Search Results

Search found 16331 results on 654 pages for 'long ouyang'.

Page 144/654 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How can I get the type I want?

    - by Danny Chen
    There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

    Read the article

  • Spring + iBatis + Hessian caching

    - by ILya
    Hi. I have a Hessian service on Spring + iBatis working on Tomcat. I'm wondering how to cache results... I've made the following config in my sqlmap file: <sqlMap namespace="Account"> <cacheModel id="accountCache" type="MEMORY" readOnly="true" serialize="false"> <flushInterval hours="24"/> <flushOnExecute statement="Account.addAccount"/> <flushOnExecute statement="Account.deleteAccount"/> <property name="reference-type" value="STRONG" /> </cacheModel> <typeAlias alias="Account" type="domain.Account" /> <select id="getAccounts" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts; </select> <select id="getAccount" parameterClass="Long" resultClass="Account" cacheModel="accountCache"> fix all; select id, name, pin from accounts where id=#id#; </select> <insert id="addAccount" parameterClass="Account"> fix all; insert into accounts (id, name, pin) values (#id#, #name#, #pin#); </insert> <delete id="deleteAccount" parameterClass="Long"> fix all; delete from accounts where id = #id#; </delete> </sqlMap> Then i've done some tests... I have a hessian client application. I'm calling getAccounts several times and after each call it's a query to DBMS. How to make my service to query DBMS only a first time (after server restart) getAccounts called and for the following calls to use a cache?

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

  • When to drop an IT job

    - by Nippysaurus
    In my career I have had two programming jobs. Both these jobs were in a field that I am most familiar with (C# / MSSQL) but I have quit both jobs for the same reason: unmanageable code and bad (loose) company structure. There was something in common with both these jobs: small companies (in one I was the only developer). Currently I am in the following position: being given written instructions which are almost impossible to follow (somewhat of a fools errand). we are given short time constraints, but seldom asked how long work will take, and when we do it is always too long and needs to be shorter (and when it ends up taking longer than they need it to take, it's always our fault). there is no time for proper documenting, but we get blamed for not documenting (see previous point). Management is constantly screwing me around, saying I'm underperforming on a given task (which is not true, and switching me to a task which is much more confusing). So I must ask my fellow developers: how bad does a job need to be before you would consider jumping ship? And what to look out for when considering taking a job. In future I will be asking about documented procedures, release control, bug management and adoption of new technologies. EDIT: Let me add some more fuel to the fire ... I have been in my current job for just over a year, and the work I am doing almost never uses any of the knowledge I have gained from the other work I have been doing here. Everything is a giant learning curve. Because of this about 30% of my time is learning what is going on with this new product (who's owner / original developer has left the company), 30% trying to find the relevant documentation that helps the whole thing make sense, 30% actually finding where to make the change, 10% actually making the change.

    Read the article

  • Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

    - by vIceBerg
    I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

    Read the article

  • Using shared_ptr to implement RCU (read-copy-update)?

    - by yongsun
    I'm very interested in the user-space RCU (read-copy-update), and trying to simulate one via tr1::shared_ptr, here is the code, while I'm really a newbie in concurrent programming, would some experts help me to review? The basic idea is, reader calls get_reading_copy() to gain the pointer of current protected data (let's say it's generation one, or G1). writer calls get_updating_copy() to gain a copy of the G1 (let's say it's G2), and only one writer is allowed to enter the critical section. After the updating is done, writer calls update() to do a swap, and make the m_data_ptr pointing to data G2. The ongoing readers and the writer now hold the shared_ptr of G1, and either a reader or a writer will eventually deallocate the G1 data. Any new readers would get the pointer to G2, and a new writer would get the copy of G2 (let's say G3). It's possible the G1 is not released yet, so multiple generations of data my co-exists. template <typename T> class rcu_protected { public: typedef T type; typedef std::tr1::shared_ptr<type> rcu_pointer; rcu_protected() : m_data_ptr (new type()) {} rcu_pointer get_reading_copy () { spin_until_eq (m_is_swapping, 0); return m_data_ptr; } rcu_pointer get_updating_copy () { spin_until_eq (m_is_swapping, 0); while (!CAS (m_is_writing, 0, 1)) {/* do sleep for back-off when exceeding maximum retry times */} rcu_pointer new_data_ptr(new type(*m_data_ptr)); // as spin_until_eq does not have memory barrier protection, // we need to place a read barrier to protect the loading of // new_data_ptr not to be re-ordered before its construction _ReadBarrier(); return new_data_ptr; } void update (rcu_pointer new_data_ptr) { while (!CAS (m_is_swapping, 0, 1)) {} m_data_ptr.swap (new_data_ptr); // as spin_until_eq does not have memory barrier protection, // we need to place a write barrier to protect the assignments of // m_is_writing/m_is_swapping be re-ordered bofore the swapping _WriteBarrier(); m_is_writing = 0; m_is_swapping = 0; } private: volatile long m_is_writing; volatile long m_is_swapping; rcu_pointer m_data_ptr; };

