Search Results

Search found 13300 results on 532 pages for 'exalytics performance tuning'.

Page 147/532 | < Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >

  • JavaScript tags, performance and W3C

    - by Thomas
    Today I was looking for website optimization content and I found an article talking about move JavaScript scripts to the bottom of the HTML page. Is this valid with W3C's recommendations? I learned that all JavaScript must be inside of head tag... Thank you.

    Read the article

  • Improve performance writing 10 million records to text file using windows service

    - by user1039583
    I'm fetching more than 10 millions of records from database and writing to a text file. It takes hours of time to complete this operation. Is there any option to use TPL features here? It would be great if someone could get me started implementing this with the TPL. using (FileStream fStream = new FileStream("d:\\file.txt", FileMode.OpenOrCreate, FileAccess.ReadWrite)) { BufferedStream bStream = new BufferedStream(fStream); TextWriter writer = new StreamWriter(bStream); for (int i = 0; i < 100000000; i++) { writer.WriteLine(i); } bStream.Flush(); writer.Flush(); // empty buffer; fStream.Flush(); }

    Read the article

  • Mysql regexp performance question

    - by Tim
    Rumour has it that this; SELECT * FROM lineage_string where lineage like '%179%' and lineage regexp '(^|/)179(/|$)' Would be faster than this; SELECT * FROM lineage_string where lineage regexp '(^|/)179(/|$)' Can anyone confirm ? Or know a decent way to test the speed of such queries. Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • pyInotify performance

    - by tranimatronic
    I have a very large directory tree I am wanting pyInotify to watch. Is it better to have pyInotify watch the entire tree or is it better to have a number of watches reporting changes to specific files ? Thanks

    Read the article

  • Stopping cookies being set from a domain (aka "cookieless domain") to increase site performance

    - by Django Reinhardt
    I was reading in Google's documentation about improving site speed. One of their recommendations is serving static content (images, css, js, etc.) from a "cookieless domain": Static content, such as images, JS and CSS files, don't need to be accompanied by cookies, as there is no user interaction with these resources. You can decrease request latency by serving static resources from a domain that doesn't serve cookies. Google then says that the best way to do this is to buy a new domain and set it to point to your current one: To reserve a cookieless domain for serving static content, register a new domain name and configure your DNS database with a CNAME record that points the new domain to your existing domain A record. Configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain. In your web pages, reference the domain name in the URLs for the static resources. This is pretty straight forward stuff, except for the bit where it says to "configure your web server to serve static resources from the new domain, and do not allow any cookies to be set anywhere on this domain". From what I've read, there's no setting in IIS that allows you to say "serve static resources", so how do I prevent ASP.NET from setting cookies on this new domain? At present, even if I'm just requesting a .jpg from the new domain, it sets a cookie on my browser, even though our application's cookies are set to our old domain. For example, ASP.NET sets an ".ASPXANONYMOUS" cookie that (as far as I'm aware) we're not telling it to do. Apologies if this is a real newb question, I'm new at this! Thanks.

    Read the article

  • Performance implications of finalizers on JVM

    - by Alexey Romanov
    According to this post, in .Net, Finalizers are actually even worse than that. Besides that they run late (which is indeed a serious problem for many kinds of resources), they are also less powerful because they can only perform a subset of the operations allowed in a destructor (e.g., a finalizer cannot reliably use other objects, whereas a destructor can), and even when writing in that subset finalizers are extremely difficult to write correctly. And collecting finalizable objects is expensive: Each finalizable object, and the potentially huge graph of objects reachable from it, is promoted to the next GC generation, which makes it more expensive to collect by some large multiple. Does this also apply to JVMs in general and to HotSpot in particular?

    Read the article

  • How to test my GAE site for performance

    - by Sergey Basharov
    I am building a GAE site that uses AJAX/JSON for almost all its tasks including building the UI elements, all interactions and client-server requests. What is a good way to test it for highloads so that I could have some statistics about how much resources 1000 average users per some period of time would take. I think I can create some Python functions for this purpose. What can you advise? Thanks.

