Search Results

Search found 6869 results on 275 pages for 'tab ordering'.

Page 144/275 | < Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >

  • How to hot-add a vCPU to a virtual SQL Server

    One of the benefits of running SQL on virtual environment is the capability to present additional vCPUs to the virtual server online and real-time without interruption to running processes. Our VM administrator normally presents only 1 vCPU on the virtual server and extends as required. This article describes how SQL Server is able to detect hot-added vCPUs in my virtual server. New! SQL Prompt 6 – now with tab historyWriting, exploring, and editing SQL just became even more effortless with SQL Prompt 6. Download a free trial.

    Read the article

  • select tag sits one pixel lower in Firefox than it does in Chrome

    - by sepoto
    #allday { width: 180px; height: 20px; margin-top: 2px !important; margin-right: 0px; padding: 0px; -webkit-appearance: menulist; box-sizing: border-box; -webkit-box-align: center; border: 1px solid; border-image: initial; white-space: pre; -webkit-rtl-ordering: logical; color: black; background-color: white; cursor: default; } I inspected the element in both browsers but I'm not really seeing where the discrepancy is. Has anyone been through this before with the select tag?

    Read the article

  • What's the simplest way of defining lexicographic comparison for elements of a class?

    - by the_mandrill
    If I have a class that I want to be able to sort (ie support a less-than concept), and it has several data items such that I need to do lexicographic ordering then I need something like this: struct MyData { string surname; string forename; bool operator<(const MyData& other) const { return surname < other.surname || (surname==other.surname && forename < other.forename); } }; This becomes pretty unmanageable for anything with more than 2 data members. Are there any simpler ways of achieving it? The data members may be any Comparable class.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Release Note for 3/30/2012

    We have been pretty busy working on a new UI for CodePlex, I will have a preview post coming shortly. Here are the notes from today’s release: Updated source code tab to show Author and Committer for Git (Thanks to Brad Wilson for reporting) Fixed issue where pagination did not work correctly in topic view Fixed issue where additional comments on a given line of code would get overridden for Git project Have ideas on how to improve CodePlex? Visit our ideas page! Vote for your favorite ideas or submit a new one. Got Twitter? Follow us and keep apprised of the latest releases and service status at @codeplex.

    Read the article

  • receive xml file as a parameter to a .net web service

    - by fizch
    My company is currently looking into bringing a new piece of third party software in for online ordering. The software does not handle pricing so they are requesting the pricing information from a web service. Their software is passing an XML file as a parameter, and expecting an XML file as a response. I would think that returning an XML file would be pretty straight forward, but I cannot think of a way to receive an XML file as a parameter. Has anyone done this, or am I missing something really obvious?

    Read the article

  • Initialise a wix CheckBox's check state based on a property?

    - by MauriceL
    How does one initalise a Wix check box based on the value of a property? So far, I've done the following: <Control Id="Checkbox" Type="CheckBox" X="0" Y="0" Width="100" Height="15" Property="CHECKBOX_SELECTION" Text="I want this feature" CheckBoxValue="1" TabSkip="no"> <Condition Action="hide">HIDE_CHECKBOX</Condition> <Condition Action="show">NOT HIDE_CHECKBOX</Condition> </Control> Currently I have two custom actions to set HIDE_CHECKBOX and CHECKBOX_SELECTION. The CHECKBOX_SELECTION custom action occurs immediately after the HIDE_CHECKBOX action. What I'm seeing is that HIDE_CHECKBOX is behaving correctly (ie. the checkbox is hidden) which suggests that I've got the ordering of custom actions correct, but CHECKBOX_SELECTION is not changing the check state of the check box. Is this a safe assumption? Also, I've confirmed that SELECTION is being set to '1' in the logs.

    Read the article

  • Given a user control with a form containing validation can I validate entirely server side?

    - by JoshBaltzell
    We have an existing User Control that was built to dynamically generate a web form for an end user. This form includes required field validators, custom validators that use server side code and Regular Expression validatiors. We now have a need to use all these validators to verify that all the needed data is entered when using a separate ordering process that cannot be validated in the same way, but has the same validation requirements before it is added to the database. I would like to use this user control to validate the input by passing it all the values and checking the validation summary. The only way I know how to do this is to render it to a page on the client side and trigger the form submit. Is there any way to populate and validate a web form entirely on the server side?

    Read the article

  • When Less is More

    - by aditya.agarkar
    How do you reconcile the fact that while the overall warehouse volume is down you still need more workers in the warehouse to ship all the orders? A WMS customer recently pointed out this seemingly perplexing fact in a customer conference. So what is going on? Didn't we tell you before that for a warehouse the customer is really the "king"? In this case customers are merely responding to a low overall low demand and uncertainty. They do not want to hold down inventory and one of the ways to do that is by decreasing the order size and ordering more frequently. Overall impact to the warehouse? Two words: "More work!!" This is not all. Smaller order sizes also mean challenges from a transportation perspective including a rise in costlier parcel or LTL shipments instead of cheaper TL shipments. Here is a hypothetical scenario where a customer reduces the order size by 10% and increases the order frequency by 10%. As you can see in the following table, the overall volume declines by 1% but the warehouse has to ship roughly 10% more lines. Order Frequency (Line Count)Order Size (Units)Total VolumeChange (%)10010010,000 -110909,900-1% If you want to see how "Less is More" in graphical terms, this is how it appears: Even though the volume is down, there is going to be more work in the warehouse in terms of number of lines shipped. The operators need to pick more discrete orders, pack them into more shipping containers and ship more deliveries. What do you do differently if you are facing this situation?In this case here are some obvious steps to take:Uno: Change your pick methods. If you are used to doing order picks, it needs to go out the door. You need to evaluate batch picking and grouping techniques. Go for cluster picking, go for zone picking, pick and pass...anything that improves your picker productivity. More than anything, cluster picking works like a charm and above all, its simple and very effective. Dos: Are you minimize "touch" points in your pick process? Consider doing one step pick, pack and confirm i.e. pick and pack stuff directly into shipping cartons. Done correctly the container will not require any more "touch" points all the way to the trailer loading. Use cartonization!Tres: Are the being picked from an optimized pick face? Are the items slotted correctly? This needs to be looked into. Consider automated "pull" or "push" replenishment into your pick face and also make sure that high demand items are occupying the golden zones.  Cuatro: Are you tracking labor productivity? If not there needs to be a concerted push for having labor standards in place. Hope you found these ideas useful.

    Read the article

  • How can I get my progress reviewed as a solo junior developer

    - by Oliver Hyde
    I am currently working for a 2 person company, as the solo primary developer. My boss gets the clients, mocks up some png design templates and hands them over to me. This system has been working fine and i'm really enjoying it. The types of projects I work on are for small - medium sized businesses and they usually want a CMS system. Developed from scratch i'll build a customised backend for the client to add/edit/remove categories, tags, products etc and then output them to the front end according to the design template handed to me. As time has gone on, the projects have increased in complexity, with shopping cart / ordering features and other common e-commerce type features. Again, this system has been working fine and i'm really enjoying it. My issue is my personal development as a programmer. I spend a lot of my spare time reading programming blogs, checking through stackexchange, reading suggested programming books (currently on 'The Pragmatic Programmer', really good so far), doing brain exercises (lumosity.com and khanacademy math problems), doing lots of physical exercise and other personal development type activities. I can't help but feel though, that I'm missing out on feedback, critique. My boss is great and never holds back on praise in regards to my work, but he unfortunately is either to busy to check my code, or to be honest, I don't think it's one of his specialties and so can't provide feedback. I want to know what i'm doing wrong and what i'm doing right. Should I be putting that much logic in the controller, am I modulating my code enough etc. So what I have done is developed a little 'Family Budgeting' app and tried to do it as cleanly and effectively as I currently know how. What i'm wanting to know is, is there somewhere I can submit this app, and have some seasoned developers provide feedback. It's not just a subsection of my code like 'codereview.stackexchange' appears to require, it's my entire workflow that I want critiqued. I know this is a lot to ask, and I expect the main advice given will be to look for a job within a team, which is certainly something I will look into later down the track, but for now I want to persist with my current employment situation, but just don't want to develop too many bad habits. Let me know if I can provide any further information to help clarify, or if this isn't the right place for this type of question I apologise in advance. Didn't want to use reddit as I felt this community fosters more well thought out responses.