    Read the article

  • How can I keep an event from being delivered to the GUI until my code finished running?

    - by Frerich Raabe
    I installed a global mouse hook function like this: mouseEventHook = ::SetWindowsHookEx( WH_MOUSE_LL, mouseEventHookFn, thisModule, 0 ); The hook function looks like this: RESULT CALLBACK mouseEventHookFn( int code, WPARAM wParam, LPARAM lParam ) { if ( code == HC_ACTION ) { PMSLLHOOKSTRUCT mi = (PMSLLHOOKSTRUCT)lParam; // .. do interesting stuff .. } return ::CallNextHookEx( mouseEventHook, code, wParam, lParam ); } Now, my problem is that I cannot control how long the 'do interesting stuff' part takes exactly. In particular, it might take longer than the LowLevelHooksTimeout defined in the Windows registry. This means that, at least on Windows XP, the system no longer delivers mouse events to my hook function. I'd like to avoid this, but at the same time I need the 'do interesting stuff' part to happen before the target GUI receives the event. I attempted to solve this by doing the 'interesting stuff' work in a separate thread so that the mouseEventHookFn above can post a message to the worker thread and then do a return 1; immediately (which ends the hook function but avoids that the event is handed to the GUI). The idea was that the worker thread, when finished, performs the CallNextHookEx call itself. However, this causes a crash inside of CallNextHookEx (in fact, the crash occurs inside an internal function called PhkNextValid. I assume it's not safe to call CallNextHookEx from outside a hook function, is this true? If so, does anybody else know how I can run code (which needs to interact with the GUI thread of an application) before the GUI receives the event and avoid that my hook function blocks too long?

    Read the article

  • Deserialize xml which uses attribute name/value pairs

    - by Bodyloss
    My application receives a constant stream of xml files which are more or less a direct copy of the database record <record type="update"> <field name="id">987654321</field> <field name="user_id">4321</field> <field name="updated">2011-11-24 13:43:23</field> </record> And I need to deserialize this into a class which provides nullable property's for all columns class Record { public long? Id { get; set; } public long? UserId { get; set; } public DateTime? Updated { get; set; } } I just cant seem to work out a method of doing this without having to parse the xml file manually and switch on the field's name attribute to store the values. Is their a way this can be achieved quickly using an XmlSerializer? And if not is their a more efficient way of parsing it manually? Regards and thanks My main problem is that the attribute name needs to have its value set to a property name and its value as the contents of a <field>..</field> element

    Read the article

  • Why doesn't java.lang.Number implement Comparable?

    - by Julien Chastang
    Does anyone know why java.lang.Number does not implement Comparable? This means that you cannot sort Numbers with Collections.sort which seems to me a little strange. Post discussion update: Thanks for all the helpful responses. I ended up doing some more research about this topic. The simplest explanation for why java.lang.Number does not implement Comparable is rooted in mutability concerns. For a bit of review, java.lang.Number is the abstract super-type of AtomicInteger, AtomicLong, BigDecimal, BigInteger, Byte, Double, Float, Integer, Long and Short. On that list, AtomicInteger and AtomicLong to do not implement Comparable. Digging around, I discovered that it is not a good practice to implement Comparable on mutable types because the objects can change during or after comparison rendering the result of the comparison useless. Both AtomicLong and AtomicInteger are mutable. The API designers had the forethought to not have Number implement Comparable because it would have constrained implementation of future subtypes. Indeed, AtomicLong and AtomicInteger were added in Java 1.5 long after java.lang.Number was initially implemented. Apart from mutability, there are probably other considerations here too. A compareTo implementation in Number would have to promote all numeric values to BigDecimal because it is capable of accommodating all the Number sub-types. The implication of that promotion in terms of mathematics and performance is a bit unclear to me, but my intuition finds that solution kludgy.