    Read the article

  • LINQ Joins - Performance

    - by Meiscooldude
    I am curious on how exactly LINQ (not LINQ to SQL) is performing is joins behind the scenes in relation to how Sql Server performs joins. Sql Server before executing a query, generates an Execution Plan. The Execution Plan is basically an Expression Tree on what it believes is the best way to execute the query. Each node provides information on whether to do a Sort, Scan, Select, Join, ect. On a 'Join' node in our execution plan, we can see three possible algorithms; Hash Join, Merge Join, and Nested Loops Join. Sql Server will choose which algorithm to for each Join operation based on expected number of rows in Inner and Outer tables, what type of join we are doing (some algorithms don't support all types of joins), whether we need data ordered, and probably many other factors. Join Algorithms: Nested Loop Join: Best for small inputs, can be optimized with ordered inner table. Merge Join: Best for medium to large inputs sorted inputs, or an output that needs to be ordered. Hash Join: Best for medium to large inputs, can be parallelized to scale linearly. LINQ Query: DataTable firstTable, secondTable; ... var rows = from firstRow in firstTable.AsEnumerable () join secondRow in secondTable.AsEnumerable () on firstRow.Field<object> (randomObject.Property) equals secondRow.Field<object> (randomObject.Property) select new {firstRow, secondRow}; SQL Query: SELECT * FROM firstTable fT INNER JOIN secondTable sT ON fT.Property = sT.Property Sql Server might use a Nested Loop Join if it knows there are a small number of rows from each table, a merge join if it knows one of the tables has an index, and Hash join if it knows there are a lot of rows on either table and neither has an index. Does Linq choose its algorithm for joins? or does it always use one?

    Read the article

  • Performance improvement of client server system

    - by Tanuj
    I have a legacy client server system where the server maintains a record of some data stored in a sqlite database. The data is related to monitoring access patterns of files stored on the server. The client application is basically a remote viewer of the data. When the client is launched, it connects to the server and gets the data from the server to display in a grid view. The data gets updated in real time on the server and the view in the client automatically gets refreshed. There are two problems with the current implementation: When the database gets too big, it takes a lot of time to load the client. What are the best ways to deal with this. One option is to maintain a cache at the client side. How to best implement a cache ? How can the server maintain a diff so that it only sends the diff during the refresh cycle. There can be multiple clients and each client needs to display the latest data available on the server. The server is a windows service daemon. Both the client and the server are implemented in C#

    Read the article

  • How large is the performance loss for a 64-bit VirtualBox guest running on a 32-bit host?

    - by IllvilJa
    I have a 64-bit Virtualbox guest running Gentoo Linux (amd64) and it is currently hosted on a 32-bit Gentoo laptop. I've noticed that the performance of the VM is very slow compared to the performance of the 32-bit host itself. Also when I compare with another 32-bit Linux VM running on the same host, performance is significantly less on the 64-bit VM. I know that running a 64-bit VM on a 32-bit host does incur some performance penalties for the VM, but does anyone have any deeper knowledge of how large a penalty one might expect in this scenario, roughly speaking? Is a 10% slowdown something to expect, or should it be a slowdown in the 90% range (running at 1/10 the normal speed)? Or to phrase it in another way: would it be reasonable to expect that the performance improvement for the 64-bit VM increases so much that it is worth reinstalling the host machine to run 64-bit Gentoo instead? I'm currently seriously considering that upgrade, but am curious about other peoples experience of the current scenario. I am aware that the host OS will require more RAM when running in 64-bit, but that's OK for me. Also, I do know that one usually don't run a 64-bit VM on a 32-bit server (I'm surprised I even got the VM started in the first place) but things turned out that way when I tried to future proof the VM I was setting up and decided to make it 64-bit anyway.

