Search Results

Search found 29949 results on 1198 pages for 'large scale website'.

Page 146/1198 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • Indexing large DB's with Lucene/PHP

    - by thebluefox
    Afternoon chaps, Trying to index a 1.7million row table with the Zend port of Lucene. On small tests of a few thousand rows its worked perfectly, but as soon as I try and up the rows to a few tens of thousands, it times out. Obviously, I could increase the time php allows the script to run, but seeing as 360 seconds gets me ~10,000 rows, I'd hate to think how many seconds it'd take to do 1.7million. I've also tried making the script run a few thousand, refresh, and then run the next few thousand, but doing this clears the index each time. Any ideas guys? Thanks :)

    Read the article

  • Database for managing large volumes of (system) metrics

    - by symcbean
    Hi, I'm looking at building a system for managing and reporting stats on web page performance. I'll be collecting a lot more stats than are available in the standard log formats (approx 20 metrics) but compared to most types of database applications, the base data structure will be very simple. My problem is that I'll be accumulating a lot of data - in the region of 100,000 records (i.e. sets of metrics) per hour. Of course, resources are very limited! So that its possible to sensibly interact with the data, I'd need to consolidate each metric into one minute bins, broken down by URL, then for anything more than 1 day old, consolidated into 10 minute bins, then at 1 week, hourly bins. At the front end, I want to provide a view (prefereably as plots) of the last hour of data, with the facility for users to drill up/down through defined hierarchies of URLs (which do not always map directly to the hierarchy expressed in the path of the URL) and to view different time frames. Rather than coding all this myself and using a relational database, I was wondering if there were tools available which would facilitate both the management of the data and the reporting. I had a look at Mondrian however I can't see from the documentation I've looked at whether it's possible to drop the more granular information while maintaining the consolidated views of the data. RRDTool looks promising in terms of managing the data consolidation, but seems to be rather limited in terms of querying the dataset as a multi-dimensional/relational database. What else whould I be looking at?

    Read the article

  • Flex - weird display behavior on large number of Canvas

    - by itarato
    Hi, I have a Flex app (SDK 3.5 - FP10) that does mindmap trees. Every node is a Canvas (I'm using Canvas specific properties so I needed it). It has a shadow effect, background color and some small ui element on it (like icons, texts...). It works perfectly until it goes over ~700 nodes (Canvas). Over that number it shows grey rectangles: http://yfrog.com/bhw2pj . If I turn off the DropShadowFilter effect for the Canvas, they are also gone, so I assume it's a DropShadowFilter problem: http://yfrog.com/2d9y8j . The effect is simple: private static var _nodeDropShadow:DropShadowFilter = new DropShadowFilter(1, 45, 0x888888, 1, 1, 1); _backgroundComp.filters = _nodeDropShadow; Is it possible that Flex can't handle that much? Thanks in advance

    Read the article

  • Cache for large read only database recommendation

    - by paddydub
    I am building site on with Spring, Hibernate and Mysql. The mysql database contains information on coordinates and locations etc, it is never updated only queried. The database contains 15000 rows of coordinates and 48000 rows of coordinate connections. Every time a request is processed, the application needs to read all these coordinates which is taking approx 3-4 seconds. I would like to set up a cache, to allow quick access to the data. I'm researching memcached at the moment, can you please advise if this would be my best option?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Reverse massive text file in Java

    - by DanJanson
    What would be the best approach to reverse a large text file that is uploaded asynchronously to a servlet that reverses this file in a scalable and efficient way? text file can be massive (gigabytes long) can assume mulitple server/clustered environment to do this in a distributed manner. open source libraries are encouraged to consider I was thinking of using Java NIO to treat file as an array on disk (so that I don't have to treat the file as a string buffer in memory). Also, I am thinking of using MapReduce to break up the file and process it in separate machines. Any input is appreciated. Thanks. Daniel

    Read the article

  • Migrating from Physical SQL (SQL2000) To VMWare machine (SQL2008) - Transferring Large DB

    - by alex
    We're in the middle of migrating from a windows & SQL 2000 box to a Virtualised Win & SQL 2k8 box The VMWare box is on a different site, with better hardware, connectivity etc... The old(current) physical machine is still in constant use - I've taken a backup of the DB on this machine, which is 21GB Transfering this to our virtual machine took around 7+ hours - which isn't ideal when we do the "actual" switchover. My question is - How should I handle the migration better? Could i set up our current machine to do log shipping to the VM machine to keep up to date? then, schedule down time out of hours to do the switch over? Is there a better way?