    Read the article

  • With C# 3.0, how to write Interface based code with generic collection?

    - by Deecay
    I want to write code that is decouple and clean, and I know that by programming to an interface instead of the implementation, my code will be more flexible and extensible. So, instead of writing methods like: bool IsProductAvailable(ProductTypeA product); I write methods like: bool IsProductAvailable(IProduct product); As long as my products implement IProduct: class ProductTypeA : IProduct I should be OK. All is well until I start using generic collections. Since C# 3.0 doesn't support covariant and contravariant, even though both ProuctTypeA and ProductTypeB implements IProduct, you cannot put List in List. This is pretty troublesome because a lot of times I want to write something like: bool AreProductsAvailable(List<IProduct> products); So that I can check product avaialbility by writing: List<ProductA> productsArrived = GetDataFromDataabase(); bool result = AreProductsAvailable(productsArrived); And I want to write just one AreProductsAvailable() method that works with all IProduct collections. I know that C# 4.0 is going to support covariant and contravariant, but I also realize that there other libraries that seemed to have the problem solved. For instance, I was trying out ILOG Gantt the gantt chart control, and found that they have a lot of collection intefaces that looks like this: IActivityCollection ILinkCollection So it seems like their approach is wrapping the generic collection with an interface. So instead of "bool AreProductsAvailable(List products);", I can do: bool AreProductsAvailable(IProductCollection products); And then write some code so that IProductCollection takes whatever generic collection of IProduct, be it List or List. However, I don't know how to write an IProductCollection interface that does that "magic". :-< (ashame) .... Could someone shed me some light? This has been bugging me for so long, and I so wanted to do the "right thing". Well, thanks!

    Read the article

  • MSForms.ListBox Type Mismatch in Access

    - by Jason
    I have an Access database where I use a Tab control (without tabs) to simulate a wizard. One of the tab pages has an MSForms.ListBox control called lstPorts, and a button named cmdAdd which adds the contents of a textbox to the List Box. I then try to keep the contents of the ListBox sorted. However, the call to the Sort method causes a type mismatch. Here is the cmdAdd_Click() code behind: Private Sub cmdAdd_Click() Dim test As MSForms.ListBox lstPorts2.AddItem (txtPortName) Call SortListBox(lstPorts2) End Sub Here is the SortListBox Sub: Public Sub SortListBox(ByRef oLb As MSForms.ListBox) Dim vaItems As Variant Dim i As Long, j As Long Dim vTemp As Variant 'Put the items in a variant array vaItems = oLb.List For i = LBound(vaItems, 1) To UBound(vaItems, 1) - 1 For j = i + 1 To UBound(vaItems, 1) If vaItems(i, 0) > vaItems(j, 0) Then vTemp = vaItems(i, 0) vaItems(i, 0) = vaItems(j, 0) vaItems(j, 0) = vTemp End If Next j Next i 'Clear the listbox oLb.Clear 'Add the sorted array back to the listbox For i = LBound(vaItems, 1) To UBound(vaItems, 1) oLb.AddItem vaItems(i, 0) Next i End Sub Any help out there? Since the Sort routine explicitly references the MSForms.ListBox, most of the results from Google aren't applicable. Jason

    Read the article

  • Runnable to be run every second only runs once in Fragment onCreateView()

    - by jul
    I'm trying to update the time in a TextView with a Runnable supposed to be run every second. The Runnable is started from a Fragment's onCreateView(), but it's only executed once. Anybody can help? Thanks public class MyFragment extends Fragment { Calendar mCalendar; private Runnable mTicker; private Handler mHandler; TextView mClock; String mFormat; private boolean mClockStopped = false; @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { RelativeLayout view = (RelativeLayout) inflater.inflate(R.layout.meteo_widget, container, false); /* * Clock (from DigitalClock widget source) */ mClock = (TextView) view.findViewById(R.id.clock); mCalendar = Calendar.getInstance(); mHandler = new Handler(); mTicker = new Runnable() { public void run() { if(mClockStopped) return; mCalendar.setTimeInMillis(System.currentTimeMillis()); mClock.setText(DateFormat.format("hh:mm:ss", mCalendar)); mClock.invalidate(); long now = SystemClock.uptimeMillis(); long next = now + (1000 - now % 1000); mHandler.postAtTime(mTicker, next); } }; mTicker.run(); return view; } @Override public void onResume() { super.onResume(); mClockStopped = true; } @Override public void onPause() { mClockStopped = false; super.onPause(); } }

    Read the article

  • Select statement with multiple 'where' fields using same value without duplicating text

    - by kdbdallas
    I will start by saying that I don't think what I want can be done, but that said, I am hoping I am wrong and someone knows more than me. So here is your chance... Prove you are smarter than me :) I want to do a search against a SQLite table looking for any records that "are similar" without having to write out the query in long hand. To clarify this is how I know I can write the query: select * from Articles where title like '%Bla%' or category like '%Bla%' or post like '%Bla%' This works and is not a huge deal if you are only checking against a couple of columns, but if you need to check against a bunch then your query can get really long and nasty looking really fast, not to mention the chance for typos. (ie: 'Bla%' instead of '%Bla%') What I am wondering is if there is a short hand way to do this? *This next code does not work the way I want, but just shows kind of what I am looking for select * from Articles where title or category or post like '%Bla%' Anyone know if there is a way to specify that multiple 'where' columns should use the same search value without listing that same search value for every column? Thanks in advance!

    Read the article

  • Drawing an image in Java, slow as hell on a netbook.

    - by Norswap
    In follow-up to my previous questions (especially this one : http://stackoverflow.com/questions/2684123/java-volatileimage-slower-than-bufferedimage), i have noticed that simply drawing an Image (it doesn't matter if it's buffered or volatile, since the computer has no accelerated memory*, and tests shows it's doesn't change anything), tends to be very long. (*) System.out.println(GraphicsEnvironment.getLocalGraphicsEnvironment() .getDefaultScreenDevice().getAvailableAcceleratedMemory()); --> 0 How long ? For a 500x400 image, about 0.04 seconds. This is only drawing the image on the backbuffer (obtained via buffer strategy). Now considering that world of warcraft runs on that netbook (tough it is quite laggy) and that online java games seems to have no problem whatsoever, this is quite thought provoking. I'm quite certain I didn't miss something obvious, I've searched extensively the web, but nothing will do. So do any of you java whiz have an idea of what obscure problem might be causing this (or maybe it is normal, tough I doubt it) ? PS : As I'm writing this I realized this might be cause by my Linux installation (archlinux) tough I have the correct Intel driver. But my computer normally has "Integrated Intel Graphics Media Accelerator 950", which would mean it should have accelerated video memory somehow. Any ideas about this side of things ?

    Read the article

  • Speed up an Excel Macro?

    - by N. Lucas
    Right now I have a macro PopulateYearlyValues But it seems to me it's taking way too long Sub PopulateYearlyValues(ByVal Month As Range) Dim c As Double Dim s As Double c = Application.WorksheetFunction.Match(UCase(Month.Value), ActiveSheet.Range("AA5:AX5"), 0) s = (ActiveSheet.Range("AA5").Column - 1) With ActiveSheet Dim i As Integer Dim j As Integer For i = 7 To 44 .Range("G" & i).Value = 0 .Range("H" & i).Value = 0 For j = 1 To c .Range("G" & i).Value = (.Range("G" & i).Value + .Cells(i, s).Offset(0, j)) .Range("H" & i).Value = (.Range("H" & i).Value + .Cells(i, s).Offset(0, (j + 1))) j = j + 1 Next j Next i End With End Sub I have a range G7:H44 that needs to be populated with the SUM of range AA7:AX44 but.. it's only every other column: If Month.Value = "January" G7 = SUM(AA7) H7 = SUM(AB7) ... G44 = SUM(AA44) H44 = SUM(AB44) End If If Month.Value = "April" G7 = SUM(AA7, AC7, AE7, AG7) H7 = SUM(AB7, AD7, AF7, AH7) ... G44 = SUM(AA44, AC44, AE44, AG44) H44 = SUM(AB44, AD44, AF44, AH44) End If But the macro I have is taking way too long.. Is there any other way to do this?