    Read the article

  • C#/.NET Little Wonders: The ConcurrentDictionary

    - by James Michael Hare
    Once again we consider some of the lesser known classes and keywords of C#.  In this series of posts, we will discuss how the concurrent collections have been developed to help alleviate these multi-threading concerns.  Last week’s post began with a general introduction and discussed the ConcurrentStack<T> and ConcurrentQueue<T>.  Today's post discusses the ConcurrentDictionary<T> (originally I had intended to discuss ConcurrentBag this week as well, but ConcurrentDictionary had enough information to create a very full post on its own!).  Finally next week, we shall close with a discussion of the ConcurrentBag<T> and BlockingCollection<T>. For more of the "Little Wonders" posts, see the index here. Recap As you'll recall from the previous post, the original collections were object-based containers that accomplished synchronization through a Synchronized member.  While these were convenient because you didn't have to worry about writing your own synchronization logic, they were a bit too finely grained and if you needed to perform multiple operations under one lock, the automatic synchronization didn't buy much. With the advent of .NET 2.0, the original collections were succeeded by the generic collections which are fully type-safe, but eschew automatic synchronization.  This cuts both ways in that you have a lot more control as a developer over when and how fine-grained you want to synchronize, but on the other hand if you just want simple synchronization it creates more work. With .NET 4.0, we get the best of both worlds in generic collections.  A new breed of collections was born called the concurrent collections in the System.Collections.Concurrent namespace.  These amazing collections are fine-tuned to have best overall performance for situations requiring concurrent access.  They are not meant to replace the generic collections, but to simply be an alternative to creating your own locking mechanisms. Among those concurrent collections were the ConcurrentStack<T> and ConcurrentQueue<T> which provide classic LIFO and FIFO collections with a concurrent twist.  As we saw, some of the traditional methods that required calls to be made in a certain order (like checking for not IsEmpty before calling Pop()) were replaced in favor of an umbrella operation that combined both under one lock (like TryPop()). Now, let's take a look at the next in our series of concurrent collections!For some excellent information on the performance of the concurrent collections and how they perform compared to a traditional brute-force locking strategy, see this wonderful whitepaper by the Microsoft Parallel Computing Platform team here. ConcurrentDictionary – the fully thread-safe dictionary The ConcurrentDictionary<TKey,TValue> is the thread-safe counterpart to the generic Dictionary<TKey, TValue> collection.  Obviously, both are designed for quick – O(1) – lookups of data based on a key.  If you think of algorithms where you need lightning fast lookups of data and don’t care whether the data is maintained in any particular ordering or not, the unsorted dictionaries are generally the best way to go. Note: as a side note, there are sorted implementations of IDictionary, namely SortedDictionary and SortedList which are stored as an ordered tree and a ordered list respectively.  While these are not as fast as the non-sorted dictionaries – they are O(log2 n) – they are a great combination of both speed and ordering -- and still greatly outperform a linear search. Now, once again keep in mind that if all you need to do is load a collection once and then allow multi-threaded reading you do not need any locking.  Examples of this tend to be situations where you load a lookup or translation table once at program start, then keep it in memory for read-only reference.  In such cases locking is completely non-productive. However, most of the time when we need a concurrent dictionary we are interleaving both reads and updates.  This is where the ConcurrentDictionary really shines!  It achieves its thread-safety with no common lock to improve efficiency.  It actually uses a series of locks to provide concurrent updates, and has lockless reads!  This means that the ConcurrentDictionary gets even more efficient the higher the ratio of reads-to-writes you have. ConcurrentDictionary and Dictionary differences For the most part, the ConcurrentDictionary<TKey,TValue> behaves like it’s Dictionary<TKey,TValue> counterpart with a few differences.  Some notable examples of which are: Add() does not exist in the concurrent dictionary. This means you must use TryAdd(), AddOrUpdate(), or GetOrAdd().  It also means that you can’t use a collection initializer with the concurrent dictionary. TryAdd() replaced Add() to attempt atomic, safe adds. Because Add() only succeeds if the item doesn’t already exist, we need an atomic operation to check if the item exists, and if not add it while still under an atomic lock. TryUpdate() was added to attempt atomic, safe updates. If we want to update an item, we must make sure it exists first and that the original value is what we expected it to be.  If all these are true, we can update the item under one atomic step. TryRemove() was added to attempt atomic, safe removes. To safely attempt to remove a value we need to see if the key exists first, this checks for existence and removes under an atomic lock. AddOrUpdate() was added to attempt an thread-safe “upsert”. There are many times where you want to insert into a dictionary if the key doesn’t exist, or update the value if it does.  This allows you to make a thread-safe add-or-update. GetOrAdd() was added to attempt an thread-safe query/insert. Sometimes, you want to query for whether an item exists in the cache, and if it doesn’t insert a starting value for it.  This allows you to get the value if it exists and insert if not. Count, Keys, Values properties take a snapshot of the dictionary. Accessing these properties may interfere with add and update performance and should be used with caution. ToArray() returns a static snapshot of the dictionary. That is, the dictionary is locked, and then copied to an array as a O(n) operation.  GetEnumerator() is thread-safe and efficient, but allows dirty reads. Because reads require no locking, you can safely iterate over the contents of the dictionary.  The only downside is that, depending on timing, you may get dirty reads. Dirty reads during iteration The last point on GetEnumerator() bears some explanation.  Picture a scenario in which you call GetEnumerator() (or iterate using a foreach, etc.) and then, during that iteration the dictionary gets updated.  This may not sound like a big deal, but it can lead to inconsistent results if used incorrectly.  The problem is that items you already iterated over that are updated a split second after don’t show the update, but items that you iterate over that were updated a split second before do show the update.  Thus you may get a combination of items that are “stale” because you iterated before the update, and “fresh” because they were updated after GetEnumerator() but before the iteration reached them. Let’s illustrate with an example, let’s say you load up a concurrent dictionary like this: 1: // load up a dictionary. 2: var dictionary = new ConcurrentDictionary<string, int>(); 3:  4: dictionary["A"] = 1; 5: dictionary["B"] = 2; 6: dictionary["C"] = 3; 7: dictionary["D"] = 4; 8: dictionary["E"] = 5; 9: dictionary["F"] = 6; Then you have one task (using the wonderful TPL!) to iterate using dirty reads: 1: // attempt iteration in a separate thread 2: var iterationTask = new Task(() => 3: { 4: // iterates using a dirty read 5: foreach (var pair in dictionary) 6: { 7: Console.WriteLine(pair.Key + ":" + pair.Value); 8: } 9: }); And one task to attempt updates in a separate thread (probably): 1: // attempt updates in a separate thread 2: var updateTask = new Task(() => 3: { 4: // iterates, and updates the value by one 5: foreach (var pair in dictionary) 6: { 7: dictionary[pair.Key] = pair.Value + 1; 8: } 9: }); Now that we’ve done this, we can fire up both tasks and wait for them to complete: 1: // start both tasks 2: updateTask.Start(); 3: iterationTask.Start(); 4:  5: // wait for both to complete. 6: Task.WaitAll(updateTask, iterationTask); Now, if I you didn’t know about the dirty reads, you may have expected to see the iteration before the updates (such as A:1, B:2, C:3, D:4, E:5, F:6).  However, because the reads are dirty, we will quite possibly get a combination of some updated, some original.  My own run netted this result: 1: F:6 2: E:6 3: D:5 4: C:4 5: B:3 6: A:2 Note that, of course, iteration is not in order because ConcurrentDictionary, like Dictionary, is unordered.  Also note that both E and F show the value 6.  This is because the output task reached F before the update, but the updates for the rest of the items occurred before their output (probably because console output is very slow, comparatively). If we want to always guarantee that we will get a consistent snapshot to iterate over (that is, at the point we ask for it we see precisely what is in the dictionary and no subsequent updates during iteration), we should iterate over a call to ToArray() instead: 1: // attempt iteration in a separate thread 2: var iterationTask = new Task(() => 3: { 4: // iterates using a dirty read 5: foreach (var pair in dictionary.ToArray()) 6: { 7: Console.WriteLine(pair.Key + ":" + pair.Value); 8: } 9: }); The atomic Try…() methods As you can imagine TryAdd() and TryRemove() have few surprises.  Both first check the existence of the item to determine if it can be added or removed based on whether or not the key currently exists in the dictionary: 1: // try add attempts an add and returns false if it already exists 2: if (dictionary.TryAdd("G", 7)) 3: Console.WriteLine("G did not exist, now inserted with 7"); 4: else 5: Console.WriteLine("G already existed, insert failed."); TryRemove() also has the virtue of returning the value portion of the removed entry matching the given key: 1: // attempt to remove the value, if it exists it is removed and the original is returned 2: int removedValue; 3: if (dictionary.TryRemove("C", out removedValue)) 4: Console.WriteLine("Removed C and its value was " + removedValue); 5: else 6: Console.WriteLine("C did not exist, remove failed."); Now TryUpdate() is an interesting creature.  You might think from it’s name that TryUpdate() first checks for an item’s existence, and then updates if the item exists, otherwise it returns false.  Well, note quite... It turns out when you call TryUpdate() on a concurrent dictionary, you pass it not only the new value you want it to have, but also the value you expected it to have before the update.  If the item exists in the dictionary, and it has the value you expected, it will update it to the new value atomically and return true.  If the item is not in the dictionary or does not have the value you expected, it is not modified and false is returned. 1: // attempt to update the value, if it exists and if it has the expected original value 2: if (dictionary.TryUpdate("G", 42, 7)) 3: Console.WriteLine("G existed and was 7, now it's 42."); 4: else 5: Console.WriteLine("G either didn't exist, or wasn't 7."); The composite Add methods The ConcurrentDictionary also has composite add methods that can be used to perform updates and gets, with an add if the item is not existing at the time of the update or get. The first of these, AddOrUpdate(), allows you to add a new item to the dictionary if it doesn’t exist, or update the existing item if it does.  For example, let’s say you are creating a dictionary of counts of stock ticker symbols you’ve subscribed to from a market data feed: 1: public sealed class SubscriptionManager 2: { 3: private readonly ConcurrentDictionary<string, int> _subscriptions = new ConcurrentDictionary<string, int>(); 4:  5: // adds a new subscription, or increments the count of the existing one. 6: public void AddSubscription(string tickerKey) 7: { 8: // add a new subscription with count of 1, or update existing count by 1 if exists 9: var resultCount = _subscriptions.AddOrUpdate(tickerKey, 1, (symbol, count) => count + 1); 10:  11: // now check the result to see if we just incremented the count, or inserted first count 12: if (resultCount == 1) 13: { 14: // subscribe to symbol... 15: } 16: } 17: } Notice the update value factory Func delegate.  If the key does not exist in the dictionary, the add value is used (in this case 1 representing the first subscription for this symbol), but if the key already exists, it passes the key and current value to the update delegate which computes the new value to be stored in the dictionary.  The return result of this operation is the value used (in our case: 1 if added, existing value + 1 if updated). Likewise, the GetOrAdd() allows you to attempt to retrieve a value from the dictionary, and if the value does not currently exist in the dictionary it will insert a value.  This can be handy in cases where perhaps you wish to cache data, and thus you would query the cache to see if the item exists, and if it doesn’t you would put the item into the cache for the first time: 1: public sealed class PriceCache 2: { 3: private readonly ConcurrentDictionary<string, double> _cache = new ConcurrentDictionary<string, double>(); 4:  5: // adds a new subscription, or increments the count of the existing one. 6: public double QueryPrice(string tickerKey) 7: { 8: // check for the price in the cache, if it doesn't exist it will call the delegate to create value. 9: return _cache.GetOrAdd(tickerKey, symbol => GetCurrentPrice(symbol)); 10: } 11:  12: private double GetCurrentPrice(string tickerKey) 13: { 14: // do code to calculate actual true price. 15: } 16: } There are other variations of these two methods which vary whether a value is provided or a factory delegate, but otherwise they work much the same. Oddities with the composite Add methods The AddOrUpdate() and GetOrAdd() methods are totally thread-safe, on this you may rely, but they are not atomic.  It is important to note that the methods that use delegates execute those delegates outside of the lock.  This was done intentionally so that a user delegate (of which the ConcurrentDictionary has no control of course) does not take too long and lock out other threads. This is not necessarily an issue, per se, but it is something you must consider in your design.  The main thing to consider is that your delegate may get called to generate an item, but that item may not be the one returned!  Consider this scenario: A calls GetOrAdd and sees that the key does not currently exist, so it calls the delegate.  Now thread B also calls GetOrAdd and also sees that the key does not currently exist, and for whatever reason in this race condition it’s delegate completes first and it adds its new value to the dictionary.  Now A is done and goes to get the lock, and now sees that the item now exists.  In this case even though it called the delegate to create the item, it will pitch it because an item arrived between the time it attempted to create one and it attempted to add it. Let’s illustrate, assume this totally contrived example program which has a dictionary of char to int.  And in this dictionary we want to store a char and it’s ordinal (that is, A = 1, B = 2, etc).  So for our value generator, we will simply increment the previous value in a thread-safe way (perhaps using Interlocked): 1: public static class Program 2: { 3: private static int _nextNumber = 0; 4:  5: // the holder of the char to ordinal 6: private static ConcurrentDictionary<char, int> _dictionary 7: = new ConcurrentDictionary<char, int>(); 8:  9: // get the next id value 10: public static int NextId 11: { 12: get { return Interlocked.Increment(ref _nextNumber); } 13: } Then, we add a method that will perform our insert: 1: public static void Inserter() 2: { 3: for (int i = 0; i < 26; i++) 4: { 5: _dictionary.GetOrAdd((char)('A' + i), key => NextId); 6: } 7: } Finally, we run our test by starting two tasks to do this work and get the results… 1: public static void Main() 2: { 3: // 3 tasks attempting to get/insert 4: var tasks = new List<Task> 5: { 6: new Task(Inserter), 7: new Task(Inserter) 8: }; 9:  10: tasks.ForEach(t => t.Start()); 11: Task.WaitAll(tasks.ToArray()); 12:  13: foreach (var pair in _dictionary.OrderBy(p => p.Key)) 14: { 15: Console.WriteLine(pair.Key + ":" + pair.Value); 16: } 17: } If you run this with only one task, you get the expected A:1, B:2, ..., Z:26.  But running this in parallel you will get something a bit more complex.  My run netted these results: 1: A:1 2: B:3 3: C:4 4: D:5 5: E:6 6: F:7 7: G:8 8: H:9 9: I:10 10: J:11 11: K:12 12: L:13 13: M:14 14: N:15 15: O:16 16: P:17 17: Q:18 18: R:19 19: S:20 20: T:21 21: U:22 22: V:23 23: W:24 24: X:25 25: Y:26 26: Z:27 Notice that B is 3?  This is most likely because both threads attempted to call GetOrAdd() at roughly the same time and both saw that B did not exist, thus they both called the generator and one thread got back 2 and the other got back 3.  However, only one of those threads can get the lock at a time for the actual insert, and thus the one that generated the 3 won and the 3 was inserted and the 2 got discarded.  This is why on these methods your factory delegates should be careful not to have any logic that would be unsafe if the value they generate will be pitched in favor of another item generated at roughly the same time.  As such, it is probably a good idea to keep those generators as stateless as possible. Summary The ConcurrentDictionary is a very efficient and thread-safe version of the Dictionary generic collection.  It has all the benefits of type-safety that it’s generic collection counterpart does, and in addition is extremely efficient especially when there are more reads than writes concurrently. Tweet Technorati Tags: C#, .NET, Concurrent Collections, Collections, Little Wonders, Black Rabbit Coder,James Michael Hare

    Read the article

  • Using Stub Objects

    - by user9154181
    Having told the long and winding tale of where stub objects came from and how we use them to build Solaris, I'd like to focus now on the the nuts and bolts of building and using them. The following new features were added to the Solaris link-editor (ld) to support the production and use of stub objects: -z stub This new command line option informs ld that it is to build a stub object rather than a normal object. In this mode, it accepts the same command line arguments as usual, but will quietly ignore any objects and sharable object dependencies. STUB_OBJECT Mapfile Directive In order to build a stub version of an object, its mapfile must specify the STUB_OBJECT directive. When producing a non-stub object, the presence of STUB_OBJECT causes the link-editor to perform extra validation to ensure that the stub and non-stub objects will be compatible. ASSERT Mapfile Directive All data symbols exported from the object must have an ASSERT symbol directive in the mapfile that declares them as data and supplies the size, binding, bss attributes, and symbol aliasing details. When building the stub objects, the information in these ASSERT directives is used to create the data symbols. When building the real object, these ASSERT directives will ensure that the real object matches the linking interface presented by the stub. Although ASSERT was added to the link-editor in order to support stub objects, they are a general purpose feature that can be used independently of stub objects. For instance you might choose to use an ASSERT directive if you have a symbol that must have a specific address in order for the object to operate properly and you want to automatically ensure that this will always be the case. The material presented here is derived from a document I originally wrote during the development effort, which had the dual goals of providing supplemental materials for the stub object PSARC case, and as a set of edits that were eventually applied to the Oracle Solaris Linker and Libraries Manual (LLM). The Solaris 11 LLM contains this information in a more polished form. Stub Objects A stub object is a shared object, built entirely from mapfiles, that supplies the same linking interface as the real object, while containing no code or data. Stub objects cannot be used at runtime. However, an application can be built against a stub object, where the stub object provides the real object name to be used at runtime, and then use the real object at runtime. When building a stub object, the link-editor ignores any object or library files specified on the command line, and these files need not exist in order to build a stub. Since the compilation step can be omitted, and because the link-editor has relatively little work to do, stub objects can be built very quickly. Stub objects can be used to solve a variety of build problems: Speed Modern machines, using a version of make with the ability to parallelize operations, are capable of compiling and linking many objects simultaneously, and doing so offers significant speedups. However, it is typical that a given object will depend on other objects, and that there will be a core set of objects that nearly everything else depends on. It is necessary to impose an ordering that builds each object before any other object that requires it. This ordering creates bottlenecks that reduce the amount of parallelization that is possible and limits the overall speed at which the code can be built. Complexity/Correctness In a large body of code, there can be a large number of dependencies between the various objects. The makefiles or other build descriptions for these objects can become very complex and difficult to understand or maintain. The dependencies can change as the system evolves. This can cause a given set of makefiles to become slightly incorrect over time, leading to race conditions and mysterious rare build failures. Dependency Cycles It might be desirable to organize code as cooperating shared objects, each of which draw on the resources provided by the other. Such cycles cannot be supported in an environment where objects must be built before the objects that use them, even though the runtime linker is fully capable of loading and using such objects if they could be built. Stub shared objects offer an alternative method for building code that sidesteps the above issues. Stub objects can be quickly built for all the shared objects produced by the build. Then, all the real shared objects and executables can be built in parallel, in any order, using the stub objects to stand in for the real objects at link-time. Afterwards, the executables and real shared objects are kept, and the stub shared objects are discarded. Stub objects are built from a mapfile, which must satisfy the following requirements. The mapfile must specify the STUB_OBJECT directive. This directive informs the link-editor that the object can be built as a stub object, and as such causes the link-editor to perform validation and sanity checking intended to guarantee that an object and its stub will always provide identical linking interfaces. All function and data symbols that make up the external interface to the object must be explicitly listed in the mapfile. The mapfile must use symbol scope reduction ('*'), to remove any symbols not explicitly listed from the external interface. All global data exported from the object must have an ASSERT symbol attribute in the mapfile to specify the symbol type, size, and bss attributes. In the case where there are multiple symbols that reference the same data, the ASSERT for one of these symbols must specify the TYPE and SIZE attributes, while the others must use the ALIAS attribute to reference this primary symbol. Given such a mapfile, the stub and real versions of the shared object can be built using the same command line for each, adding the '-z stub' option to the link for the stub object, and omiting the option from the link for the real object. To demonstrate these ideas, the following code implements a shared object named idx5, which exports data from a 5 element array of integers, with each element initialized to contain its zero-based array index. This data is available as a global array, via an alternative alias data symbol with weak binding, and via a functional interface. % cat idx5.c int _idx5[5] = { 0, 1, 2, 3, 4 }; #pragma weak idx5 = _idx5 int idx5_func(int index) { if ((index 4)) return (-1); return (_idx5[index]); } A mapfile is required to describe the interface provided by this shared object. % cat mapfile $mapfile_version 2 STUB_OBJECT; SYMBOL_SCOPE { _idx5 { ASSERT { TYPE=data; SIZE=4[5] }; }; idx5 { ASSERT { BINDING=weak; ALIAS=_idx5 }; }; idx5_func; local: *; }; The following main program is used to print all the index values available from the idx5 shared object. % cat main.c #include <stdio.h> extern int _idx5[5], idx5[5], idx5_func(int); int main(int argc, char **argv) { int i; for (i = 0; i The following commands create a stub version of this shared object in a subdirectory named stublib. elfdump is used to verify that the resulting object is a stub. The command used to build the stub differs from that of the real object only in the addition of the -z stub option, and the use of a different output file name. This demonstrates the ease with which stub generation can be added to an existing makefile. % cc -Kpic -G -M mapfile -h libidx5.so.1 idx5.c -o stublib/libidx5.so.1 -zstub % ln -s libidx5.so.1 stublib/libidx5.so % elfdump -d stublib/libidx5.so | grep STUB [11] FLAGS_1 0x4000000 [ STUB ] The main program can now be built, using the stub object to stand in for the real shared object, and setting a runpath that will find the real object at runtime. However, as we have not yet built the real object, this program cannot yet be run. Attempts to cause the system to load the stub object are rejected, as the runtime linker knows that stub objects lack the actual code and data found in the real object, and cannot execute. % cc main.c -L stublib -R '$ORIGIN/lib' -lidx5 -lc % ./a.out ld.so.1: a.out: fatal: libidx5.so.1: open failed: No such file or directory Killed % LD_PRELOAD=stublib/libidx5.so.1 ./a.out ld.so.1: a.out: fatal: stublib/libidx5.so.1: stub shared object cannot be used at runtime Killed We build the real object using the same command as we used to build the stub, omitting the -z stub option, and writing the results to a different file. % cc -Kpic -G -M mapfile -h libidx5.so.1 idx5.c -o lib/libidx5.so.1 Once the real object has been built in the lib subdirectory, the program can be run. % ./a.out [0] 0 0 0 [1] 1 1 1 [2] 2 2 2 [3] 3 3 3 [4] 4 4 4 Mapfile Changes The version 2 mapfile syntax was extended in a number of places to accommodate stub objects. Conditional Input The version 2 mapfile syntax has the ability conditionalize mapfile input using the $if control directive. As you might imagine, these directives are used frequently with ASSERT directives for data, because a given data symbol will frequently have a different size in 32 or 64-bit code, or on differing hardware such as x86 versus sparc. The link-editor maintains an internal table of names that can be used in the logical expressions evaluated by $if and $elif. At startup, this table is initialized with items that describe the class of object (_ELF32 or _ELF64) and the type of the target machine (_sparc or _x86). We found that there were a small number of cases in the Solaris code base in which we needed to know what kind of object we were producing, so we added the following new predefined items in order to address that need: NameMeaning ...... _ET_DYNshared object _ET_EXECexecutable object _ET_RELrelocatable object ...... STUB_OBJECT Directive The new STUB_OBJECT directive informs the link-editor that the object described by the mapfile can be built as a stub object. STUB_OBJECT; A stub shared object is built entirely from the information in the mapfiles supplied on the command line. When the -z stub option is specified to build a stub object, the presence of the STUB_OBJECT directive in a mapfile is required, and the link-editor uses the information in symbol ASSERT attributes to create global symbols that match those of the real object. When the real object is built, the presence of STUB_OBJECT causes the link-editor to verify that the mapfiles accurately describe the real object interface, and that a stub object built from them will provide the same linking interface as the real object it represents. All function and data symbols that make up the external interface to the object must be explicitly listed in the mapfile. The mapfile must use symbol scope reduction ('*'), to remove any symbols not explicitly listed from the external interface. All global data in the object is required to have an ASSERT attribute that specifies the symbol type and size. If the ASSERT BIND attribute is not present, the link-editor provides a default assertion that the symbol must be GLOBAL. If the ASSERT SH_ATTR attribute is not present, or does not specify that the section is one of BITS or NOBITS, the link-editor provides a default assertion that the associated section is BITS. All data symbols that describe the same address and size are required to have ASSERT ALIAS attributes specified in the mapfile. If aliased symbols are discovered that do not have an ASSERT ALIAS specified, the link fails and no object is produced. These rules ensure that the mapfiles contain a description of the real shared object's linking interface that is sufficient to produce a stub object with a completely compatible linking interface. SYMBOL_SCOPE/SYMBOL_VERSION ASSERT Attribute The SYMBOL_SCOPE and SYMBOL_VERSION mapfile directives were extended with a symbol attribute named ASSERT. The syntax for the ASSERT attribute is as follows: ASSERT { ALIAS = symbol_name; BINDING = symbol_binding; TYPE = symbol_type; SH_ATTR = section_attributes; SIZE = size_value; SIZE = size_value[count]; }; The ASSERT attribute is used to specify the expected characteristics of the symbol. The link-editor compares the symbol characteristics that result from the link to those given by ASSERT attributes. If the real and asserted attributes do not agree, a fatal error is issued and the output object is not created. In normal use, the link editor evaluates the ASSERT attribute when present, but does not require them, or provide default values for them. The presence of the STUB_OBJECT directive in a mapfile alters the interpretation of ASSERT to require them under some circumstances, and to supply default assertions if explicit ones are not present. See the definition of the STUB_OBJECT Directive for the details. When the -z stub command line option is specified to build a stub object, the information provided by ASSERT attributes is used to define the attributes of the global symbols provided by the object. ASSERT accepts the following: ALIAS Name of a previously defined symbol that this symbol is an alias for. An alias symbol has the same type, value, and size as the main symbol. The ALIAS attribute is mutually exclusive to the TYPE, SIZE, and SH_ATTR attributes, and cannot be used with them. When ALIAS is specified, the type, size, and section attributes are obtained from the alias symbol. BIND Specifies an ELF symbol binding, which can be any of the STB_ constants defined in <sys/elf.h>, with the STB_ prefix removed (e.g. GLOBAL, WEAK). TYPE Specifies an ELF symbol type, which can be any of the STT_ constants defined in <sys/elf.h>, with the STT_ prefix removed (e.g. OBJECT, COMMON, FUNC). In addition, for compatibility with other mapfile usage, FUNCTION and DATA can be specified, for STT_FUNC and STT_OBJECT, respectively. TYPE is mutually exclusive to ALIAS, and cannot be used in conjunction with it. SH_ATTR Specifies attributes of the section associated with the symbol. The section_attributes that can be specified are given in the following table: Section AttributeMeaning BITSSection is not of type SHT_NOBITS NOBITSSection is of type SHT_NOBITS SH_ATTR is mutually exclusive to ALIAS, and cannot be used in conjunction with it. SIZE Specifies the expected symbol size. SIZE is mutually exclusive to ALIAS, and cannot be used in conjunction with it. The syntax for the size_value argument is as described in the discussion of the SIZE attribute below. SIZE The SIZE symbol attribute existed before support for stub objects was introduced. It is used to set the size attribute of a given symbol. This attribute results in the creation of a symbol definition. Prior to the introduction of the ASSERT SIZE attribute, the value of a SIZE attribute was always numeric. While attempting to apply ASSERT SIZE to the objects in the Solaris ON consolidation, I found that many data symbols have a size based on the natural machine wordsize for the class of object being produced. Variables declared as long, or as a pointer, will be 4 bytes in size in a 32-bit object, and 8 bytes in a 64-bit object. Initially, I employed the conditional $if directive to handle these cases as follows: $if _ELF32 foo { ASSERT { TYPE=data; SIZE=4 } }; bar { ASSERT { TYPE=data; SIZE=20 } }; $elif _ELF64 foo { ASSERT { TYPE=data; SIZE=8 } }; bar { ASSERT { TYPE=data; SIZE=40 } }; $else $error UNKNOWN ELFCLASS $endif I found that the situation occurs frequently enough that this is cumbersome. To simplify this case, I introduced the idea of the addrsize symbolic name, and of a repeat count, which together make it simple to specify machine word scalar or array symbols. Both the SIZE, and ASSERT SIZE attributes support this syntax: The size_value argument can be a numeric value, or it can be the symbolic name addrsize. addrsize represents the size of a machine word capable of holding a memory address. The link-editor substitutes the value 4 for addrsize when building 32-bit objects, and the value 8 when building 64-bit objects. addrsize is useful for representing the size of pointer variables and C variables of type long, as it automatically adjusts for 32 and 64-bit objects without requiring the use of conditional input. The size_value argument can be optionally suffixed with a count value, enclosed in square brackets. If count is present, size_value and count are multiplied together to obtain the final size value. Using this feature, the example above can be written more naturally as: foo { ASSERT { TYPE=data; SIZE=addrsize } }; bar { ASSERT { TYPE=data; SIZE=addrsize[5] } }; Exported Global Data Is Still A Bad Idea As you can see, the additional plumbing added to the Solaris link-editor to support stub objects is minimal. Furthermore, about 90% of that plumbing is dedicated to handling global data. We have long advised against global data exported from shared objects. There are many ways in which global data does not fit well with dynamic linking. Stub objects simply provide one more reason to avoid this practice. It is always better to export all data via a functional interface. You should always hide your data, and make it available to your users via a function that they can call to acquire the address of the data item. However, If you do have to support global data for a stub, perhaps because you are working with an already existing object, it is still easilily done, as shown above. Oracle does not like us to discuss hypothetical new features that don't exist in shipping product, so I'll end this section with a speculation. It might be possible to do more in this area to ease the difficulty of dealing with objects that have global data that the users of the library don't need. Perhaps someday... Conclusions It is easy to create stub objects for most objects. If your library only exports function symbols, all you have to do to build a faithful stub object is to add STUB_OBJECT; and then to use the same link command you're currently using, with the addition of the -z stub option. Happy Stubbing!