    Read the article

  • bitshift large strings for encoding QR Codes

    - by icekreaman
    As an example, suppose a QR Code data stream contains 55 data words (each one byte in length) and 15 error correction words (again one byte). The data stream begins with a 12 bit header and ends with four 0 bits. So, 12 + 4 bits of header/footer and 15 bytes of error correction, leaves me 53 bytes to hold 53 alphanumeric characters. The 53 bytes of data and 15 bytes of ec are supplied in a string of length 68 (str68). The problem seems simple enough - concatenate 2 bytes of (right-shifted) header data with str68 and then left shift the entire 70 bytes by 4 bits. This is the first time in many years of programming that I have ever needed to do something like this, I am a c and bit shifting noob, so please be gentle... I have done a little investigation and so far have not been able to figure out how to bitshift 70 bytes of data; any help would be greatly appreciated. Larger QR codes can hold 2000 bytes of data...

    Read the article

  • Finding cause of memory leaks in large PHP stacks

    - by Mike B
    I have CLI script that runs over several thousand iterations between runs and it appears to have a memory leak. I'm using a tweaked version of Zend Framework with Smarty for view templating and each iteration uses several MB worth of code. The first run immediately uses nearly 8MB of memory (which is fine) but every following run adds about 80kb. My main loop looks like this (very simplified) $users = UsersModel::getUsers(); foreach($users as $user) { $obj = new doSomethingAwesome(); $obj->run($user); $obj = null; unset($obj); } The point is that everything in scope should be unset and the memory freed. My understanding is that PHP runs through its garbage collection process at it's own desire but it does so at the end of functions/methods/scripts. So something must be leaking memory inside doSomethingAwesome() but as I said it is a huge stack of code. Ideally, I would love to find some sort of tool that displayed all my variables no matter the scope at some point during execution. Some sort of symbol-table viewer for php. Does anything like that or any other tools that could help nail down memory leaks in php exist?

    Read the article

  • Large tables of static data with DBGhost

    - by Paulo Manuel Santos
    We are thinking of restructuring our database development and deployment processes by using DBGhost, we want to move away from the central development database and bring the database to the source control. One of the problems we have is a big table with static data (containing translated language strings), it has close to 200K rows. I know that our best solution is to move these stings into resource files, but until we implement that, will DbGhost be able to maintain all this static data and generate our development and deployment databases in a short time? And if not is there a good alternative to filling up this table whenever we need to?

    Read the article

  • Managing Large Database Entity Models

    - by ChiliYago
    I would like hear how other's are effectively (or not) working with the Visual Studio Entity Designer when many database tables exists. It seems to me that navigating the Designer is tough enough to find what you are looking for with just a few tables but how about a database with say 100 to 200 tables? When a table change is made at the database level how is the model updated? Does it overwrite any manual changes you have made to the model? How would you quickly find an entity in the designer to make a change or inspect a change? Seems unrealistic to be scrolling around looking for specific entity. Thanks for your feedback!

    Read the article

  • Objective C code to handle large amount of data processing in iPhone

    - by user167662
    I had the following code that takes in 14 mb or more of image data encoded in base4 string and converts them to jpeg before writing to a file in iphone. It crashes my program giving the following error : Program received signal: “0”. warning: check_safe_call: could not restore current frame I tweak my program and it can process a few more images before the error appear again. My coding is as follows: // parameters is an array where the fourth element contains a list of images in base64 >encoded string NSMutableArray *imageStrList = (NSMutableArray*) [parameters objectAtIndex:5]; while (imageStrList.count != 0) { NSString *imgString = [imageStrList objectAtIndex:0]; // Create a file name using my own Utility class NSString *fileName = [Utility generateFileNName]; NSData *restoredImg = [NSData decodeWebSafeBase64ForString:imgString]; UIImage *img = [UIImage imageWithData: restoredImg]; NSData *imgJPEG = UIImageJPEGRepresentation(img, 0.4f); [imgJPEG writeToFile:fileName atomically:YES]; [imageStrList removeObjectAtIndex:0]; } I tried playing around with UIImageJPEGRepresentation and found out that the lower the value, the more image it can processed but this should not be the way. I am wondering if there is anyway to free up memory of the imageStrList immediately after processing each image so that it can be used by the next one in the line.

    Read the article

  • How can I share an entity framework model across website users

    - by richardmoss
    Hello, Currently my website is based around MVC and the Entity Framework running against a SQL Server 2005 database. So far, it has all been running very smoothly, and I really enjoy MVC and its slimmer more concise code (and no huge viewstates or soul destroying postbacks ;)) Recently I was working on upgrading the site to use a simple forum system, and this is where I started running into problems. When I was testing the site using two different browsers, if I created or replied to a post in one browser, the other browser couldn't see the post. At the moment, each visitor to the site gets their own copy of the entity model, which I store in their session data. Obviously this is the problem as updates to one model aren't getting carried to the other. As a test, I tried storing a single copy of the model which all visitors would access by assigning the model to a static variable. This worked, and both browsers could see each others modifications. However, it had its side effects. For example, if I fired up both browsers at the same time and the model was initialized, one browser would crash, and the other would work fine, despite me using a locking object so in theory one of them should have been delayed until the model was ready (of course I could have implemented this wrong ;)). Also, originally this site did use one model for all visitors and when it was live, it frequently shut down - killing the IIS application pool while it did. Now I'm not sure if this was related, but I don't really want to reintroduce whatever bug I had that caused this shut down. So, my question is a simple one really - what is the best way of either using the same model for all website users so they all see updates, or if they do have separate copies (which I imagine will have a performance impact in time) how can the models detect changes in the database and update themselves according. Thanks in advance for any advice! Regards; Richard Moss

    Read the article

  • ActionBar SpinnerAdapter Large Branding followed by selection (spinner)

    - by SatanEnglish
    I'm trying to implement a spinner In the action bar that has brand Name above it. With the ActionBar setListNavigationCallbacks method if possible actionBar.setNavigationMode(ActionBar.NAVIGATION_MODE_LIST); actionBar.setListNavigationCallbacks(mSpinnerAdapter, null); Can anyone give me an Idea of how to do this? I would put some code here but I have no idea where to begin as I have not managed to find relevant information yet. Edit: Using V4.0

    Read the article

  • filesize of large files in c

    - by endeavormac
    How can I get the filesize of a file in C when the filesize is greater than 4gb? ftell returns a 4 byte signed long, limiting it to two bytes. stat has a variable of type off_t which is also 4 bytes (not sure of sign), so at most it can tell me the size of a 4gb file. What if the file is larger than 4 gb?

    Read the article

  • Best practice to modularise a large Grails app?

    - by Mulone
    Hi all, A Grails app I'm working on is becoming pretty big, and it would be good to refactor it into several modules, so that we don't have to redeploy the whole thing every time. In your opinion, what is the best practice to split a Grails app in several modules? In particular I'd like to create a package of domain classes + relevant services and use it in the app as a module. Is this possible? Is it possible to do it with plugins? Cheers, Mulone

    Read the article

  • inserting large number of dates

    - by Radhe
    How can I insert all dates in an year(or more) in a table using sql My dates table has following structure dates(date1 date); Suppose I want to insert dates between "2009-01-01" to "2010-12-31" inclusive. Is there any sql query for the above?

    Read the article

  • TSQL, select values from large many-to-many relationship

    - by eugeneK
    I have two tables Publishers and Campaigns, both have similar many-to-many relationships with Countries,Regions,Languages and Categories. more info Publisher2Categories has publisherID and categoryID which are foreign keys to publisherID in Publishers and categoryID in Categories which are identity columns. On other side i have Campaigns2Categories with campaignID and categoryID columns which are foreign keys to campaignID in Campaigns and categoryID in Categories which again are identities. Same goes for Regions, Languages and Countries relationships I pass to query certain publisherID and want to get campaignIDs of Campaigns that have at least one equal to Publisher value from regions, countries, language or categories thanks

    Read the article

  • Robust Large File Transfer with WCF

    - by Sharov
    I want to transfer big files (1GB) over unreliable transport channels. When connection is interrupted, I don't want start file transfering from the begining. I can partially store it in a temp table and store last readed position, so when connection is reestablished I can request continue uploading of file from this position. Is there any best-practice for such kind of things. I'm currently use chunking channel.

    Read the article

  • Timeout on Large mySQL Query

    - by Bob Stewart
    I have this query: $theQuery = mysql_query("SELECT phrase, date from wordList WHERE group='nouns'"); while($getWords=mysql_fetch_array($theQuery)) { echo "$getWords[phrase] created on $getWords[date]<br>"; } The data table "wordList" contains 75,000 records in the group "nouns" and every time I load the code I am returned an error. Help!

    Read the article

  • Load large images into Bitmap?

    - by GuyNoir
    I'm trying to make a basic application that displays an image from the camera, but I when I try to load the .jpg in from the sdcard with BitmapFactory.decodeFile, it returns null. It doesn't give an out of memory error which I find strange, but the exact same code works fine on smaller images. How does the generic gallery display huge pictures from the camera with so little memory?

    Read the article

  • designing an ASP.NET MVC partial view - showing user choices within a large set of choices

    - by p.campbell
    Consider a partial view whose job is to render markup for a pizza order. The desire is to reuse this partial view in the Create, Details, and Update views. It will always be passed an IEnumerable<Topping>, and output a multitude of checkboxes. There are lots... maybe 40 in all (yes, that might smell). A-OK so far. Problem The question is around how to include the user's choices on the Details and Update views. From the datastore, we've got a List<ChosenTopping>. The goal is to have each checkbox set to true for each chosen topping. What's the easiest to read, or most maintainable way to achieve this? Potential Solutions Create a ViewModel with the List and List. Write out the checkboxes as per normal. While writing each, check whether the ToppingID exists in the list of ChosenTopping. Create a new ViewModel that's a hybrid of both. Perhaps call it DisplayTopping or similar. It would have property ID, Name and IsUserChosen. The respective controller methods for Create, Update, and Details would have to create this new collection with respect to the user's choices as they see fit. The Create controller method would basically set all to false so that it appears to be a blank slate. The real application isn't pizza, and the organization is a bit different from the fakeshot, but the concept is the same. Is it wise to reuse the control for the 3 different scenarios? How better can you display the list of options + the user's current choices? Would you use jQuery instead to show the user selections? Any other thoughts on the potential smell of splashing up a whole bunch of checkboxes?

    Read the article

  • Internet explore is unresponsive while loading a large page

    - by kdhamane
    We have a html page being rendered in the browser (IE) that causes the browser to hang. The page is generated through server side script (ASP.NET and viewstate is disabled). The page while loading takes a long time (its not a b\w issue since we can reproduce it on local machine) and sometimes results in script unresponsive error. On debugging the issue we found that the html size on the client side is 4.73 MB. There's also a lot of DOM traversal (using JQuery) after document is ready (jquery-document.ready). After loading as well, the page simply hangs on any user interaction (scroll, mouseover) etc. A CPU usage spike (25-50% usage) is seen during loading and on any user interaction

    Read the article

  • Assigning large UInt32 constants in VB.Net

    - by Kumba
    I inquired on VB's erratic behavior of treating all numerics as signed types back in this question, and from the accepted answer there, was able to get by. Per that answer: Visual Basic Literals Also keep in mind you can add literals to your code in VB.net and explicitly state constants as unsigned. So I tried this: Friend Const POW_1_32 As UInt32 = 4294967296UI And VB.NET throws an Overflow error in the IDE. Pulling out the integer overflow checks doesn't seem to help -- this appears to be a flaw in the IDE itself. This, however, doesn't generate an error: Friend Const POW_1_32 As UInt64 = 4294967296UL So this suggests to me that the IDE isn't properly parsing the code and understanding the difference between Int32 and UInt32. Any suggested workarounds and/or possible clues on when MS will make unsigned data types intrinsic to the framework instead of the hacks they currently are?

    Read the article

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >