Search Results

Search found 23527 results on 942 pages for 'url pattern'.

Page 146/942 | < Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >

  • What is good practice in .NET system architecture design concerning multiple models and aggregates

    - by BuzzBubba
    I'm designing a larger enterprise architecture and I'm in a doubt about how to separate the models and design those. There are several points I'd like suggestions for: - models to define - way to define models Currently my idea is to define: Core (domain) model Repositories to get data to that domain model from a database or other store Business logic model that would contain business logic, validation logic and more specific versions of forms of data retrieval methods View models prepared for specifically formated data output that would be parsed by views of different kind (web, silverlight, etc). For the first model I'm puzzled at what to use and how to define the mode. Should this model entities contain collections and in what form? IList, IEnumerable or IQueryable collections? - I'm thinking of immutable collections which IEnumerable is, but I'd like to avoid huge data collections and to offer my Business logic layer access with LINQ expressions so that query trees get executed at Data level and retrieve only really required data for situations like the one when I'm retrieving a very specific subset of elements amongst thousands or hundreds of thousands. What if I have an item with several thousands of bids? I can't just make an IEnumerable collection of those on the model and then retrieve an item list in some Repository method or even Business model method. Should it be IQueryable so that I actually pass my queries to Repository all the way from the Business logic model layer? Should I just avoid collections in my domain model? Should I void only some collections? Should I separate Domain model and BusinessLogic model or integrate those? Data would be dealt trough repositories which would use Domain model classes. Should repositories be used directly using only classes from domain model like data containers? This is an example of what I had in mind: So, my Domain objects would look like (e.g.) public class Item { public string ItemName { get; set; } public int Price { get; set; } public bool Available { get; set; } private IList<Bid> _bids; public IQueryable<Bid> Bids { get { return _bids.AsQueryable(); } private set { _bids = value; } } public AddNewBid(Bid newBid) { _bids.Add(new Bid {.... } } Where Bid would be defined as a normal class. Repositories would be defined as data retrieval factories and used to get data into another (Business logic) model which would again be used to get data to ViewModels which would then be rendered by different consumers. I would define IQueryable interfaces for all aggregating collections to get flexibility and minimize data retrieved from real data store. Or should I make Domain Model "anemic" with pure data store entities and all collections define for business logic model? One of the most important questions is, where to have IQueryable typed collections? - All the way from Repositories to Business model or not at all and expose only solid IList and IEnumerable from Repositories and deal with more specific queries inside Business model, but have more finer grained methods for data retrieval within Repositories. So, what do you think? Have any suggestions?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • PHP-REGEX: accented letters matches non-accented ones, and visceversa. How to achive it?

    - by Lightworker
    I want to do the typical higlight code. So I have something like: $valor = preg_replace("/(".$_REQUEST['txt_search'].")/iu", "<span style='background-color:yellow; font-weight:bold;'>\\1</span>", $valor); Now, the request word could be something like "josé". And with it, I want "jose" or "JOSÉ" or "José" or ... highlighted too. With this expression, if I write "josé", it matches "josé" and "JOSÉ" (and all the case variants). It always matches the accented variants only. If I search "jose", it matches "JOSE", "jose", "Jose"... but not the accented ones. So I've partially what I want, cause I have case insensitive on accented and non-accented separately. I need it fully combined, wich means accent (unicode) insensitive, so I can search "jose", and highlight "josé", "josÉ", "José", "JOSE", "JOSÉ", "JoSé", ... I don't want to do a replace of accents on the word, cause when I print it on screen I need to see the real word as it comes. Any ideas? Thanks!

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • Multi-tenant Access Control: Repository or Service layer?

    - by FreshCode
    In a multi-tenant ASP.NET MVC application based on Rob Conery's MVC Storefront, should I be filtering the tenant's data in the repository or the service layer? 1. Filter tenant's data in the repository: public interface IJobRepository { IQueryable<Job> GetJobs(short tenantId); } 2. Let the service filter the repository data by tenant: public interface IJobService { IList<Job> GetJobs(short tenantId); } My gut-feeling says to do it in the service layer (option 2), but it could be argued that each tenant should in essence have their own "virtual repository," (option 1) where this responsibility lies with the repository. Which is the most elegant approach: option 1, option 2 or is there a better way? Update: I tried the proposed idea of filtering at the repository, but the problem is that my application provides the tenant context (via sub-domain) and only interacts with the service layer. Passing the context all the way to the repository layer is a mission. So instead I have opted to filter my data at the service layer. I feel that the repository should represent all data physically available in the repository with appropriate filters for retrieving tenant-specific data, to be used by the service layer. Final Update: I ended up abandoning this approach due to the unnecessary complexities. See my answer below.

