampleView(Context context) { super(context); // register our interest in hearing about changes to our surface SurfaceHolder holder = getHolder(); holder.addCallback(this); // create thread only; it's started in surfaceCreated() eThread = new ExampleThread(holder, context, new Handler() { @Override public void handleMessage(Message m) { // mStatusText.setVisibility(m.getData().getInt("viz")); // mStatusText.setText(m.getData().getString("text")); } }); setFocusable(true); } @Override public boolean onTouchEvent(MotionEvent event) { return eThread.onTouchEvent(event); } public ExampleThread getThread() { return eThread; } @Override public void surfaceChanged(SurfaceHolder arg0, int arg1, int arg2, int arg3) { // TODO Auto-generated method stub } public void surfaceCreated(SurfaceHolder holder) { if (eThread.getState() == Thread.State.TERMINATED) { eThread = new ExampleThread(getHolder(), getContext(), getHandler()); eThread.start(); } else { eThread.start(); } } @Override public void surfaceDestroyed(SurfaceHolder holder) { boolean retry = true; eThread.setRunning(false); while (retry) { try { eThread.join(); retry = false; } catch (InterruptedException e) { } } } }

    Read the article

  • C# AES returns wrong Test Vectors

    - by ralu
    I need to implement some crypto protocol on C# and want to say that this is my first project in C#. After spending some time to get used on C# I found out that I am unable to get compliant AES vectors. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; namespace ConsoleApplication1 { class Program { public static void Main() { try { //test vectors from "ecb_vk.txt" byte[] key = { 0x80, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] data = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] encTest = { 0x0e, 0xdd, 0x33, 0xd3, 0xc6, 0x21, 0xe5, 0x46, 0x45, 0x5b, 0xd8, 0xba, 0x14, 0x18, 0xbe, 0xc8 }; AesManaged aesAlg = new AesManaged(); aesAlg.BlockSize = 128; aesAlg.Key = key; aesAlg.Mode = CipherMode.ECB; ICryptoTransform encryptor = aesAlg.CreateEncryptor(); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); StreamWriter swEncrypt = new StreamWriter(csEncrypt); swEncrypt.Write(data); swEncrypt.Close(); csEncrypt.Close(); msEncrypt.Close(); aesAlg.Clear(); byte[] encr; encr = msEncrypt.ToArray(); string datastr = BitConverter.ToString(data); string encrstr = BitConverter.ToString(encr); string encTestStr = BitConverter.ToString(encTest); Console.WriteLine("data: {0}", datastr); Console.WriteLine("encr: {0}", encrstr); Console.WriteLine("should: {0}", encTestStr); Console.ReadKey(); } catch (Exception e) { Console.WriteLine("Error: {0}", e.Message); } } } } Output is wrong: data: 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 encr: A0-3C-C2-22-A4-32-F7-C9-BA-36-AE-73-66-BD-BB-A3 should: 0E-DD-33-D3-C6-21-E5-46-45-5B-D8-BA-14-18-BE-C8 I am sure that there is correct AES implementation in C#, so I need some advice from C# wizard to help whit this. Thanks

    Read the article

  • What is the problems for my xml file format ?

    - by python
    <? $xml="<?xml version='1.0' encoding='UTF-8' standalone='no'?> <Document> <pain.001.001.02> <books> <book> <qty>12</qty> <title>C++</title> </book> <book> <qty>21</qty> <title>PHP</title> </book> </books> <books> <book> <qty>25</qty> <title>Java</title> </book> <book> <qty>32</qty> <title>Python</title> </book> <book> <qty>22</qty> <title>History</title> </book> </books> </pain.001.001.02> </Document> "; $doc = new DOMDOcument; $doc->loadxml($xml); $xpath = new DOMXpath($doc); $arr = array( array( '12;C++', '21;PHP'), array( '25;Java', '32;Python' ) ); # Remove elements based on qty and title foreach($arr as $items) { foreach($items as $item) { list($qty, $title) = explode(';', $item); foreach($xpath->query('//pain.001.001.02/books/book[title="'.$title.'"][qty="'.$qty.'"]') as $book) { $book->parentNode->removeChild($book); } } } # Remove empty <books> foreach($xpath->query('pain.001.001.02/books[count(book)=0]') as $empty) { $empty->parentNode->removeChild($empty); } header('Content-type: text/xml'); echo $doc->savexml(); ?> If I put <Document> in the xml document , get the expected result BUT If change <Document> to <Document xmlns="urn:iso:std:iso:20022:tech:xsd:pain.001.001.02"> get UNEXPECTED RESULT? Do you have any idea? thanks

    Read the article

  • treeview size in wpf

    - by AComputert
    please let me know how can I re size height of tree view control when screen resolution is changed? please see this code: <TreeView Name="treeView1" Height="150" VerticalAlignment="Top"> <TreeViewItem Header="Root" IsExpanded="True"> <TreeViewItem Header="Item 1"></TreeViewItem> <TreeViewItem Header="Item 2"></TreeViewItem> <TreeViewItem Header="Item 3"></TreeViewItem> <TreeViewItem Header="Item 4"></TreeViewItem> <TreeViewItem Header="Item 5"></TreeViewItem> <TreeViewItem Header="Item 6"></TreeViewItem> <TreeViewItem Header="Item 7"></TreeViewItem> <TreeViewItem Header="Item 8"></TreeViewItem> <TreeViewItem Header="Item 9"></TreeViewItem> <TreeViewItem Header="Item 10"></TreeViewItem> <TreeViewItem Header="Item 11"></TreeViewItem> <TreeViewItem Header="Item 12"></TreeViewItem> <TreeViewItem Header="Item 13"></TreeViewItem> <TreeViewItem Header="Item 14"></TreeViewItem> <TreeViewItem Header="Item 15"></TreeViewItem> <TreeViewItem Header="Item 16"></TreeViewItem> <TreeViewItem Header="Item 17"></TreeViewItem> <TreeViewItem Header="Item 18"></TreeViewItem> <TreeViewItem Header="Item 19"></TreeViewItem> <TreeViewItem Header="Item 20"></TreeViewItem> <TreeViewItem Header="Item 21"></TreeViewItem> <TreeViewItem Header="Item 22"></TreeViewItem> <TreeViewItem Header="Item 23"></TreeViewItem> <TreeViewItem Header="Item 24"></TreeViewItem> <TreeViewItem Header="Item 24"></TreeViewItem> </TreeViewItem> </TreeView> in some screen resolutions i can see all nodse and in some resolutions i see a scroll bar. I want to see all nodes without scroll bar.

    Read the article

  • error: expected `;' before '{' token - What is the cause?

    - by melee
    Here is my implementation file: using namespace std; #include <iostream> #include <iomanip> #include <string> #include <stack> //line 5 #include "proj05.canvas.h" //----------------Constructor----------------// Canvas::Canvas() //line 10 { Title = ""; Nrow = 0; Ncol = 0; image[][100]; // line 15 position.r = 0; position.c = 0; } //-------------------Paint------------------// line 20 void Canvas::Paint(int R, int C, char Color) { cout << "Paint to be implemented" << endl; } The errors I'm getting are these: proj05.canvas.cpp: In function 'std::istream& operator>>(std::istream&, Canvas&)': proj05.canvas.cpp:11: error: expected `;' before '{' token proj05.canvas.cpp:22: error: a function-definition is not allowed here before '{' token proj05.canvas.cpp:24: error: expected `}' at end of input proj05.canvas.cpp:24: error: expected `}' at end of input These seem like simple syntax errors, but I am not sure what's wrong. Could someone decode these for me? I'd really appreciate it, thanks for your time! EDIT Here is the definition of Canvas in my .h file: #ifndef CANVAS_H #define CANVAS_H #include <iostream> #include <iomanip> #include <string> #include <stack> class Canvas { public: Canvas(); void Paint(int R, int C, char Color); const int Nrow; const int Ncol; string Title; int image[][100]; stack<int> path; struct PixelCoordinates { unsigned int r; unsigned int c; } position; }; #endif

    Read the article

  • Boost thread synchronization in release build

    - by Joseph16
    Hi, when I try to run the following code in debug and release mode in VS2005. Each time I see different output in console and It doesn't seem like the multithreading is achieved in release mode. 1. #include <boost/thread.hpp> 2. #include <iostream> 3. 4. void wait(int seconds) 5. { 6. boost::this_thread::sleep(boost::posix_time::seconds(seconds)); 7. } 8. 9. boost::mutex mutex; 10. 11. void thread() 12. { 13. for (int i = 0; i < 5; ++i) 14. { 15. //wait(1); 16. mutex.lock(); 17. std::cout << "Thread " << boost::this_thread::get_id() << ": " << i << std::endl; 18. mutex.unlock(); 19. } 20. } 21. 22. int main() 23. { 24. boost::thread t1(thread); 25. boost::thread t2(thread); 26. t1.join(); 27. t2.join(); 28. } Debug Mode Thread 00153E60: 0 Thread 00153E90: 0 Thread 00153E60: 1 Thread 00153E90: 1 Thread 00153E90: 2 Thread 00153E60: 2 Thread 00153E90: 3 Thread 00153E60: 3 Thread 00153E60: 4 Thread 00153E90: 4 Press any key to continue . . . Release Mode Thread 00153D28: 0 Thread 00153D28: 1 Thread 00153D28: 2 Thread 00153D28: 3 Thread 00153D28: 4 Thread 00153D58: 0 Thread 00153D58: 1 Thread 00153D58: 2 Thread 00153D58: 3 Thread 00153D58: 4 Press any key to continue . . .

    Read the article

  • mod_rewrite htaccess redirect on specific request

    - by John
    is there a way to make mod_rewrite redirect all urls contain the following request: ?do=page&f=* to a specific page? for example: http://example.com/index.php?do=page&f=2 http://example.com/index2.php?do=page&f=4 http://example.com/page.php?do=page&f=22 to: http://example.com/custom.php

    Read the article

  • Get values from HTML in a multidimensional array and calculate values using PHP

    - by Frank Nwoko
    I have searched but could not get solution on this issue. I am working on an application which will generate unknown number of items and have users select the quantity from a drop down against each item. Eg. Item(s) | price | Select qty Rice 23 3 Beans 22 4 Eggs 52 5 ... ... ... unknown Please, how can I capture the above in an array and also calculate the total value for all selected items and corresponding fees? I have the following HTML code: <form id='form1' name='form1' method='post' action='item_calc.php'> <?php ..... while($t_row = mysql_fetch_assoc($get_items)) { echo "<p><label>$t_row['$item_name'] <input type='text' READONLY name='item_price[]' value='$t_row['$item_price']' /></label> <input type='text' READONLY name='item_fees[]' value='$t_row['$item_fee']' /> <select name="item_qty"> <option value="1"> <option value="2"> <option value="3"> <option value="4"> <option value="5"> </select> </p><p>"; } echo "<label><input type='submit' name='submit' value='Submit' /></label></p> </form>"; Please, how can I get item_price[] + item_fees[] * item_qty for all selected items? This is what I have tried: for ($i = 0; $i < count($_POST['item_price']); $i++) { // Do something here with $_POST['checkbx'][$i] foreach ($_POST['item_fees'] as $tkey => $tvalue) { //echo "Key: $tkey; Value: $tvalue<br>"; } foreach ($_POST['item_price'] as $pkey => $pvalue) { //echo "Key: $pkey; Value: $pvalue<br>"; } $total = $tvalue + $pvalue; } echo $total;

    Read the article

< Previous Page | 139 140 141 142 143 144 145 146 147 148 149 150  | Next Page >