    Read the article

  • why arrayfun does NOT improve my struct array operation performance

    - by HaveF
    here is the input data: % @param Landmarks: % Landmarks should be 1*m struct. % m is the number of training set. % Landmark(i).data is a n*2 matrix old function: function Landmarks=CenterOfGravity(Landmarks) % align center of gravity for i=1 : length(Landmarks) Landmarks(i).data=Landmarks(i).data - ones(size(Landmarks(i).data,1),1)... *mean(Landmarks(i).data); end end new function which use arrayfun: function [Landmarks] = center_to_gravity(Landmarks) Landmarks = arrayfun(@(struct_data)... struct('data', struct_data.data - repmat(mean(struct_data.data), [size(struct_data.data, 1), 1]))... ,Landmarks); end %function center_to_gravity when using profiler, I find the usage of time is NOT what I expected: Function Total Time Self Time* CenterOfGravity 0.011s 0.004 s center_to_gravity 0.029s 0.001 s Can someone tell me why? BTW...I can't add "arrayfun" as a new tag for my reputation.

    Read the article

  • Performance problems when loading local JSON via <script> elements in IE8

    - by Jens Bannmann
    I have a web page with some JS scripts that needs to work locally, e.g. from hard disk or a CD-ROM. The scripts load JSON data from files by inserting <script> tags. This worked fine in IE6, but now in IE8 it takes an enormous amount of time: it went from "instantly" to 3-10 seconds. The main data file is 45KB large. How can I solve this? I would switch from <script> tags to another method of loading JSON (ideally involving the new native JSON parser), but it seems locally loaded content cannot access the XMLHttpRequest object. Any ideas?

    Read the article

  • Dynamically generating high performance functions in clojure

    - by mikera
    I'm trying to use Clojure to dynamically generate functions that can be applied to large volumes of data - i.e. a requirement is that the functions be compiled to bytecode in order to execute fast, but their specification is not known until run time. e.g. suppose I specify functions with a simple DSL like: (def my-spec [:add [:multiply 2 :param0] 3]) I would like to create a function compile-spec such that: (compile-spec my-spec) Would return a compiled function of one parameter x that returns 2x+3. What is the best way to do this in Clojure?

    Read the article

  • Javascript memory leak/ performance issue?

    - by Tom
    I just cannot for the life of me figure out this memory leak in Internet Explorer. insertTags simple takes string str and places each word within start and end tags for HTML (usually anchor tags). transliterate is for arabic numbers, and replaces normal numbers 0-9 with a &#..n; XML identity for their arabic counterparts. fragment = document.createDocumentFragment(); for (i = 0, e = response.verses.length; i < e; i++) { fragment.appendChild((function(){ p = document.createElement('p'); p.setAttribute('lang', (response.unicode) ? 'ar' : 'en'); p.innerHTML = ((response.unicode) ? (response.surah + ':' + (i+1)).transliterate() : response.surah + ':' + (i+1)) + ' ' + insertTags(response.verses[i], '<a href="#" onclick="window.popup(this);return false;" class="match">', '</a>'); try { return p } finally { p = null; } })()); } params[0].appendChild( fragment ); fragment = null; I would love some links other than MSDN and about.com, because neither of them have sufficiently explained to me why my script leaks memory. I am sure this is the problem, because without it everything runs fast (but nothing displays). I've read that doing a lot of DOM manipulations can be dangerous, but the for loops a max of 286 times (# of verses in surah 2, the longest surah in the Qur'an).

    Read the article

  • Measure CPU performance via JS

    - by Nicholas Kyriakides
    A webapp has as a central component a relatively heavy algorithm that handles geometric operations. There are 2 solutions to make the whole thing accessible from both high-end machines and relatively slower mobile devices. I will use RPC's if i detect that the user machine is ''slow'' or else if i detect that the user machine can handle it OK, then i provide to the webapp the script to handle it client side. Now what would be a reliable way to detect the speed of the user machine? I was thinking of providing a sample script as a test when the page loads and detect the time it took to execute that. Any ideas?