    Read the article

  • Subterranean IL: Exception handler semantics

    - by Simon Cooper
    In my blog posts on fault and filter exception handlers, I said that the same behaviour could be replicated using normal catch blocks. Well, that isn't entirely true... Changing the handler semantics Consider the following: .try { .try { .try { newobj instance void [mscorlib]System.Exception::.ctor() // IL for: // e.Data.Add("DictKey", true) throw } fault { ldstr "1: Fault handler" call void [mscorlib]System.Console::WriteLine(string) endfault } } filter { ldstr "2a: Filter logic" call void [mscorlib]System.Console::WriteLine(string) // IL for: // (bool)((Exception)e).Data["DictKey"] endfilter }{ ldstr "2b: Filter handler" call void [mscorlib]System.Console::WriteLine(string) leave.s Return } } catch object { ldstr "3: Catch handler" call void [mscorlib]System.Console::WriteLine(string) leave.s Return } Return: // rest of method If the filter handler is engaged (true is inserted into the exception dictionary) then the filter handler gets engaged, and the following gets printed to the console: 2a: Filter logic 1: Fault handler 2b: Filter handler and if the filter handler isn't engaged, then the following is printed: 2a:Filter logic 1: Fault handler 3: Catch handler Filter handler execution The filter handler is executed first. Hmm, ok. Well, what happens if we replaced the fault block with the C# equivalent (with the exception dictionary value set to false)? .try { // throw exception } catch object { ldstr "1: Fault handler" call void [mscorlib]System.Console::WriteLine(string) rethrow } we get this: 1: Fault handler 2a: Filter logic 3: Catch handler The fault handler is executed first, instead of the filter block. Eh? This change in behaviour is due to the way the CLR searches for exception handlers. When an exception is thrown, the CLR stops execution of the thread, and searches up the stack for an exception handler that can handle the exception and stop it propagating further - catch or filter handlers. It checks the type clause of catch clauses, and executes the code in filter blocks to see if the filter can handle the exception. When the CLR finds a valid handler, it saves the handler's location, then goes back to where the exception was thrown and executes fault and finally blocks between there and the handler location, discarding stack frames in the process, until it reaches the handler. So? By replacing a fault with a catch, we have changed the semantics of when the filter code is executed; by using a rethrow instruction, we've split up the exception handler search into two - one search to find the first catch, then a second when the rethrow instruction is encountered. This is only really obvious when mixing C# exception handlers with fault or filter handlers, so this doesn't affect code written only in C#. However it could cause some subtle and hard-to-debug effects with object initialization and ordering when using and calling code written in a language that can compile fault and filter handlers.

    Read the article

  • Send raw data to USB parallel port after upgrading to 11.10

    - by zaphod
    I have a laser cutter connected via a generic USB to parallel adapter. The laser cutter speaks HPGL, as it happens, but since this is a laser cutter and not a plotter, I usually want to generate the HPGL myself, since I care about the ordering, speed, and direction of cuts and so on. In previous versions of Ubuntu, I was able to print to the cutter by copying an HPGL file directly to the corresponding USB "lp" device. For example: cp foo.plt /dev/usblp1 Well, I just upgraded to Ubuntu 11.10 oneiric, and I can't find any "lp" devices in /dev anymore. D'oh! What's the preferred way to send raw data to a parallel port in Ubuntu? I've tried System Settings Printing + Add, hoping that I might be able to associate my device with some kind of "raw printer" driver and print to it with a command like lp -d LaserCutter foo.plt But my USB to parallel adapter doesn't seem to show up in the list. What I do see are my HP Color LaserJet, two USB-to-serial adapters, "Enter URI", and "Network Printer". Meanwhile, over in /dev, I do see /dev/ttyUSB0 and /dev/ttyUSB1 devices for the 2 USB-to-serial adapters. I don't see anything obvious corresponding to the HP printer (which was /dev/usblp0 prior to the upgrade), except for generic USB stuff. For example, sudo find /dev | grep lp produces no output. I do seem to be able to print to the HP printer just fine, though. The printer setup GUI gives it a device URI starting with "hp:" which isn't much help for the parallel adapter. The CUPS administrator's guide makes it sound like I might need to feed it a device URI of the form parallel:/dev/SOMETHING, but of course if I had a /dev/SOMETHING I'd probably just go on writing to it directly. Here's what dmesg says after I disconnect and reconnect the device from the USB port: [ 924.722906] usb 1-1.1.4: USB disconnect, device number 7 [ 959.993002] usb 1-1.1.4: new full speed USB device number 8 using ehci_hcd And here's how it shows up in lsusb -v: Bus 001 Device 008: ID 1a86:7584 QinHeng Electronics CH340S Device Descriptor: bLength 18 bDescriptorType 1 bcdUSB 1.10 bDeviceClass 0 (Defined at Interface level) bDeviceSubClass 0 bDeviceProtocol 0 bMaxPacketSize0 8 idVendor 0x1a86 QinHeng Electronics idProduct 0x7584 CH340S bcdDevice 2.52 iManufacturer 0 iProduct 2 USB2.0-Print iSerial 0 bNumConfigurations 1 Configuration Descriptor: bLength 9 bDescriptorType 2 wTotalLength 32 bNumInterfaces 1 bConfigurationValue 1 iConfiguration 0 bmAttributes 0x80 (Bus Powered) MaxPower 96mA Interface Descriptor: bLength 9 bDescriptorType 4 bInterfaceNumber 0 bAlternateSetting 0 bNumEndpoints 2 bInterfaceClass 7 Printer bInterfaceSubClass 1 Printer bInterfaceProtocol 2 Bidirectional iInterface 0 Endpoint Descriptor: bLength 7 bDescriptorType 5 bEndpointAddress 0x82 EP 2 IN bmAttributes 2 Transfer Type Bulk Synch Type None Usage Type Data wMaxPacketSize 0x0020 1x 32 bytes bInterval 0 Endpoint Descriptor: bLength 7 bDescriptorType 5 bEndpointAddress 0x02 EP 2 OUT bmAttributes 2 Transfer Type Bulk Synch Type None Usage Type Data wMaxPacketSize 0x0020 1x 32 bytes bInterval 0 Device Status: 0x0000 (Bus Powered)

    Read the article

  • Your interesting code tricks/ conventions? [closed]

    - by Paul
    What interesting conventions, rules, tricks do you use in your code? Preferably some that are not so popular so that the rest of us would find them as novelties. :) Here's some of mine... Input and output parameters This applies to C++ and other languages that have both references and pointers. This is the convention: input parameters are always passed by value or const reference; output parameters are always passed by pointer. This way I'm able to see at a glance, directly from the function call, what parameters might get modified by the function: Inspiration: Old C code int a = 6, b = 7, sum = 0; calculateSum(a, b, &sum); Ordering of headers My typical source file begins like this (see code below). The reason I put the matching header first is because, in case that header is not self-sufficient (I forgot to include some necessary library, or forgot to forward declare some type or function), a compiler error will occur. // Matching header #include "example.h" // Standard libraries #include <string> ... Setter functions Sometimes I find that I need to set multiple properties of an object all at once (like when I just constructed it and I need to initialize it). To reduce the amount of typing and, in some cases, improve readability, I decided to make my setters chainable: Inspiration: Builder pattern class Employee { public: Employee& name(const std::string& name); Employee& salary(double salary); private: std::string name_; double salary_; }; Employee bob; bob.name("William Smith").salary(500.00); Maybe in this particular case it could have been just as well done in the constructor. But for Real WorldTM applications, classes would have lots more fields that should be set to appropriate values and it becomes unmaintainable to do it in the constructor. So what about you? What personal tips and tricks would you like to share?

    Read the article

  • ArchBeat Link-o-Rama for 2012-04-05

    - by Bob Rhubart
    Webcast: Oracle Maximum Availability Architecture Best Practices event.on24.com Date: Thursday, April 12, 2012 Time: 10:00 AM PDT Oracle expert Tom Kyte discusses how Oracle’s Maximum Availability Architecture can help to minimize the costs and risk of downtime. Oracle Enterprise Manager Ops Center 12c Launch - Interactive Webcast and Live Chat www.oracle.com Thursday, April 12, 2012. 9 a.m. PT / 12 p.m. ET / 4 p.m. GMT. Speakers: Steve Wilson (VP Systems Management, Oracle) John Fowler (Exec VP Systems, Oracle) Brad Cameron (VP Development, Oracle Fusion Middleware) Bill Nesheim (VP Oracle Solaris) Dennis Reno (VP Customer Portal Experience, Oracle) Mike Wookey (Chief Architect, Oracle Enterprise Manager Ops Center) Prasad Pai (Sr Director, Oracle Enterprise Manager Ops Center) 2012 Real World Performance Tour Dates |Performance Tuning | Performance Engineering www.ioug.org Coming to your town: a full day of real world database performance with Tom Kyte, Andrew Holdsworth, and Graham Wood. Rochester, NY - March 8 Los Angeles, CA - April 30 Orange County, CA - May 1 Redwood Shores, CA - May 3 Oracle Technology Network Developer Day: MySQL - New York www.oracle.com Wednesday, May 02, 2012 8:00 AM – 4:30 PM Grand Hyatt New York 109 East 42nd Street, Grand Central Terminal New York, NY 10017 Webcast Series: Data Warehousing Best Practices event.on24.com April 19, 2012 - Best Practices for Workload Management of a Data Warehouse on Oracle Exadata May 10, 2012 - Best Practices for Extreme Data Warehouse Performance on Oracle Exadata How to create a Global Rule that stores a document’s folder path in a custom metadata field | Nicolas Montoya blogs.oracle.com An illustrated how-to from Oracle Fusion Middleware A-Team blogger Nicolas Montoya. Get Proactive with Fusion Middleware | Daniel Mortimer blogs.oracle.com Daniel Mortimer shows how to access "a one stop shop for navigating to proactive support material, tools, and communication channels related to Oracle Fusion Middleware." Build an enterprise on 'other peoples' work', via SOA and cloud | Joe McKendrick www.zdnet.com Are you down with OPW? Joe McKendrick's synopsis of a recent presentation by David Linthicum focuses on reuse. Oracle Fusion Middleware Security: Unsolicited login with OAM 11g | Chris Johnson fusionsecurity.blogspot.com Chris Johnson shows how to create a shopping cart login model using "plain old HTML." How to use the Human WorkFlow Web Services | Edwin Biemond biemond.blogspot.com Oracle ACE Edwin Biemond shows how to invoke two WorkFlow web services to query the Human task in Oracle SOA Suite with your own ordering and restrictions. Bad Practice Use Case for LOV Performance Implementation in ADF BC | Andrejus Baranovskis andrejusb.blogspot.com "If you want to learn something well, there is nothing better [than] to learn bad practices first," says Oracle ACE Director Andrejus Baranovskis. Thought for the Day "The best meetings get real work done. When your people learn that your meetings actually accomplish something, they will stop making excuses to be elsewhere." — Larry Constantine

    Read the article

  • Best Language for the job? Database | C++, .NET, Java

    - by Randy E
    Ok, quick overview. I'm pretty brand new to software design. I have experience reading and editing/customizing PHP things for online scripts/software; Such as CMS, Wordpress, some forum solutions. I'm about to begin my degree in Software Design, the school I'm going to will allow us to kind of focus on an area, C++, Java, or .NET. I've played around a little with VB over the past week, mostly just trying to get a slight feel for it, however nothing extensive. I've been through Herbert Schildt's "C++, A Beginner's Guide." but I was mainly reading it, not doing anything with it beyond a couple basic Console Apps (and getting frustrated with auto-close :/ ). Now, where I decide to focus more in with my degree will depend on what the best language for the job is for my first piece of software I want to develop on my own. Assume I haven't looked at any of the languages at all, please help with the following: My first piece of software will be a database program. Everything has to do with users inputting and retrieving data, and calling that data to help with another function of the software, automatically calculating billing information based on information inputted in the other portion of the program. I won't go into too many details as I'm targeting a niche that doesn't have too much competition, but the competition that is there is established. I want to offer more features, scalable solutions, and the ability to port it to an online version. Ok, basically, it is a complete case management with integrated billing for Private Investigators. I would like the case management to be able to check the Database to see if certain information has been inputted before (such as Names/SSN's), and then the billing will pull hours inputted in the case portion for investigative work, multiplying by an already inputted amount for the fee, and then calculate sales tax. I also want to provide potential clients with an easily scalable solution, that is, a basic option for start ups that costs the least amount, with no additional users, ran on one machine. A middle option with the ability to create users and place them in two groups (User or Admin), as well as adding a few additional features, ran on one machine, but this will allow it to be accessed after being mapped on a network drive. And a third option to allow the placement into 4 different groups (Investigators, Billing, Managers, Admins) and more features. And then, a couple of years after launch, a 4th option that is browser based allowing the same 4 groups to login, as well as clients (view things concerning their case, with some admin customizable objects that can be added for clients view), over the internet. The only licensing security I would like to employ right off the bat will be serial key generated after ordering online (received in an email after the successful purchase). The program will access a database stored on a server periodically to verify license. I would like it to be able to check to make sure it's the most updated version and automatically update if not.

    Read the article

  • What Precalculus knowledge is required before learning Discrete Math Computer Science topics?

    - by Ein Doofus
    Below I've listed the chapters from a Precalculus book as well as the author recommended Computer Science chapters from a Discrete Mathematics book. Although these chapters are from two specific books on these subjects I believe the topics are generally the same between any Precalc or Discrete Math book. What Precalculus topics should one know before starting these Discrete Math Computer Science topics?: Discrete Mathematics CS Chapters 1.1 Propositional Logic 1.2 Propositional Equivalences 1.3 Predicates and Quantifiers 1.4 Nested Quantifiers 1.5 Rules of Inference 1.6 Introduction to Proofs 1.7 Proof Methods and Strategy 2.1 Sets 2.2 Set Operations 2.3 Functions 2.4 Sequences and Summations 3.1 Algorithms 3.2 The Growths of Functions 3.3 Complexity of Algorithms 3.4 The Integers and Division 3.5 Primes and Greatest Common Divisors 3.6 Integers and Algorithms 3.8 Matrices 4.1 Mathematical Induction 4.2 Strong Induction and Well-Ordering 4.3 Recursive Definitions and Structural Induction 4.4 Recursive Algorithms 4.5 Program Correctness 5.1 The Basics of Counting 5.2 The Pigeonhole Principle 5.3 Permutations and Combinations 5.6 Generating Permutations and Combinations 6.1 An Introduction to Discrete Probability 6.4 Expected Value and Variance 7.1 Recurrence Relations 7.3 Divide-and-Conquer Algorithms and Recurrence Relations 7.5 Inclusion-Exclusion 8.1 Relations and Their Properties 8.2 n-ary Relations and Their Applications 8.3 Representing Relations 8.5 Equivalence Relations 9.1 Graphs and Graph Models 9.2 Graph Terminology and Special Types of Graphs 9.3 Representing Graphs and Graph Isomorphism 9.4 Connectivity 9.5 Euler and Hamilton Ptahs 10.1 Introduction to Trees 10.2 Application of Trees 10.3 Tree Traversal 11.1 Boolean Functions 11.2 Representing Boolean Functions 11.3 Logic Gates 11.4 Minimization of Circuits 12.1 Language and Grammars 12.2 Finite-State Machines with Output 12.3 Finite-State Machines with No Output 12.4 Language Recognition 12.5 Turing Machines Precalculus Chapters R.1 The Real-Number System R.2 Integer Exponents, Scientific Notation, and Order of Operations R.3 Addition, Subtraction, and Multiplication of Polynomials R.4 Factoring R.5 Rational Expressions R.6 Radical Notation and Rational Exponents R.7 The Basics of Equation Solving 1.1 Functions, Graphs, Graphers 1.2 Linear Functions, Slope, and Applications 1.3 Modeling: Data Analysis, Curve Fitting, and Linear Regression 1.4 More on Functions 1.5 Symmetry and Transformations 1.6 Variation and Applications 1.7 Distance, Midpoints, and Circles 2.1 Zeros of Linear Functions and Models 2.2 The Complex Numbers 2.3 Zeros of Quadratic Functions and Models 2.4 Analyzing Graphs of Quadratic Functions 2.5 Modeling: Data Analysis, Curve Fitting, and Quadratic Regression 2.6 Zeros and More Equation Solving 2.7 Solving Inequalities 3.1 Polynomial Functions and Modeling 3.2 Polynomial Division; The Remainder and Factor Theorems 3.3 Theorems about Zeros of Polynomial Functions 3.4 Rational Functions 3.5 Polynomial and Rational Inequalities 4.1 Composite and Inverse Functions 4.2 Exponential Functions and Graphs 4.3 Logarithmic Functions and Graphs 4.4 Properties of Logarithmic Functions 4.5 Solving Exponential and Logarithmic Equations 4.6 Applications and Models: Growth and Decay 5.1 Systems of Equations in Two Variables 5.2 System of Equations in Three Variables 5.3 Matrices and Systems of Equations 5.4 Matrix Operations 5.5 Inverses of Matrices 5.6 System of Inequalities and Linear Programming 5.7 Partial Fractions 6.1 The Parabola 6.2 The Circle and Ellipse 6.3 The Hyperbola 6.4 Nonlinear Systems of Equations

    Read the article

  • Misadventures at Radio Shack

    - by Chris Williams
    While I'm waiting for my Arduino kits to show up, I started reading the Getting Started With Arduino book from O'Reilly (review coming later) and I'm about 40 pages in when I get to a parts list for one of the first projects. Looks pretty straightforward, and even has Radio Shack part numbers next to almost everything. So on my lunch today, I decided to run out to "The Shack" (seriously, that's their rebranding?) to pick up some basics, like a couple resistors, a breadboard, a momentary switch and a pack of pre-cut jumper wires. I found the resistors without any difficulty, and while they didn't have the exact switch I wanted, it was easy enough to find one that would do. That's where my good luck abruptly ended. I was surprised that I couldn't find a breadboard or any jumper wires, so while I was looking around, a guy came up and asked me if I needed some help. I told him I did, explained what I needed and even gave him the Radio Shack part number for the pack of jumper wires. After a couple minutes he says he can't find anything in the system, which was unfortunate but not the end of the world.  So then I asked him about the breadboard, and he pointed me to some blank circuitboards (which are not the same thing) and I said (nicely) that those weren't breadboards and attempted to explain (again) what I needed, at which point he says to me "I don't even know what the hell you're looking for!" I stood there for a moment and tried to process his words. About that time, another salesperson came up and asked what I was trying to find. I told her I needed a breadboard, and she pointed to the blank circuit boards and said "they're right in front of you..." After seeing the look on my face, she thought for a minute and said... "OH! you mean those white things. We don't have those anymore." I thanked her, set everything down on the counter and left. (I wasn't going to buy only half the stuff I needed.. and I was pretty sure I was never going to be buying ANYTHING at that particular location ever again.) Guess I'll be ordering more stuff online at this point. It's a shame really, because I used to LOVE going to Radio Shack as a kid, and looking through all the cool electronics components and stuff, even if I didnt understand what most of them were at the time. Seems like the only thing they carry in any quantity/variety now is cell phones and random stereo connectors.

    Read the article

  • Send raw data to USB parallel port after upgrading to 11.10 oneiric

    - by zaphod
    I have a laser cutter connected via a generic USB to parallel adapter. The laser cutter speaks HPGL, as it happens, but since this is a laser cutter and not a plotter, I usually want to generate the HPGL myself, since I care about the ordering, speed, and direction of cuts and so on. In previous versions of Ubuntu, I was able to print to the cutter by copying an HPGL file directly to the corresponding USB "lp" device. For example: cp foo.plt /dev/usblp1 Well, I just upgraded to Ubuntu 11.10 oneiric, and I can't find any "lp" devices in /dev anymore. D'oh! What's the preferred way to send raw data to a parallel port in Ubuntu? I've tried System Settings Printing + Add, hoping that I might be able to associate my device with some kind of "raw printer" driver and print to it with a command like lp -d LaserCutter foo.plt But my USB to parallel adapter doesn't seem to show up in the list. What I do see are my HP Color LaserJet, two USB-to-serial adapters, "Enter URI", and "Network Printer". Meanwhile, over in /dev, I do see /dev/ttyUSB0 and /dev/ttyUSB1 devices for the 2 USB-to-serial adapters. I don't see anything obvious corresponding to the HP printer (which was /dev/usblp0 prior to the upgrade), except for generic USB stuff. For example, sudo find /dev | grep lp produces no output. I do seem to be able to print to the HP printer just fine, though. The printer setup GUI gives it a device URI starting with "hp:" which isn't much help for the parallel adapter. The CUPS administrator's guide makes it sound like I might need to feed it a device URI of the form parallel:/dev/SOMETHING, but of course if I had a /dev/SOMETHING I'd probably just go on writing to it directly. Here's what dmesg says after I disconnect and reconnect the device from the USB port: [ 924.722906] usb 1-1.1.4: USB disconnect, device number 7 [ 959.993002] usb 1-1.1.4: new full speed USB device number 8 using ehci_hcd And here's how it shows up in lsusb -v: Bus 001 Device 008: ID 1a86:7584 QinHeng Electronics CH340S Device Descriptor: bLength 18 bDescriptorType 1 bcdUSB 1.10 bDeviceClass 0 (Defined at Interface level) bDeviceSubClass 0 bDeviceProtocol 0 bMaxPacketSize0 8 idVendor 0x1a86 QinHeng Electronics idProduct 0x7584 CH340S bcdDevice 2.52 iManufacturer 0 iProduct 2 USB2.0-Print iSerial 0 bNumConfigurations 1 Configuration Descriptor: bLength 9 bDescriptorType 2 wTotalLength 32 bNumInterfaces 1 bConfigurationValue 1 iConfiguration 0 bmAttributes 0x80 (Bus Powered) MaxPower 96mA Interface Descriptor: bLength 9 bDescriptorType 4 bInterfaceNumber 0 bAlternateSetting 0 bNumEndpoints 2 bInterfaceClass 7 Printer bInterfaceSubClass 1 Printer bInterfaceProtocol 2 Bidirectional iInterface 0 Endpoint Descriptor: bLength 7 bDescriptorType 5 bEndpointAddress 0x82 EP 2 IN bmAttributes 2 Transfer Type Bulk Synch Type None Usage Type Data wMaxPacketSize 0x0020 1x 32 bytes bInterval 0 Endpoint Descriptor: bLength 7 bDescriptorType 5 bEndpointAddress 0x02 EP 2 OUT bmAttributes 2 Transfer Type Bulk Synch Type None Usage Type Data wMaxPacketSize 0x0020 1x 32 bytes bInterval 0 Device Status: 0x0000 (Bus Powered)

    Read the article

  • HttpUtility.UrlEncode in console application

    - by iar
    I'd like to use HttpUtility.UrlEncode in a console application, VB.NET, VS 2010 Beta 2. System.Web.HttpUtility.UrlEncode(item) Error message: 'HttpUtility' is not a member of 'Web'. In this question Anjisan suggests to add a reference to System.Web, as follows: In your solution explorer, right click on references Choose "add reference" In the "Add Reference" dialog box, use the .NET tab Scroll down to System.Web, select that, and hit ok However, I don't have a System.Web entry at that location.

    Read the article

  • C# TextBox Autocomplete (Winforms) key events and customization?

    - by m0s
    Hi, I was wondering if it is possible to catch key events for auto-complete list. For example instead of Enter key press for auto-complete use lets say Tab key. Also is it possible to change the colors and add background image for the auto-complete pop-up list? Currently I have my own implementation which is a separate window(form) with a list-box, which works OK, but Id really like to use .net's auto-complete if it can do what I need. Thanks for attention.

    Read the article

  • Primefaces TreeView node expansion

    - by Boiler Bill
    Being new to primefaces, I have been researching a way to have TreeView in dynamic mode update a separate tab pane given the id on Node expansion. This works great for node selection with the "update" attribute. Can it work the same way on Node Expansion was well? Here is my code that works when a node is selected: <p:tree id="tree" dynamic="true" var="node" cache="true" update="details" value="#{treeBean.root}" rendered="#{treeBean.root != null}" styleClass="inventoryTree" nodeExpandListener="#{treeBean.onNodeExpand}" nodeSelectListener="#{treeBean.onNodeSelect}">

    Read the article

  • passing valus to one jsp page to another jsp page

    - by devuser
    I'm retrieving values from database to table in jsp.(to a column) I want to insert that value into another table in database. To do that i'm using another jsp table to insert that value in db and i call that jsp page in my previous jsp's page form action tab. I use request.getParameter() method to get the values in my first jsp page to new jsp page.but i couldnt get that values using request.getParameter(). How can i solve this

    Read the article

  • How to add UITabViewController programatically?

    - by chaitanya
    Hi, In my app I need to add tabviewcontroller to my 2nd view, If its a main view directly we can take the TabViewController type while creating the project but my requirement is i have one view controller in my app, from this view i shold call tabviewcontroller, So how can I tab view controller programatically and how to add nibs to that and how to define the no of tabs for this programatically?

    Read the article

< Previous Page | 140 141 142 143 144 145 146 147 148 149 150 151  | Next Page >