    Read the article

  • C#/ASP.NET MVC 4 Instantiate Object Derived From Interface In Factory Method

    - by Chris
    Currently have a Factory class that features a GetSelector function, which returns a concrete implementation of ISelector. I have several different classes that implement ISelector and based on a setting I would like to receive the appropriate ISelector back. public interface ISelector { string GetValue(string Params); } public class XmlSelector : ISelector { public string GetValue(string Params) { // open XML file and get value } } public static class SelectorFactory { public static ISelector GetSelector() { return new XmlSelector(); // Needs changing to look at settings } } My question is what is the best way to store the setting? I am aware of using AppSettings etc. but I'm not sure whether I want to have to store strings in the web.config and perform a switch on it - just seems to be really tightly coupled in that if a new implementation of ISelector is made, then the Factory would need to be changed. Is there any way of perhaps storing an assembly name and instantiating based on that? Thanks, Chris

    Read the article

  • C# Inheritence: Choosing what repository based on type of inherited class

    - by Oskar Kjellin
    I have been making a program that downloads information about movies from the internet. I have a base class Title, which represents all titles. Movie, Serie and Episode are inherited from that class. To save them to the database I have 2 services, MovieService and SerieService. They in turn call repositories, but that is not important here. I have a method Save(Title title) which I am not very happy with. I check for what type the title is and then call the correct service. I would like to perhaps write like this: ITitleService service = title.GetService(); title.GetSavedBy(service); So I have an abstract method on Title that returns an ITitleSaver, which will return the correct service for the instance. My question is how should I implement ITitleSaver? If I make it accept Title I will have to cast it to the correct type before calling the correct overload. Which will lead to having to deal with casting once again. What is the best approach to dealing with this? I would like to have the saving logic in the corresponding class.

    Read the article

  • Comparing 2 columns in the same table with the "Like" function

    - by Vic
    I'm trying to come up with a way to query the values in two different columns in the same table where the result set will indicate instances where the value of columnB doesn't contain the value of columnA. For example, my "Nodes" table contains columns "NodeName" and "DNS". The values should look similar to the following: NodeName DNS Router1 Router1.mydomain.com I want to run a query to show which rows have a DNS value that does not contain (or begin with) the value of the NodeName field. I think the query should function something similar to the following, but obviously I'm missing something with regard to the use of "Like" in this situation. SELECT NodeName, DNS WHERE DNS NOT LIKE 'NodeName%' I'm using SQL Server 2005, and any suggestions would be greatly appreciated... :)

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

  • Dependecy Injection with Massive ORM: dynamic trouble

    - by Sergi Papaseit
    I've started working on an MVC 3 project that needs data from an enormous existing database. My first idea was to go ahead and use EF 4.1 and create a bunch of POCO's to represent the tables I need, but I'm starting to think the mapping will get overly complicated as I only need some of the columns in some of the tables. (thanks to Steven for the clarification in the comments. So I thought I'd give Massive ORM a try. I normally use a Unit of Work implementation so I can keep everything nicely decoupled and can use Dependency Injection. This is part of what I have for Massive: public interface ISession { DynamicModel CreateTable<T>() where T : DynamicModel, new(); dynamic Single<T>(string where, params object[] args) where T : DynamicModel, new(); dynamic Single<T>(object key, string columns = "*") where T : DynamicModel, new(); // Some more methods supported by Massive here } And here's my implementation of the above interface: public class MassiveSession : ISession { public DynamicModel CreateTable<T>() where T : DynamicModel, new() { return new T(); } public dynamic Single<T>(string where, params object[] args) where T: DynamicModel, new() { var table = CreateTable<T>(); return table.Single(where, args); } public dynamic Single<T>(object key, string columns = "*") where T: DynamicModel, new() { var table = CreateTable<T>(); return table.Single(key, columns); } } The problem comes with the First(), Last() and FindBy() methods. Massive is based around a dynamic object called DynamicModel and doesn't define any of the above method; it handles them through a TryInvokeMethod() implementation overriden from DynamicObject instead: public override bool TryInvokeMember(InvokeMemberBinder binder, object[] args, out object result) { } I'm at a loss on how to "interface" those methods in my ISession. How could my ISession provide support for First(), Last() and FindBy()? Put it another way, how can I use all of Massive's capabilities and still be able to decouple my classes from data access?

    Read the article

  • WPF tree data binding

    - by Am
    Hi, I have a well defined tree repository. Where I can rename items, move them up, down, etc. Add new and delete. The data is stored in a table as follows: Index Parent Label Left Right 1 0 root 1 14 2 1 food 2 7 3 2 cake 3 4 4 2 pie 5 6 5 1 flowers 8 13 6 5 roses 9 10 7 5 violets 11 12 Representing the following tree: (1) root (14) (2) food (7) (8) flowers (13) (3) cake (4) (5) pie (6) (9) roeses (10) (11) violets (12) or root food cake pie flowers roses violets Now, my problem is how to represent this in a bindable way, so that a TreeView can handle all the possible data changes? Renaming is easy, all I need is to make the label an updatble field. But what if a user moves flowers above food? I can make the relevant data changes, but they cause a complete data change to all other items in the tree. And all the examples I found of bindable hierarchies are good for non static trees.. So my current (and bad) solution is to reload the displayed tree after relocation change. Any direction will be good. Thanks

    Read the article

  • Can anyone explain UriMatcher (Android SDK)?

    - by mobibob
    I have been tasked with designing my web services client code to use the utility class UriMatcher in the Android SDK. Unfortunately, the example in the Dev Guide does not relate to anything in my mind. I know I am missing some fundamental points to the functionality and possibly about Uri itself. If you can tie it to some web APIs that are accessible with HTTP POST request, that would be ideal.

    Read the article

  • Dependency injection and factory

    - by legenden
    Trying to figure out how to best handle the following scenario: Assume a RequestContext class which has a dependency to an external service, such as: public class RequestContext : IRequestContext { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContext(ServiceFactory<IWeatherService> weatherService, UserLocation location, string query) { _weatherService = weatherService; ... What sort of dependency should I require in the class that will ultimately instantiate RequestContext? It could be ServiceFactory<IWeatherService>, but that doesn't seem right, or I could create an IRequestContextFactory for it along the lines of: public class RequestContextFactory : IRequestContextFactory { private readonly ServiceFactory<IWeatherService> _weatherService; public RequestContextFactory(ServiceFactory<IWeatherService> weatherService) { _weatherService = weatherService; } public RequestContext Create(UserLocation location, string query) { return new RequestContext(_weatherService, location, query); } } And then pass the IRequestContextFactory through constructor injection. This seems like a good way to do it, but the problem with this approach is that I think it hinders discoverability (devs must know about the factory and implement it, which is not really apparent). Is there a better/more discoverable way that I'm missing?

    Read the article

  • XSLT fails to load huge XML doc after matching certain elements

    - by krisvandenbergh
    I'm trying to match certain elements using XSLT. My input document is very large and the source XML fails to load after processing the following code (consider especially the first line). <xsl:template match="XMI/XMI.content/Model_Management.Model/Foundation.Core.Namespace.ownedElement/Model_Management.Package/Foundation.Core.Namespace.ownedElement"> <rdf:RDF> <rdf:Description rdf:about=""> <xsl:for-each select="Foundation.Core.Class"> <xsl:for-each select="Foundation.Core.ModelElement.name"> <owl:Class rdf:ID="@Foundation.Core.ModelElement.name" /> </xsl:for-each> </xsl:for-each> </rdf:Description> </rdf:RDF> </xsl:template> Apparently the XSLT fails to load after "Model_Management.Model". The PHP code is as follows: if ($xml->loadXML($source_xml) == false) { die('Failed to load source XML: ' . $http_file); } It then fails to perform loadXML and immediately dies. I think there are two options now. 1) I should set a maximum executing time. Frankly, I don't know how that I do this for the built-in PHP 5 XSLT processor. 2) Think about another way to match. What would be the best way to deal with this? The input document can be found at http://krisvandenbergh.be/uml_pricing.xml Any help would be appreciated! Thanks.

    Read the article

  • Is factory method proper design for my problem?

    - by metdos
    Hello Everyone, here is my problem and I'm considering to use factory method in C++, what are your opinions ? There are a Base Class and a lot of Subclasses. I need to transfer objects on network via TCP. I will create objects in first side, and using this object I will create a byte array TCP message, and send it to other side. On the other side I will decompose TCP message, I will create object and I will add this object to a polymorphic queue.

    Read the article

  • What is the appropriate terminology in Java when building remote proxies?

    - by Uri
    Suppose that I am implementing a remote proxy in Java to an object that is likely to reside on a remote server but may reside locally. There's my real object on the remote server, there's the local implementation (the proxy itself), and there's the interface I provide to my program which hides the details of where the object actually is. The local representation may contact a local or a remote implementation of the object. What is the standard terminology in Java for these things? What should I name my interfaces/classes? I've seen the terms Subjects, Images, and Implementations thrown around (probably from the GOF days), but I wonder what is acceptable way to do the naming for a framework written in Java.

    Read the article

< Previous Page | 142 143 144 145 146 147 148 149 150 151 152 153  | Next Page >