    Read the article

  • UITableView performance degrading after adding subviews on cell iphone sdk

    - by neha
    Hi all, In my application, I'm adding a label and two buttons on cell of UItableView [I have not created a separate cell class]. I'm adding these to cell and not cell.contentview. After I run my application on IPhone, the tableview cell rendering after I move the cells up-down, is very jerky. Is it because I'm not adding the views on cell.contentView or because I've not created a custom class for cell? Can anybody please help? Thanks in advance.

    Read the article

  • Java curious Loop Performance

    - by user1680583
    I have a big problem while evaluate my java code. To simplify the problem I wrote the following code which produce the same curious behavior. Important is the method run() and given double value rate. For my runtime test (in the main method) I set the rate to 0.5 one times and 1.0 the other time. With the value 1.0 the if-statement will be executed in each loop iteration and with the value 0.5 the if-statement will be executed half as much. For this reason I expected longer runtime by the first case but opposite is true. Can anybody explain me this phenomenon?? The result of main: Test mit rate = 0.5 Length: 50000000, IF executions: 25000856 Execution time was 4329 ms. Length: 50000000, IF executions: 24999141 Execution time was 4307 ms. Length: 50000000, IF executions: 25001582 Execution time was 4223 ms. Length: 50000000, IF executions: 25000694 Execution time was 4328 ms. Length: 50000000, IF executions: 25004766 Execution time was 4346 ms. ================================= Test mit rate = 1.0 Length: 50000000, IF executions: 50000000 Execution time was 3482 ms. Length: 50000000, IF executions: 50000000 Execution time was 3572 ms. Length: 50000000, IF executions: 50000000 Execution time was 3529 ms. Length: 50000000, IF executions: 50000000 Execution time was 3479 ms. Length: 50000000, IF executions: 50000000 Execution time was 3473 ms. The Code public ArrayList<Byte> list = new ArrayList<Byte>(); public final int LENGTH = 50000000; public PerformanceTest(){ byte[]arr = new byte[LENGTH]; Random random = new Random(); random.nextBytes(arr); for(byte b : arr) list.add(b); } public void run(double rate){ byte b = 0; int count = 0; for (int i = 0; i < LENGTH; i++) { if(getRate(rate)){ list.set(i, b); count++; } } System.out.println("Length: " + LENGTH + ", IF executions: " + count); } public boolean getRate(double rate){ return Math.random() < rate; } public static void main(String[] args) throws InterruptedException { PerformanceTest test = new PerformanceTest(); long start, end; System.out.println("Test mit rate = 0.5"); for (int i = 0; i < 5; i++) { start=System.currentTimeMillis(); test.run(0.5); end = System.currentTimeMillis(); System.out.println("Execution time was "+(end-start)+" ms."); Thread.sleep(500); } System.out.println("================================="); System.out.println("Test mit rate = 1.0"); for (int i = 0; i < 5; i++) { start=System.currentTimeMillis(); test.run(1.0); end = System.currentTimeMillis(); System.out.println("Execution time was "+(end-start)+" ms."); Thread.sleep(500); } }

    Read the article

  • Entity framework with Linq to Entities performance

    - by mare
    If I have a static method like this public static string GetTicClassificationTitle(string classI, string classII, string classIII) { using (TicDatabaseEntities ticdb = new TicDatabaseEntities()) { var result = from classes in ticdb.Classifications where classes.ClassI == classI where classes.ClassII == classII where classes.ClassIII == classIII select classes.Description; return result.FirstOrDefault(); } } and use this method in various places in foreach loops or just plain calling it numerous times, does it create and open new connection every time? If so, how can I tackle this? Should I cache the results somewhere, like in this case, I would cache the entire Classifications table in Memory Cache? And then do queries vs this cached object? Or should I make TicDatabaseEntities variable static and initialize it at class level? Should my class be static if it contains only static methods? Because right now it is not.. Also I've noticed that if I return result.First() instead of FirstOrDefault() and the query does not find a match, it will issue an exception (with FirstOrDefault() there is no exception, it returns null). Thank you for clarification.

    Read the article

< Previous Page | 143 144 145 146 147 148 149 150 151 152 153 154  | Next Page >