    Read the article

  • Not loading associations without proxies in NHibernate

    - by Alice
    I don't like the idea of proxy and lazy loading. I don't need that. I want pure POCO. And I want to control loading associations explicitly when I need. Here is entity public class Post { public long Id { get; set; } public long OwnerId { get; set; } public string Content { get; set; } public User Owner { get; set; } } and mapping <class name="Post"> <id name="Id" /> <property name="OwnerId" /> <property name="Content" /> <many-to-one name="Owner" column="OwnerId" /> </class> However if I specify lazy="false" in the mapping, Owner is always eagerly fetched. I can't remove many-to-one mapping because that also disables explicit loading or a query like from x in session.Query<Comment>() where x.Owner.Title == "hello" select x; I specified lazy="true" and set use_proxy_validator property to false. But that also eager loads Owner. Is there any way to load only Post entity?

    Read the article

  • Python FTP grabbing and saving images issue

    - by PylonsN00b
    OK So I have been messing with this all day long. I am fairly new to Python FTP. So I have searched through here and came up w/ this: images = notions_ftp.nlst() for image_name in image_names: if found_url == False: try: for image in images: ftp_image_name = "./%s" % image_name if ftp_image_name == image: found_url = True image_name_we_want = image_name except: pass # We failed to find an image for this product, it will have to be done manually if found_url == False: log.info("Image ain't there baby -- SKU: %s" % sku) return False # Hey we found something! Open the image.... notions_ftp.retrlines("RETR %s" % image_name_we_want, open(image_name_we_want, "rb")) 1/0 So I have narrowed the error down to the line before I divide by zero. Here is the error: Traceback (most recent call last): File "<console>", line 6, in <module> File "<console>", line 39, in insert_image IOError: [Errno 2] No such file or directory: '411483CC-IT,IM.jpg' So if you follow the code you will see that the image IS in the directory because image_name_we_want is set if found in that directory listing on the first line of my code. And I KNOW it's there because I am looking at the FTP site myself and ...it's freakin there. So at some point during all of this I got the image to save locally, which is most desired, but I have long since forgot what I used to make it do that. Either way, why does it think that the image isn't there when it clearly finds it in the listing.

    Read the article

  • What's the best way to store Logon User information for Web Application?

    - by Morgan Cheng
    I was once in a project of web application developed on ASP.NET. For each logon user, there is an object (let's call it UserSessionObject here) created and stored in RAM. For each HTTP request of given user, matching UserSessoinObject instance is used to visit user state information and connection to database. So, this UserSessionObject is pretty important. This design brings several problems found later: 1) Since this UserSessionObject is cached in ASP.NET memory space, we have to config load balancer to be sticky connection. That is, HTTP request in single session would always be sent to one web server behind. This limit scalability and maintainability. 2) This UserSessionObject is accessed in every HTTP request. To keep the consistency, there is a exclusive lock for the UserSessionObject. Only one HTTP request can be processed at any given time because it must to obtain the lock first. The performance and response time is affected. Now, I'm wondering whether there is better design to handle such logon user case. It seems Sharing-Nothing-Architecture helps. That means long user info is retrieved from database each time. I'm afraid that would hurt performance. Is there any design pattern for long user web app? Thanks.

    Read the article

  • How to detect column conflicts with Hibernate?

    - by Slim
    So let's say I have an ArrayList full of Products that need to be committed to the database via Hibernate. There are already a large number of Products in the database. Each product has an ID. Note this is NOT the PK that is autogenerated by Hibernate. My questions is: what is the best way to detect conflicts with this ID? I am looking for a relatively efficient method of obtaining, from the the database, a List of Products that share an ID with any of the Products in my ArrayList. This is all in a single table called Products and the ID attribute is in column ProductID. The way I've done it is grabbing a list of all Products in the database, and compared each one with each entry in my ArrayList - but that is seriously inefficient and I don't think it would work well with a larger database. How should it be done? Thanks. I say "relatively" efficient because efficiency is not the primary concern, but it shouldn't take noticeably long to test against a table of ~1000-5000 rows. Help? EDIT* I'm very new to hibernate and below is the best I've come up with. How does this look? for(long id : idList){ //idList just holds the IDs of each Product in my ArrayList Query query = session.createQuery("select product from Product product where product.id = :id"); query.setLong("id", id); for(int i = 0; i < query.list().size(); i++){ listOfConflictingProducts.add((Product) query.list().get(i)); } }

    Read the article

  • How can I send GET data to multiple URLs at the same time using cURL?

    - by Rob
    My apologies, I've actually asked this question multiple times, but never quite understood the answers. Here is my current code: while($resultSet = mysql_fetch_array($SQL)){ $ch = curl_init($resultSet['url'] . $fullcurl); //load the urls and send GET data curl_setopt($ch, CURLOPT_TIMEOUT, 2); //Only load it for two seconds (Long enough to send the data) curl_exec($ch); //Execute the cURL curl_close($ch); //Close it off } //end while loop What I'm doing here, is taking URLs from a MySQL Database ($resultSet['url']), appending some extra variables to it, just some GET data ($fullcurl), and simply requesting the pages. This starts the script running on those pages, and that's all that this script needs to do, is start those scripts. It doesn't need to return any output. Just the load the page long enough for the script to start. However, currently it's loading each URL (currently 11) one at a time. I need to load all of them simultaneously. I understand I need to use curl_multi_*, but I haven't the slightest idea on how cURL functions work, so I don't know how to change my code to use curl_multi_* in a while loop. So my questions are: How can I change this code to load all of the URLs simultaneously? Please explain it and not just give me code. I want to know what each individual function does exactly. Will curl_multi_exec even work in a while loop, since the while loop is just sending each row one at a time? And of course, any references, guides, tutorials about cURL functions would be nice, as well. Preferably not so much from php.net, as while it does a good job of giving me the syntax, its just a little dry and not so good with the explanations.

    Read the article

  • Can a WebServiceHost be changed to avoid the use of HttpListener?

    - by sbyse
    I am looking for a way to use a WCF WebServiceHost without having to rely on the HttpListener class and it's associated permission problems (see this question for details). I'm working on a application which communicates locally with another (third-party) application via their REST API. At the moment we are using WCF as an embedded HTTP server. We create a WebServiceHost as follows: String hostPath = "http://localhost:" + portNo; WebServiceHost host = new WebServiceHost(typeof(IntegrationService), new Uri(hostPath)); // create a webhttpbinding for rest/pox and enable cookie support for session management WebHttpBinding webHttpBinding = new WebHttpBinding(); webHttpBinding.AllowCookies = true; ServiceEndpoint ep = host.AddServiceEndpoint(typeof(IIntegrationService), webHttpBinding, ""); host.Open() ChannelFactory<IIntegrationService> cf = new ChannelFactory<IIntegrationService>(webHttpBinding, hostPath); IIntegrationService channel = cf.CreateChannel(); Everything works nicely as long as our application is run as administrator. If we run our application on a machine without administrative privileges the host.Open() will throw an HttpListenerException with ErrorCode == 5 (ERROR_ACCESS_DENIED). We can get around the problem by running httpcfg.exe from the command line but this is a one-click desktop application and that's not really as long term solution for us. We could ditch WCF and write our own HTTP server but I'd like to avoid that if possible. What's the easiest way to replace HttpListener with a standard TCP socket while still using all of the remaining HTTP scaffolding that WCF provides?

    Read the article

  • Modify this code to read bytes in the reverse endian?

    - by ibiza
    Hi, I have this bit of code which reads an 8 bytes array and converts it to a int64. I would like to know how to tweak this code so it would work when receiving data represented with the reverse endian... protected static long getLong(byte[] b, int off) { return ((b[off + 7] & 0xFFL) >> 0) + ((b[off + 6] & 0xFFL) << 8) + ((b[off + 5] & 0xFFL) << 16) + ((b[off + 4] & 0xFFL) << 24) + ((b[off + 3] & 0xFFL) << 32) + ((b[off + 2] & 0xFFL) << 40) + ((b[off + 1] & 0xFFL) << 48) + (((long) b[off + 0]) << 56); } Thanks for the help!

    Read the article

  • Howcome some C++ functions with unspecified linkage build with C linkage?

    - by christoffer
    This is something that makes me fairly perplexed. I have a C++ file that implements a set of functions, and a header file that defines prototypes for them. When building with Visual Studio or MingW-gcc, I get linking errors on two of the functions, and adding an 'extern "C"' qualifier resolved the error. How is this possible? Header file, "some_header.h": // Definition of struct DEMO_GLOBAL_DATA omitted DWORD WINAPI ThreadFunction(LPVOID lpData); void WriteLogString(void *pUserData, const char *pString, unsigned long nStringLen); void CheckValid(DEMO_GLOBAL_DATA *pData); int HandleStart(DEMO_GLOBAL_DATA * pDAta, TCHAR * pLogFileName); void HandleEnd(DEMO_GLOBAL_DATA *pData); C++ file, "some_implementation.cpp" #include "some_header.h" DWORD WINAPI ThreadFunction(LPVOID lpData) { /* omitted */ } void WriteLogString(void *pUserData, const char *pString, unsigned long nStringLen) { /* omitted */ } void CheckValid(DEMO_GLOBAL_DATA *pData) { /* omitted */ } int HandleStart(DEMO_GLOBAL_DATA * pDAta, TCHAR * pLogFileName) { /* omitted */ } void HandleEnd(DEMO_GLOBAL_DATA *pData) { /* omitted */ } The implementations compile without warnings, but when linking with the UI code that calls these, I get a normal error LNK2001: unresolved external symbol "int __cdecl HandleStart(struct _DEMO_GLOBAL_DATA *, wchar_t *) error LNK2001: unresolved external symbol "void __cdecl CheckValid(struct _DEMO_MAIN_GLOBAL_DATA * What really confuses me, now, is that only these two functions (HandleStart and CheckValid) seems to be built with C linkage. Explicitly adding "extern 'C'" declarations for only these two resolved the linking error, and the application builds and runs. Adding "extern 'C'" on some other function, such as HandleEnd, introduces a new linking error, so that one is obviously compiled correctly. The implementation file is never modified in any of this, only the prototypes.

    Read the article

  • MySQL Database is Indexed at Apache Solr, How to access it via URL

    - by Wasim
    data-config.xml <dataConfig> <dataSource encoding="UTF-8" type="JdbcDataSource" driver="com.mysql.jdbc.Driver" url="jdbc:mysql://localhost:3306/somevisits" user="root" password=""/> <document name="somevisits"> <entity name="login" query="select * from login"> <field column="sv_id" name="sv_id" /> <field column="sv_username" name="sv_username" /> </entity> </document> </dataConfig> schema.xml <?xml version="1.0" encoding="UTF-8" ?> <schema name="example" version="1.5"> <fields> <field name="sv_id" type="string" indexed="true" stored="true" required="true" multiValued="false" /> <field name="username" type="string" indexed="true" stored="true" required="true"/> <field name="_version_" type="long" indexed="true" stored="true" multiValued="false"/> <field name="text" type="string" indexed="true" stored="false" multiValued="true"/> </fields> <uniqueKey>sv_id</uniqueKey> <types> <fieldType name="string" class="solr.StrField" sortMissingLast="true" /> <fieldType name="long" class="solr.TrieLongField" precisionStep="0" positionIncrementGap="0"/> </types> </schema> Solr successfully imported mysql database using full http://[localSolr]:8983/solr/#/collection1/dataimport?command=full-import My question is, how to access that mysql imported database now?

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >