Search Results

Search found 12582 results on 504 pages for 'remove'.

Page 151/504 | < Previous Page | 147 148 149 150 151 152 153 154 155 156 157 158  | Next Page >

  • uninstall google chrome in fedora

    - by tbleckert
    Yesterday I installed Fedora 15 Beta with GNOME 3 - it works well. One problem though is that I installed Chrome 32-bit (which was wrong, should have been the 64-bit version) and now I can't uninstall it. I can't find it in Add/Remove Software, and I also can't install the correct version of Chrome because it complains about my other copy of Chrome. Any ideas how I can remove the existing copy and get the 64-bit version installed? Here's the message I get when trying to install: Test Transaction Errors: file /etc/cron.daily/google-chrome from install of google-chrome-stable-11.0.696.65-84435.x86_64 conflicts with file from package google-chrome-stable-11.0.696.65-84435.i386 file /opt/google/chrome/chrome from install of google-chrome-stable-11.0.696.65-84435.x86_64 conflicts with file from package google-chrome-stable-11.0.696.65-84435.i386 file /opt/google/chrome/chrome-sandbox from install of google-chrome-stable-11.0.696.65-84435.x86_64 conflicts with file from package google-chrome-stable-11.0.696.65-84435.i386 file /opt/google/chrome/libffmpegsumo.so from install of google-chrome-stable-11.0.696.65-84435.x86_64 conflicts with file from package google-chrome-stable-11.0.696.65-84435.i386 file /opt/google/chrome/libpdf.so from install of google-chrome-stable-11.0.696.65-84435.x86_64 conflicts with file from package google-chrome-stable-11.0.696.65-84435.i386 file /opt/google/chrome/libppGoogleNaClPluginChrome.so from install of google-chrome-stable-11.0.696.65-84435.x8...

    Read the article

  • Windows 2000 uninstall on a dual-boot 2000/XP system

    - by Viktor
    While several questions have already been answered about removing an OS from a dual-booting machine, most refer to Windows 7 vs. Linux/Vista/XP. I have W2K installed on my older HDD (Drive C). Later on I bought a new HDD and installed XP's under W2K environment. Each time I turned my PC on, I had the choice of W2K or XP OS, which I still have. I eventually stopped using the w2k OS and as the older HDD where this OS is installed is getting old, I plan to remove it completely. The problem is that the active master boot record is on this very HDD. So when I remove the HDD, I get no OS loader, no matter what boot drive I choose in BIOS. Apparently I have to set the boot record on the newer HDD with XP's. Some advise to use the bootable XP CD and try to set the active MBR from there.. I don't have the CD anymore. Regardless, I suspect there is much less to solving this problem than running the recovery console, like a simple boot.ini file edit. But I might be wrong.

    Read the article

  • How to install PHP5.3 and SQLite3 on Ubuntu 8.04

    - by richard
    Hello, I got a Ubuntu Hardy VPS and I am trying to install PHP5.3 with SQLite. I added the dotdeb PHP5.3 repository and succeeded in installing PHP5.3. But I need to install SQLite as well. When I'm trying to install php5-sqlite3 (sudo aptitude install php5-sqlite3) this is the output: The following packages are BROKEN: php5-sqlite3 The following NEW packages will be automatically installed: php-db php-pear php-sqlite3 The following NEW packages will be installed: php-db php-pear php-sqlite3 0 packages upgraded, 4 newly installed, 0 to remove and 0 not upgraded. Need to get 460kB of archives. After unpacking 3027kB will be used. The following packages have unmet dependencies: php5-sqlite3: Depends: phpapi-20060613 which is a virtual package. Resolving dependencies... The following actions will resolve these dependencies: Remove the following packages: libapache2-mod-php5 php5 php5-mysql Install the following packages: php-pear [5.2.4-2ubuntu5.10 (hardy-updates, hardy-security)] Downgrade the following packages: php5-cli [5.3.1-0.dotdeb.1 (<NULL>, now) -> 5.2.4-2ubuntu5.10 (hardy-updates, hardy-security)] php5-common [5.3.1-0.dotdeb.1 (<NULL>, now) -> 5.2.4-2ubuntu5.10 (hardy-updates, hardy-security)] php5-suhosin [5.3.1-0.dotdeb.1 (<NULL>, now) -> 0.9.22-1 (hardy)] Score is 197 Accept this solution? [Y/n/q/?] Obviously, downgrading PHP is not an option. Please help me! If upgrading the server to a newer release of Ubuntu makes things easier, that's not a problem.

    Read the article

  • RAID-1 and regular drive removal (using RAID-1 as a backup measure)

    - by Vi
    Is using mdadm's RAID-1 of 2 partitions (one on laptop's internal HDD, one on external HDD) a good idea. I want the system to work as RAID-1 if both drives are present, work as regular volume (degradad RAID-1) if external HDD is unplugged and quickly resync when I plug external HDD again. Questions: Is it a good idea? Will write-intent bitmap be enough for this task or I need something else? Should I consider doing it at filesystem level (3b. if yes, how?). Basic requirements are: Quick resync when I re-add the external drive (provided I hasn't changed that partition). More or less consistent data on the removed drive if I remove it not during write/resync operation. If I remove the drive during resync I expect the data to be somewhat inconsistent, but expect quick resync completion when I re-add it again. E.g. I want the the remaining drive to track what is changed (there can be a lot of changes) and that sync back only those parts that need it.

    Read the article

  • CopSSH SFTP -- limit users access to their home directory only

    - by bradvido
    Let me preface this by saying I've read and followed these instructions at the FAQ many times: http://www.itefix.no/i2/node/37 It does not do what the title claims... It allows every user access to every other user's home directory, as well as access to all subfolders below the copssh installation path. I'm only using this for SFTP access and I need my users to be sandboxed into only their home directory. If you know a fool-proof way to lock users down so they can see only their home directory and its subfolders, stop reading now and reply with the solution. The details: Here is exactly what i tried as I followed the FAQ. My copSSH installation directory is: C:\Program Files\CopSSH net localgroup sftp_users /ADD **Create a user group to hold all my SFTP users cacls c:\ /c /e /t /d sftp_users **For that group, deny access at the top level and all levels below cacls "C:\Program Files\CopSSH" /c /e /t /r sftp_users **Allow my user group access to the copSSH installation directory and its subdirectories For each sftp user, I create a new windows user account, then I: net localgroup sftp_users sftp_user_1 /add **Add my user to the group I've created Open the activate user wizard for CopSSH, choosing the user, "/bin/sftponly" and Remove copssh home directory if it exists **Remains checked Create keys for public key authentication **Remains checked Create link to user's real home directory **Remains checked This works, however, every user has access to every other user's home directory as well as the CopSSH root directory.... So I tried denying access for all users to the user home directory: cacls "C:\Program Files\CopSSH\home" /c /e /t /d sftp_users **Deny access for users to the user home directory Then I tried adding permissions on a user-by-user basis for each users home\username folder. However,these permission were not allowed by windows because of the above deny rule i created at the home directory was being inherited and over-riding my allow rule. The next step for me would be to remove the deny rule at the home directory and for each user folder, add a deny rule for every user it doesn't belong to, and add an allow rule for the one user it does belong to. However, as my user list gets long, this will become very cumbersome. Thanks for the help!

    Read the article

  • Problem removing US keyboard layout from input languages

    - by Nazariy
    I'm working on English (UK) version of Windows 7, my second input language is Russian. Since installation of Windows I have removed US keyboard layout and set LEFT ALT+SHIFT as input switcher. Everything was fine until now. Recently I noticed that my switch combination does not always work. I opened language select bar and found there English (US) keyboard layout. I went to settings and found that in General Tab there is only two languages available, US was not listed. I decided to add US layout manually and remove it after. This operation went as expected, US layout disappeared from language bar. But after few hours it appeared again. I started "googling" and found that I'm not alone. On Microsoft forum I found suggestion to remove US layout as I did before and than copy all settings to all profiles. It's look like some service are adding US layout on it's own, but I have no idea which one. Does any one know how to fix this issue?

    Read the article

  • How to know if your computer is hit by a dnschanger virus?

    - by kira
    The Federal Bureau of Investigation (FBI) is on the final stage of its Operation Ghost Click, which strikes against the menace of the DNSChanger virus and trojan. Infected PCs running the DNSChanger malware at unawares are in the danger of going offline on this coming Monday (July 9) when the FBI plans to pull down the online servers that communicate with the virus on host computers. After gaining access to a host PC, the DNSChanger virus tries to modify the DNS (Domain Name Server) settings, which are essential for Internet access, to send traffic to malicious servers. These poisoned web addresses in turn point traffic generated through infected PCs to fake or unsafe websites, most of them running online scams. There are also reports that the DNSChanger virus also acts as a trojan, allowing perpetrators of the hack attack to gain access to infected PCs. Google issued a general advisory for netizens in May earlier this year to detect and remove DNSChanger from infected PCs. According to our report, some 5 lakh PCs were still infected by the DNSChanger virus in May 2012. The first report of the DNSChanger virus and its affiliation with an international group of hackers first came to light towards the end of last year, and the FBI has been chasing them down ever since. The group behind the DNSChanger virus is estimated to have infected close to 4 million PCs around the world in 2011, until the FBI shut them down in November. In the last stage of Operation Ghost Click, the FBI plans to pull the plug and bring down the temporary rogue DNS servers on Monday, July 9, according to an official announcement. As a result, PCs still infected by the DNSChanger virus will be unable to access the Internet. How do you know if your PC has the DNSChanger virus? Don’t worry. Google has explained the hack attack and tools to remove the malware on its official blog. Trend Micro also has extensive step-by-step instructions to check if your Windows PC or Mac is infected by the virus. The article is found at http://www.thinkdigit.com/Internet/Google-warns-users-about-DNSChanger-malware_9665.html How to check if my computer is one of those affected?

    Read the article

  • Install Ubuntu on a new netbook?

    - by torbengb
    I'm planning to buy a netbook, and I am considering to install Ubuntu on it. It would mainly be used by my wife at home for web browsing and email at home (lightweight is important, hence a netbook!), and we'd occasionally bring it along on travels (mostly as digital photo dropzone). I want to use Ubuntu instead of Windows because I'm sick of all the Windows hassle and updates. I'm not concerned about Windows applications; I'd switch to native alternatives as far as possible because really only Firefox and something like Picasa are needed. I'm considering an ASUS Eee PC 1001P or an MSI Wind U100 or an Point of View Mobii II (click the links for specs; nevermind that the rest is German). I'm not in the USA. Whatever I buy will most likely have Windows 7 on it but no optical drive. I would also buy a large-ish USB stick but not an external optical drive. Should I (and can I) install Ubuntu alongside Windows 7, or remove Windows? If I remove Windows first, how would I be able to reinstall it if I change my mind? Can I make a backup? Is a recovery CD usually provided? Should I choose the regular Ubuntu, or the Ubuntu Netbook Remix (UNR)? Does UNR allow me to install additional applications just as easily? Note: I'm asking about Ubuntu vs. Windows; let's skip the hardware discussion for now. Edit: I'm assuming that Windows is already installed; if it isn't then I would only install Ubuntu and this question is irrelevant.

    Read the article

  • Exchange 2007 restore - Backup Exec Unable to Attach to a resource

    - by Andy
    I have been struggling with this one for months! Grateful for any advice. The setup is a windows 2003 server network, 4xservers on the domain. Two exchange 2007 servers (only one with mailboxes still on). Backup Exec (12.5) on a non-exchange server with agents on the others. Backup exec runs a full backup of exchange across the network well, at pretty reasonable speeds. However, when you try any kind of restore (individual emails, mailboxes or whole system restore - all to same location or to alternate server, RSG etc) the following message is received within about 10-15 secs of starting the job: Job ended: 24 December 2010 at 13:28:32 Completed status: Failed Final error: 0xe000848c - Unable to attach to a resource. Make sure that all selected resources exist and are online, and then try again. If the server or resource no longer exists, remove it from the selection list. Edit the selection list properties, click the View Selection Details tab, and then remove the resource. Final error category: Resource Errors For additional information regarding this error refer to link V-79-57344-33932 Things I have already tried: Changed account to main administrator account (with all permissions) checked versions of ese.dll on both servers - both the same Checked all VSS writers on both servers are stable / normal restoring to different locations Any advice anyone could give would be much appreciated. Many thanks, Andy

    Read the article

  • Tomcat 7 taking ages to start up after upgrade

    - by Lawrence
    I recently updated my server installation from Tomcat 6 to Tomcat 7, in order to take advantage of better connection pooling. My project uses Hibernate, for object persistance, a Mysql 5.5.20 database, and memcached for caching. When I was using Tomcat 6, Tomcat would start in about 8 seconds. After moving to Tomcat 7, it now takes between 75 - 80 seconds to start (this is on a Macbook pro 15", core i7 2Ghz, 8Gb of RAM). The only thing that has really changed between during the move from Tomcat 6 to 7 has been my context.xml file, which controls the connection pooling information: <Context antiJARLocking="true" reloadable="true" path=""> <Resource name="jdbc/test-db" auth="Container" type="javax.sql.DataSource" factory="org.apache.tomcat.jdbc.pool.DataSourceFactory" testOnBorrow="true" testOnReturn="false" testWhileIdle="true" validationQuery="SELECT 1" validationQueryTimeout="20000" validationInterval="30000" timeBetweenEvictionRunsMillis="60000" logValidationErrors="true" autoReconnect="true" username="webuser" password="xxxxxxx" driverClassName="com.mysql.jdbc.Driver" url="jdbc:mysql://databasename.us-east-1.rds.amazonaws.com:3306/test-db" maxActive="15" minIdle="2" maxIdle="10" maxWait="10000" maxAge="7200000"/> </Context> Now, as you can see, the database is running on Amazon RDS (where our live servers are), and thus is about 200ms round trip time away from my machine. I have already checked that I have security permissions to that database from my machine, (and anyway, it connects after 75 secs, so it cant be that). My initial thought was that Tomcat 7 and hibernate are doing something weird (like pre-instantiating a bunch of connections or something), and the latency to the database is amplifying the effects. While trying to diagnose the problem, I used jstack to get a stack trace of the Tomcat 7 server while its doing its startup thing. Here is the stack trace... Full thread dump Java HotSpot(TM) 64-Bit Server VM (20.12-b01-434 mixed mode): "Attach Listener" daemon prio=9 tid=7fa4c0038800 nid=0x10c39a000 waiting on condition [00000000] java.lang.Thread.State: RUNNABLE "Abandoned connection cleanup thread" daemon prio=5 tid=7fa4bb810000 nid=0x10f3ba000 in Object.wait() [10f3b9000] java.lang.Thread.State: WAITING (on object monitor) at java.lang.Object.wait(Native Method) - waiting on <7f40a0070> (a java.lang.ref.ReferenceQueue$Lock) at java.lang.ref.ReferenceQueue.remove(ReferenceQueue.java:118) - locked <7f40a0070> (a java.lang.ref.ReferenceQueue$Lock) at java.lang.ref.ReferenceQueue.remove(ReferenceQueue.java:134) at com.mysql.jdbc.NonRegisteringDriver$1.run(NonRegisteringDriver.java:93) "PoolCleaner[545768040:1352724902327]" daemon prio=5 tid=7fa4be852800 nid=0x10e772000 in Object.wait() [10e771000] java.lang.Thread.State: TIMED_WAITING (on object monitor) at java.lang.Object.wait(Native Method) - waiting on <7f40c7c90> (a java.util.TaskQueue) at java.util.TimerThread.mainLoop(Timer.java:509) - locked <7f40c7c90> (a java.util.TaskQueue) at java.util.TimerThread.run(Timer.java:462) "localhost-startStop-1" daemon prio=5 tid=7fa4bd034800 nid=0x10d66b000 runnable [10d668000] java.lang.Thread.State: RUNNABLE at java.net.SocketInputStream.socketRead0(Native Method) at java.net.SocketInputStream.read(SocketInputStream.java:129) at com.mysql.jdbc.util.ReadAheadInputStream.fill(ReadAheadInputStream.java:114) at com.mysql.jdbc.util.ReadAheadInputStream.readFromUnderlyingStreamIfNecessary(ReadAheadInputStream.java:161) at com.mysql.jdbc.util.ReadAheadInputStream.read(ReadAheadInputStream.java:189) - locked <7f3673be0> (a com.mysql.jdbc.util.ReadAheadInputStream) at com.mysql.jdbc.MysqlIO.readFully(MysqlIO.java:3014) at com.mysql.jdbc.MysqlIO.reuseAndReadPacket(MysqlIO.java:3467) at com.mysql.jdbc.MysqlIO.reuseAndReadPacket(MysqlIO.java:3456) at com.mysql.jdbc.MysqlIO.checkErrorPacket(MysqlIO.java:3997) at com.mysql.jdbc.MysqlIO.sendCommand(MysqlIO.java:2468) at com.mysql.jdbc.MysqlIO.sqlQueryDirect(MysqlIO.java:2629) at com.mysql.jdbc.ConnectionImpl.execSQL(ConnectionImpl.java:2713) - locked <7f366a1c0> (a com.mysql.jdbc.JDBC4Connection) at com.mysql.jdbc.ConnectionImpl.configureClientCharacterSet(ConnectionImpl.java:1930) at com.mysql.jdbc.ConnectionImpl.initializePropsFromServer(ConnectionImpl.java:3571) at com.mysql.jdbc.ConnectionImpl.connectOneTryOnly(ConnectionImpl.java:2445) at com.mysql.jdbc.ConnectionImpl.createNewIO(ConnectionImpl.java:2215) - locked <7f366a1c0> (a com.mysql.jdbc.JDBC4Connection) at com.mysql.jdbc.ConnectionImpl.<init>(ConnectionImpl.java:813) at com.mysql.jdbc.JDBC4Connection.<init>(JDBC4Connection.java:47) at sun.reflect.GeneratedConstructorAccessor10.newInstance(Unknown Source) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27) at java.lang.reflect.Constructor.newInstance(Constructor.java:513) at com.mysql.jdbc.Util.handleNewInstance(Util.java:411) at com.mysql.jdbc.ConnectionImpl.getInstance(ConnectionImpl.java:399) at com.mysql.jdbc.NonRegisteringDriver.connect(NonRegisteringDriver.java:334) at org.apache.tomcat.jdbc.pool.PooledConnection.connectUsingDriver(PooledConnection.java:278) at org.apache.tomcat.jdbc.pool.PooledConnection.connect(PooledConnection.java:182) at org.apache.tomcat.jdbc.pool.ConnectionPool.createConnection(ConnectionPool.java:699) at org.apache.tomcat.jdbc.pool.ConnectionPool.borrowConnection(ConnectionPool.java:631) at org.apache.tomcat.jdbc.pool.ConnectionPool.init(ConnectionPool.java:485) at org.apache.tomcat.jdbc.pool.ConnectionPool.<init>(ConnectionPool.java:143) at org.apache.tomcat.jdbc.pool.DataSourceProxy.pCreatePool(DataSourceProxy.java:116) - locked <7f34f0dc8> (a org.apache.tomcat.jdbc.pool.DataSource) at org.apache.tomcat.jdbc.pool.DataSourceProxy.createPool(DataSourceProxy.java:103) at org.apache.tomcat.jdbc.pool.DataSourceFactory.createDataSource(DataSourceFactory.java:539) at org.apache.tomcat.jdbc.pool.DataSourceFactory.getObjectInstance(DataSourceFactory.java:237) at org.apache.naming.factory.ResourceFactory.getObjectInstance(ResourceFactory.java:143) at javax.naming.spi.NamingManager.getObjectInstance(NamingManager.java:304) at org.apache.naming.NamingContext.lookup(NamingContext.java:843) at org.apache.naming.NamingContext.lookup(NamingContext.java:154) at org.apache.naming.NamingContext.lookup(NamingContext.java:831) at org.apache.naming.NamingContext.lookup(NamingContext.java:168) at org.apache.catalina.core.NamingContextListener.addResource(NamingContextListener.java:1061) at org.apache.catalina.core.NamingContextListener.createNamingContext(NamingContextListener.java:671) at org.apache.catalina.core.NamingContextListener.lifecycleEvent(NamingContextListener.java:270) at org.apache.catalina.util.LifecycleSupport.fireLifecycleEvent(LifecycleSupport.java:119) at org.apache.catalina.util.LifecycleBase.fireLifecycleEvent(LifecycleBase.java:90) at org.apache.catalina.core.StandardContext.startInternal(StandardContext.java:5173) - locked <7f46b07f0> (a org.apache.catalina.core.StandardContext) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) - locked <7f46b07f0> (a org.apache.catalina.core.StandardContext) at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1559) at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1549) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:680) "Catalina-startStop-1" daemon prio=5 tid=7fa4b7a5e800 nid=0x10d568000 waiting on condition [10d567000] java.lang.Thread.State: WAITING (parking) at sun.misc.Unsafe.park(Native Method) - parking to wait for <7f480e970> (a java.util.concurrent.FutureTask$Sync) at java.util.concurrent.locks.LockSupport.park(LockSupport.java:156) at java.util.concurrent.locks.AbstractQueuedSynchronizer.parkAndCheckInterrupt(AbstractQueuedSynchronizer.java:811) at java.util.concurrent.locks.AbstractQueuedSynchronizer.doAcquireSharedInterruptibly(AbstractQueuedSynchronizer.java:969) at java.util.concurrent.locks.AbstractQueuedSynchronizer.acquireSharedInterruptibly(AbstractQueuedSynchronizer.java:1281) at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:218) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at org.apache.catalina.core.ContainerBase.startInternal(ContainerBase.java:1123) - locked <7f453c630> (a org.apache.catalina.core.StandardHost) at org.apache.catalina.core.StandardHost.startInternal(StandardHost.java:800) - locked <7f453c630> (a org.apache.catalina.core.StandardHost) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) - locked <7f453c630> (a org.apache.catalina.core.StandardHost) at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1559) at org.apache.catalina.core.ContainerBase$StartChild.call(ContainerBase.java:1549) at java.util.concurrent.FutureTask$Sync.innerRun(FutureTask.java:303) at java.util.concurrent.FutureTask.run(FutureTask.java:138) at java.util.concurrent.ThreadPoolExecutor$Worker.runTask(ThreadPoolExecutor.java:886) at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:908) at java.lang.Thread.run(Thread.java:680) "GC Daemon" daemon prio=2 tid=7fa4b9912800 nid=0x10d465000 in Object.wait() [10d464000] java.lang.Thread.State: TIMED_WAITING (on object monitor) at java.lang.Object.wait(Native Method) - waiting on <7f4506d28> (a sun.misc.GC$LatencyLock) at sun.misc.GC$Daemon.run(GC.java:100) - locked <7f4506d28> (a sun.misc.GC$LatencyLock) "Low Memory Detector" daemon prio=5 tid=7fa4b480b800 nid=0x10c8ae000 runnable [00000000] java.lang.Thread.State: RUNNABLE "C2 CompilerThread1" daemon prio=9 tid=7fa4b480b000 nid=0x10c7ab000 waiting on condition [00000000] java.lang.Thread.State: RUNNABLE "C2 CompilerThread0" daemon prio=9 tid=7fa4b480a000 nid=0x10c6a8000 waiting on condition [00000000] java.lang.Thread.State: RUNNABLE "Signal Dispatcher" daemon prio=9 tid=7fa4b4809800 nid=0x10c5a5000 runnable [00000000] java.lang.Thread.State: RUNNABLE "Surrogate Locker Thread (Concurrent GC)" daemon prio=5 tid=7fa4b4808800 nid=0x10c4a2000 waiting on condition [00000000] java.lang.Thread.State: RUNNABLE "Finalizer" daemon prio=8 tid=7fa4b793f000 nid=0x10c297000 in Object.wait() [10c296000] java.lang.Thread.State: WAITING (on object monitor) at java.lang.Object.wait(Native Method) - waiting on <7f451c8f0> (a java.lang.ref.ReferenceQueue$Lock) at java.lang.ref.ReferenceQueue.remove(ReferenceQueue.java:118) - locked <7f451c8f0> (a java.lang.ref.ReferenceQueue$Lock) at java.lang.ref.ReferenceQueue.remove(ReferenceQueue.java:134) at java.lang.ref.Finalizer$FinalizerThread.run(Finalizer.java:159) "Reference Handler" daemon prio=10 tid=7fa4b793e000 nid=0x10c194000 in Object.wait() [10c193000] java.lang.Thread.State: WAITING (on object monitor) at java.lang.Object.wait(Native Method) - waiting on <7f452e168> (a java.lang.ref.Reference$Lock) at java.lang.Object.wait(Object.java:485) at java.lang.ref.Reference$ReferenceHandler.run(Reference.java:116) - locked <7f452e168> (a java.lang.ref.Reference$Lock) "main" prio=5 tid=7fa4b7800800 nid=0x104329000 waiting on condition [104327000] java.lang.Thread.State: WAITING (parking) at sun.misc.Unsafe.park(Native Method) - parking to wait for <7f480e9a0> (a java.util.concurrent.FutureTask$Sync) at java.util.concurrent.locks.LockSupport.park(LockSupport.java:156) at java.util.concurrent.locks.AbstractQueuedSynchronizer.parkAndCheckInterrupt(AbstractQueuedSynchronizer.java:811) at java.util.concurrent.locks.AbstractQueuedSynchronizer.doAcquireSharedInterruptibly(AbstractQueuedSynchronizer.java:969) at java.util.concurrent.locks.AbstractQueuedSynchronizer.acquireSharedInterruptibly(AbstractQueuedSynchronizer.java:1281) at java.util.concurrent.FutureTask$Sync.innerGet(FutureTask.java:218) at java.util.concurrent.FutureTask.get(FutureTask.java:83) at org.apache.catalina.core.ContainerBase.startInternal(ContainerBase.java:1123) - locked <7f451fd90> (a org.apache.catalina.core.StandardEngine) at org.apache.catalina.core.StandardEngine.startInternal(StandardEngine.java:302) - locked <7f451fd90> (a org.apache.catalina.core.StandardEngine) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) - locked <7f451fd90> (a org.apache.catalina.core.StandardEngine) at org.apache.catalina.core.StandardService.startInternal(StandardService.java:443) - locked <7f451fd90> (a org.apache.catalina.core.StandardEngine) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) - locked <7f453e810> (a org.apache.catalina.core.StandardService) at org.apache.catalina.core.StandardServer.startInternal(StandardServer.java:732) - locked <7f4506d58> (a [Lorg.apache.catalina.Service;) at org.apache.catalina.util.LifecycleBase.start(LifecycleBase.java:150) - locked <7f44f7ba0> (a org.apache.catalina.core.StandardServer) at org.apache.catalina.startup.Catalina.start(Catalina.java:684) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:322) at org.apache.catalina.startup.Bootstrap.main(Bootstrap.java:451) "VM Thread" prio=9 tid=7fa4b7939800 nid=0x10c091000 runnable "Gang worker#0 (Parallel GC Threads)" prio=9 tid=7fa4b7802000 nid=0x10772b000 runnable "Gang worker#1 (Parallel GC Threads)" prio=9 tid=7fa4b7802800 nid=0x10782e000 runnable "Gang worker#2 (Parallel GC Threads)" prio=9 tid=7fa4b7803000 nid=0x107931000 runnable "Gang worker#3 (Parallel GC Threads)" prio=9 tid=7fa4b7804000 nid=0x107a34000 runnable "Gang worker#4 (Parallel GC Threads)" prio=9 tid=7fa4b7804800 nid=0x107b37000 runnable "Gang worker#5 (Parallel GC Threads)" prio=9 tid=7fa4b7805000 nid=0x107c3a000 runnable "Gang worker#6 (Parallel GC Threads)" prio=9 tid=7fa4b7805800 nid=0x107d3d000 runnable "Gang worker#7 (Parallel GC Threads)" prio=9 tid=7fa4b7806800 nid=0x107e40000 runnable "Concurrent Mark-Sweep GC Thread" prio=9 tid=7fa4b78e3800 nid=0x10bd0b000 runnable "Gang worker#0 (Parallel CMS Threads)" prio=9 tid=7fa4b78e2800 nid=0x10b305000 runnable "Gang worker#1 (Parallel CMS Threads)" prio=9 tid=7fa4b78e3000 nid=0x10b408000 runnable "VM Periodic Task Thread" prio=10 tid=7fa4b4815800 nid=0x10c9b1000 waiting on condition "Exception Catcher Thread" prio=10 tid=7fa4b7801800 nid=0x104554000 runnable JNI global references: 919 The only thing I can figure out from this is that it looks like the mysql jdbc drivers might have something to do with the long start up (the various stack traces I took during the start up process all pretty much look the same as this). Could anyone shed some light on what might be causing this? Have I done something dense in my context.xml? Is hibernate perhaps to blame?

    Read the article

  • Rsync Push files from linux to windoes. ssh issue - connection refused

    - by piyush c
    For some reason I want to run a script to move files from Linux machine to Windows. I have installed cwRsync on my windows machine and able to connect to linux machine. When i execute following command: rsync -e "ssh -l "piyush"" -Wgovz --timeout 120 --delay-updates --remove-sent-files /usr/local/src/piyush/sync/* "[email protected]:/cygdrive/d/temp" Where 10.0.0.60 is my widows machine and I am running above command on Linux - CentOS 5.5. After running command I get following error message: ssh: connect to host 10.0.0.60 port 22: Connection refused rsync: connection unexpectedly closed (0 bytes received so far) [sender] rsync error: error in rsync protocol data stream (code 12) at io.c(463) [sender=2.6.8] [root@localhost sync]# ssh [email protected] ssh: connect to host 10.0.0.60 port 22: Connection refused I have modified my firewall settings on widows to allow all ports. I think this issue is due to SSH Daemon not present on my windows machine. So I tried installing OpenSSH on my machine and running ssh-agent but didn't helped. I tried similar command to run on my widows machine to pull files from Linux and its working fine. For some reason I want command for Linux machine so that I can embed it in a shell script. Can you suggest me if I am missing anything. I am already having cwRsync installed on my widows and running it in daemon mode using --damemon option. And I am able to login using ssh from windows machine to linux machine. When I issue bellow command, it just blocks for 120 seconds (timeout I specified in command) and exits saying there is timeout. rsync -e "ssh -l piyush" -Wgovz --timeout 120 --delay-updates --remove-sent-files /usr/local/src/piyush/sync/* "[email protected]:/cygdrive/d/temp" After starting rsync on widows, I checked, rsyc is running. And widows firewall setting are set to minimal, and on Linux machine stopped iptables service so that port 873 (default rsync port) is not blocked. What can be the possible reason that Linux machine is not able to connect to rsync-daemon on windows machine?

    Read the article

  • Postfix installation error on Ubuntu

    - by kgpdeveloper
    How do I fix this error on Ubuntu 10.04 ? Reading package lists... Done Building dependency tree Reading state information... Done postfix is already the newest version. The following packages were automatically installed and are no longer required: libaprutil1-dbd-sqlite3 libcap2 apache2.2-bin libapr1 libaprutil1-ldap libaprutil1 php5-common Use 'apt-get autoremove' to remove them. 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 1 not fully installed or removed. After this operation, 0B of additional disk space will be used. Setting up postfix (2.7.0-1) ... Postfix configuration was not changed. If you need to make changes, edit /etc/postfix/main.cf (and others) as needed. To view Postfix configuration values, see postconf(1). After modifying main.cf, be sure to run '/etc/init.d/postfix reload'. Running newaliases newaliases: warning: valid_hostname: numeric hostname: 202002 newaliases: fatal: file /etc/postfix/main.cf: parameter myhostname: bad parameter value: 202002 dpkg: error processing postfix (--configure): subprocess installed post-installation script returned error exit status 75 Processing triggers for libc-bin ... ldconfig deferred processing now taking place Errors were encountered while processing: postfix E: Sub-process /usr/bin/dpkg returned an error code (1) Even if I reboot, the same error shows up. Thanks for the help..

    Read the article

  • Ubuntu 12.4 compiz - disable all compiz plugin - empty screen

    - by gotqn
    A friend of mine has installed on my new machine Ubuntu 10.4 (I have always been windows user and have no experience with Linux). I started to watch some tutorial about how to make 'Rotated Cube' using 'Compiz',but the cube appears in the form of a list (only two slides). I have thought this could be result of my video cards (only two - one from the processor and one from the motherboard) and they can not support this options. Anyway, I have decided to disable all compiz plugins and options because my friend has set some, and I started to think there is some misunderstanding between the plugins. After, that I got only empty screen(no menu, no icons, anything) and can do nothing. How to fix this? EDIT: When I remove the compiz stuffs (from the console), the menu is shown again. Then I install the compiz again (some of the effect are still not working). After restart or log out/in the menu is hidden again. I suppose that there are some settings that I've broken but they are saved somewhere in the system and remove the compiz do not deleted them and as a result they are activated after compiz is installed again and the PC is restarted?

    Read the article

  • run as dialog always pops up

    - by user12006
    I recently got some malware on a machine that I don't use for much (partly intentional). I've cleaned it, but now everytime I open any .exe the 'Run As' dialog pops up asking me which user I want to use to run the program. What causes this, and what's the fix for it? edit My process to remove the malware was as such: Disconnected from the network Deleted DisableTaskMgr reg key Inspected with Process Explorer and Task Manager and noticed that all applications were being run within another executable located in Documents and Settings...\Temp\Some.exe The system tray application was also in Documents and Settings...\Temp\SomeOther.exe I suspected that a service was in place as the system tray application would restart if it was killed, but couldn't find any service that I didn't recognize. Removed permissions from Some.exe and SomeOther.exe (on those files only) Restarted and deleted Some.exe and SomeOther.exe Deleted startup entries that were created Ran AVG Free and Windows Defender to remove anything else (they would be killed immediately before the two .exe's were removed) Cleaned registry via CCleaner note that system restores would finish saying something to the effect of 'couldn't restore system: there were no changes made'. I attempted to restore to a week ago, and I only got the malware yesterday.

    Read the article

  • org-sort multi: date/time (?d ?t) | priority (?p) | title (?a)

    - by lawlist
    Is anyone aware of an org-sort function / modification that can refile / organize a group of TODO so that it sorts them by three (3) criteria: first sort by due date, second sort by priority, and third sort by by title of the task? EDIT: I believe that org-sort by deadline (?d) has a bug that cannot properly handle undated tasks. I am working on a workaround (i.e., moving the undated todo to a different heading before the deadline (?d) sort occurs), but perhaps the best thing to do would be to try and fix the original sorting function. Development of the workaround can be found in this thread (i.e., moving the undated tasks to a different heading in one fell swoop): How to automate org-refile for multiple todo EDIT: Apparently, the following code (ancient history) that I found on the internet was eventually modified and included as a part of org-sort-entries. Unfortunately, undated todo are not properly sorted when sorting by deadline -- i.e., they are mixed in with the dated todo. ;; multiple sort (defun org-sort-multi (&rest sort-types) "Multiple sorts on a certain level of an outline tree, or plain list items. SORT-TYPES is a list where each entry is either a character or a cons pair (BOOL . CHAR), where BOOL is whether or not to sort case-sensitively, and CHAR is one of the characters defined in `org-sort-entries-or-items'. Entries are applied in back to front order. Example: To sort first by TODO status, then by priority, then by date, then alphabetically (case-sensitive) use the following call: (org-sort-multi '(?d ?p ?t (t . ?a)))" (interactive) (dolist (x (nreverse sort-types)) (when (char-valid-p x) (setq x (cons nil x))) (condition-case nil (org-sort-entries (car x) (cdr x)) (error nil)))) ;; sort current level (defun lawlist-sort (&rest sort-types) "Sort the current org level. SORT-TYPES is a list where each entry is either a character or a cons pair (BOOL . CHAR), where BOOL is whether or not to sort case-sensitively, and CHAR is one of the characters defined in `org-sort-entries-or-items'. Entries are applied in back to front order. Defaults to \"?o ?p\" which is sorted by TODO status, then by priority" (interactive) (when (equal mode-name "Org") (let ((sort-types (or sort-types (if (or (org-entry-get nil "TODO") (org-entry-get nil "PRIORITY")) '(?d ?t ?p) ;; date, time, priority '((nil . ?a)))))) (save-excursion (outline-up-heading 1) (let ((start (point)) end) (while (and (not (bobp)) (not (eobp)) (<= (point) start)) (condition-case nil (outline-forward-same-level 1) (error (outline-up-heading 1)))) (unless (> (point) start) (goto-char (point-max))) (setq end (point)) (goto-char start) (apply 'org-sort-multi sort-types) (goto-char end) (when (eobp) (forward-line -1)) (when (looking-at "^\\s-*$") ;; (delete-line) ) (goto-char start) ;; (dotimes (x ) (org-cycle)) ))))) EDIT: Here is a more modern version of multi-sort, which is likely based upon further development of the above-code: (defun org-sort-all () (interactive) (save-excursion (goto-char (point-min)) (while (re-search-forward "^\* " nil t) (goto-char (match-beginning 0)) (condition-case err (progn (org-sort-entries t ?a) (org-sort-entries t ?p) (org-sort-entries t ?o) (forward-line)) (error nil))) (goto-char (point-min)) (while (re-search-forward "\* PROJECT " nil t) (goto-char (line-beginning-position)) (ignore-errors (org-sort-entries t ?a) (org-sort-entries t ?p) (org-sort-entries t ?o)) (forward-line)))) EDIT: The best option will be to fix sorting of deadlines (?d) so that undated todo are moved to the bottom of the outline, instead of mixed in with the dated todo. Here is an excerpt from the current org.el included within Emacs Trunk (as of July 1, 2013): (defun org-sort (with-case) "Call `org-sort-entries', `org-table-sort-lines' or `org-sort-list'. Optional argument WITH-CASE means sort case-sensitively." (interactive "P") (cond ((org-at-table-p) (org-call-with-arg 'org-table-sort-lines with-case)) ((org-at-item-p) (org-call-with-arg 'org-sort-list with-case)) (t (org-call-with-arg 'org-sort-entries with-case)))) (defun org-sort-remove-invisible (s) (remove-text-properties 0 (length s) org-rm-props s) (while (string-match org-bracket-link-regexp s) (setq s (replace-match (if (match-end 2) (match-string 3 s) (match-string 1 s)) t t s))) s) (defvar org-priority-regexp) ; defined later in the file (defvar org-after-sorting-entries-or-items-hook nil "Hook that is run after a bunch of entries or items have been sorted. When children are sorted, the cursor is in the parent line when this hook gets called. When a region or a plain list is sorted, the cursor will be in the first entry of the sorted region/list.") (defun org-sort-entries (&optional with-case sorting-type getkey-func compare-func property) "Sort entries on a certain level of an outline tree. If there is an active region, the entries in the region are sorted. Else, if the cursor is before the first entry, sort the top-level items. Else, the children of the entry at point are sorted. Sorting can be alphabetically, numerically, by date/time as given by a time stamp, by a property or by priority. The command prompts for the sorting type unless it has been given to the function through the SORTING-TYPE argument, which needs to be a character, \(?n ?N ?a ?A ?t ?T ?s ?S ?d ?D ?p ?P ?o ?O ?r ?R ?f ?F). Here is the precise meaning of each character: n Numerically, by converting the beginning of the entry/item to a number. a Alphabetically, ignoring the TODO keyword and the priority, if any. o By order of TODO keywords. t By date/time, either the first active time stamp in the entry, or, if none exist, by the first inactive one. s By the scheduled date/time. d By deadline date/time. c By creation time, which is assumed to be the first inactive time stamp at the beginning of a line. p By priority according to the cookie. r By the value of a property. Capital letters will reverse the sort order. If the SORTING-TYPE is ?f or ?F, then GETKEY-FUNC specifies a function to be called with point at the beginning of the record. It must return either a string or a number that should serve as the sorting key for that record. Comparing entries ignores case by default. However, with an optional argument WITH-CASE, the sorting considers case as well." (interactive "P") (let ((case-func (if with-case 'identity 'downcase)) (cmstr ;; The clock marker is lost when using `sort-subr', let's ;; store the clocking string. (when (equal (marker-buffer org-clock-marker) (current-buffer)) (save-excursion (goto-char org-clock-marker) (looking-back "^.*") (match-string-no-properties 0)))) start beg end stars re re2 txt what tmp) ;; Find beginning and end of region to sort (cond ((org-region-active-p) ;; we will sort the region (setq end (region-end) what "region") (goto-char (region-beginning)) (if (not (org-at-heading-p)) (outline-next-heading)) (setq start (point))) ((or (org-at-heading-p) (condition-case nil (progn (org-back-to-heading) t) (error nil))) ;; we will sort the children of the current headline (org-back-to-heading) (setq start (point) end (progn (org-end-of-subtree t t) (or (bolp) (insert "\n")) (org-back-over-empty-lines) (point)) what "children") (goto-char start) (show-subtree) (outline-next-heading)) (t ;; we will sort the top-level entries in this file (goto-char (point-min)) (or (org-at-heading-p) (outline-next-heading)) (setq start (point)) (goto-char (point-max)) (beginning-of-line 1) (when (looking-at ".*?\\S-") ;; File ends in a non-white line (end-of-line 1) (insert "\n")) (setq end (point-max)) (setq what "top-level") (goto-char start) (show-all))) (setq beg (point)) (if (>= beg end) (error "Nothing to sort")) (looking-at "\\(\\*+\\)") (setq stars (match-string 1) re (concat "^" (regexp-quote stars) " +") re2 (concat "^" (regexp-quote (substring stars 0 -1)) "[ \t\n]") txt (buffer-substring beg end)) (if (not (equal (substring txt -1) "\n")) (setq txt (concat txt "\n"))) (if (and (not (equal stars "*")) (string-match re2 txt)) (error "Region to sort contains a level above the first entry")) (unless sorting-type (message "Sort %s: [a]lpha [n]umeric [p]riority p[r]operty todo[o]rder [f]unc [t]ime [s]cheduled [d]eadline [c]reated A/N/P/R/O/F/T/S/D/C means reversed:" what) (setq sorting-type (read-char-exclusive)) (and (= (downcase sorting-type) ?f) (setq getkey-func (org-icompleting-read "Sort using function: " obarray 'fboundp t nil nil)) (setq getkey-func (intern getkey-func))) (and (= (downcase sorting-type) ?r) (setq property (org-icompleting-read "Property: " (mapcar 'list (org-buffer-property-keys t)) nil t)))) (message "Sorting entries...") (save-restriction (narrow-to-region start end) (let ((dcst (downcase sorting-type)) (case-fold-search nil) (now (current-time))) (sort-subr (/= dcst sorting-type) ;; This function moves to the beginning character of the "record" to ;; be sorted. (lambda nil (if (re-search-forward re nil t) (goto-char (match-beginning 0)) (goto-char (point-max)))) ;; This function moves to the last character of the "record" being ;; sorted. (lambda nil (save-match-data (condition-case nil (outline-forward-same-level 1) (error (goto-char (point-max)))))) ;; This function returns the value that gets sorted against. (lambda nil (cond ((= dcst ?n) (if (looking-at org-complex-heading-regexp) (string-to-number (match-string 4)) nil)) ((= dcst ?a) (if (looking-at org-complex-heading-regexp) (funcall case-func (match-string 4)) nil)) ((= dcst ?t) (let ((end (save-excursion (outline-next-heading) (point)))) (if (or (re-search-forward org-ts-regexp end t) (re-search-forward org-ts-regexp-both end t)) (org-time-string-to-seconds (match-string 0)) (org-float-time now)))) ((= dcst ?c) (let ((end (save-excursion (outline-next-heading) (point)))) (if (re-search-forward (concat "^[ \t]*\\[" org-ts-regexp1 "\\]") end t) (org-time-string-to-seconds (match-string 0)) (org-float-time now)))) ((= dcst ?s) (let ((end (save-excursion (outline-next-heading) (point)))) (if (re-search-forward org-scheduled-time-regexp end t) (org-time-string-to-seconds (match-string 1)) (org-float-time now)))) ((= dcst ?d) (let ((end (save-excursion (outline-next-heading) (point)))) (if (re-search-forward org-deadline-time-regexp end t) (org-time-string-to-seconds (match-string 1)) (org-float-time now)))) ((= dcst ?p) (if (re-search-forward org-priority-regexp (point-at-eol) t) (string-to-char (match-string 2)) org-default-priority)) ((= dcst ?r) (or (org-entry-get nil property) "")) ((= dcst ?o) (if (looking-at org-complex-heading-regexp) (- 9999 (length (member (match-string 2) org-todo-keywords-1))))) ((= dcst ?f) (if getkey-func (progn (setq tmp (funcall getkey-func)) (if (stringp tmp) (setq tmp (funcall case-func tmp))) tmp) (error "Invalid key function `%s'" getkey-func))) (t (error "Invalid sorting type `%c'" sorting-type)))) nil (cond ((= dcst ?a) 'string<) ((= dcst ?f) compare-func) ((member dcst '(?p ?t ?s ?d ?c)) '<))))) (run-hooks 'org-after-sorting-entries-or-items-hook) ;; Reset the clock marker if needed (when cmstr (save-excursion (goto-char start) (search-forward cmstr nil t) (move-marker org-clock-marker (point)))) (message "Sorting entries...done"))) (defun org-do-sort (table what &optional with-case sorting-type) "Sort TABLE of WHAT according to SORTING-TYPE. The user will be prompted for the SORTING-TYPE if the call to this function does not specify it. WHAT is only for the prompt, to indicate what is being sorted. The sorting key will be extracted from the car of the elements of the table. If WITH-CASE is non-nil, the sorting will be case-sensitive." (unless sorting-type (message "Sort %s: [a]lphabetic, [n]umeric, [t]ime. A/N/T means reversed:" what) (setq sorting-type (read-char-exclusive))) (let ((dcst (downcase sorting-type)) extractfun comparefun) ;; Define the appropriate functions (cond ((= dcst ?n) (setq extractfun 'string-to-number comparefun (if (= dcst sorting-type) '< '>))) ((= dcst ?a) (setq extractfun (if with-case (lambda(x) (org-sort-remove-invisible x)) (lambda(x) (downcase (org-sort-remove-invisible x)))) comparefun (if (= dcst sorting-type) 'string< (lambda (a b) (and (not (string< a b)) (not (string= a b))))))) ((= dcst ?t) (setq extractfun (lambda (x) (if (or (string-match org-ts-regexp x) (string-match org-ts-regexp-both x)) (org-float-time (org-time-string-to-time (match-string 0 x))) 0)) comparefun (if (= dcst sorting-type) '< '>))) (t (error "Invalid sorting type `%c'" sorting-type))) (sort (mapcar (lambda (x) (cons (funcall extractfun (car x)) (cdr x))) table) (lambda (a b) (funcall comparefun (car a) (car b))))))

    Read the article

  • Weird .#filename files on remote ssh-connected systems after mcedit

    - by etranger
    I'm using MacFusion sshfs in combination with Midnight Commander, and when I edit remote text files with mcedit, weird symlinks are created on the remote system. $ ls -l .* lrwxr-xr-x 1 user group 34 Jun 27 01:54 .#filename.txt -> [email protected] where etranger is my local login name, and mbp is a hostname of my notebook running MacOS. symlinks can be removed by running remote rm command, but cannot be deleted on the mac-fuse mounted volume and thus pollutes the filesystem. I cannot figure what part of software is responsible for this, and how I could fix this, any help is appreciated. EDIT: This appears to be mcedit behavior as documented here: https://dev.openwrt.org/ticket/8245 Apparently, sshfs fails to remove symlink to the lock file for some reason (".#" in filename, perhaps), and it pollutes the filesystem. A quick workaround is possible, using another bug of Midnight Commander: editing (F4) the broken symlink effectively converts it to a missing lock file it was supposed to point to, and removes the symlink itself. The newly created file may then be deleted normally. EDIT 2: Unchecking "Follow symlink" in MacFusion apparently allows sshfs to remove dead symlinks, so the problem disappears completely.

    Read the article

  • Windows 7 DHCP Default Gateway not Overridden by manual Default Gateway

    - by dgwilson
    We have recently installed Windows 7 for student computers. All student computers must be routed through our content filter which is located at 192.168.0.63. This was done in WinXP by adding a Default Gateway in the network adapter settings TCP/IP Properties Advanced Default Gateway. All teacher computers are routed through the DHCP assigned Default Gateway of 192.168.0.1. In WinXP the dhcp default gateway was correctly overridden by this manual setting. In Win7 it appears that the dhcp default gateway is retained and the manual one is added to the list so that there are two with the dhcp one having the primary metric. I have tried several ways to remove the dhcp default gateway such as, running the "route delete 0.0.0.0 192.168.0.1" command. Doing this from an administrator command prompt works but it just resets upon reboot. I've tried adding this command to the registry's Run section but it seems to run as a non-administrator and therefore will not complete successfully. Is there any way to prevent this and force the manual default gateway to override the dhcp one? Or to remove the dhcp assigned one automatically on boot/login? HELP! We CANNOT allow student computers to connect to the internet without going through the content filter.

    Read the article

  • Windows 7 DHCP Default Gateway not Overridden by manual Default Gateway

    - by dgwilson
    We have recently installed Windows 7 for student computers. All student computers must be routed through our content filter which is located at 192.168.0.63. This was done in WinXP by adding a Default Gateway in the network adapter settings TCP/IP Properties Advanced Default Gateway. All teacher computers are routed through the DHCP assigned Default Gateway of 192.168.0.1. In WinXP the dhcp default gateway was correctly overridden by this manual setting. In Win7 it appears that the dhcp default gateway is retained and the manual one is added to the list so that there are two with the dhcp one having the primary metric. I have tried several ways to remove the dhcp default gateway such as, running the "route delete 0.0.0.0 192.168.0.1" command. Doing this from an administrator command prompt works but it just resets upon reboot. I've tried adding this command to the registry's Run section but it seems to run as a non-administrator and therefore will not complete successfully. Is there any way to prevent this and force the manual default gateway to override the dhcp one? Or to remove the dhcp assigned one automatically on boot/login? HELP! We CANNOT allow student computers to connect to the internet without going through the content filter.

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Make dhcp assign same IP and hostname for different interfaces at one machine

    - by Egeshi
    I have a feeling that question itself looks stupid but it is not. Please let me clarify. I have dynamic DNS with BIND and NIS configured at my LAN and have laptop which I am using in both wireless and wired mode. I mean that sometimes I have to use wired interface to achieve higher throughput but most of time I don't need it and using wireless mode. Everything works great. Issue is that I want both interfaces get same IP from DHCP. Just for convenient firewall setup. If I add both hosts to dhcp in this manner # bt wireless host bt { hardware ethernet 00:1f:1f:62:60:28; fixed-address 172.16.77.110; } # bt wired host bt { hardware ethernet 00:14:22:b7:5a:de; fixed-address 172.16.77.110; } DHCP says logs following message dhcpd: Dynamic and static leases present for 172.16.77.110 dhcpd: Remove host declaration bt-wired or remove 172.16.77.110 dhcpd: from the dynamic address pool for 172.16/16 Host records are added outside of any subnet, but it makes no difference if I put them there, effect is still the same. This is not critical but either is not my whim because even if DHCP seems to work fine for that "bt" host, I cannot make connection TO it from remote machine anymore with this definitely incorrect DHCP config. I'd be thankful if one spares a minute for advice about how to configure DHCPD correctly. UPDATE. I realize that there's a soulution to assign different hostname in DHCP config but would like to use benefits of short host names.

    Read the article

  • Installing MySQL 5.1 on OS X 10.7 Lion

    - by xisal
    I am trying to install MySQL 5.1. I am on Lion, and when I remove all files associated with MySQL on my machine it still tells me that I have a newer version installed when I try to install it from the DMG file. Has anyone successfully installed MySQL 5.1 on Lion? I found a solution using Homebrew: Completely remove MySQL from your system (just in case) sudo rm /usr/local/mysql sudo rm -rf /usr/local/mysql* sudo rm -rf /Library/StartupItems/MySQLCOM sudo rm -rf /Library/PreferencePanes/My* vim /etc/hostconfig and removed the line MYSQLCOM=-YES- rm -rf ~/Library/PreferencePanes/My* sudo rm -rf /Library/Receipts/mysql* sudo rm -rf /Library/Receipts/MySQL* sudo rm -rf /var/db/receipts/com.mysql.* Source:http://stackoverflow.com/questions/1436425/how-do-you-uninstall-mysql-from-mac-os-x Install homebrew /usr/bin/ruby -e "$(curl -fsSL https://raw.github.com/gist/323731)" Source: https://github.com/mxcl/homebrew/wiki/installation Install MySQL 5.1 via brew brew install mysql51 if that doesn't work, do this: brew install https://raw.github.com/adamv/homebrew-alt/master/versions/mysql51.rb Source: http://stackoverflow.com/questions/4359131/brew-install-mysql-on-mac-os/6399627#6399627 Make MySQL Work Create mysql.sock file touch /tmp/mysql.sock Install MySQL default tables /usr/local/Cellar/mysql51/5.1.58/bin/mysql_install_db ...or your path Source: http://stackoverflow.com/questions/4788381/getting-cant-connect-through-socket-tmp-mysql-when-installing-mysql-on-ma/5140849#5140849

    Read the article

  • Can't ping a DNS zone on windows server 2008 R2

    - by Roberto Fernandes
    I´ve just configured a windows server 2008 r2, but got a lot of problems on DNS role. Let me talk about the server configuration: name: fdserver IP address: 192.168.0.10 I have a DNS zone called "fd.local". This is my domain and it´s working ok. I´ve created a zone called fdserver, and inside this zone a record (A) with "*" as a host. because this is a webserver, i´ve configured apache so if you enter something like "site.fdserver" it will point you to the "site" folder. This is working ok ONLY inside the server. This server is a DNS server too... and have 3 entries: 192.168.0.10 (his own IP), 8.8.8.8 and 8.8.4.4 (google public DNS). Now start the problems... Most of the computers on my network, CAN join the domain without problems. But just CAN'T ping "something.fdserver". Now comes the strange thing... If I remove the twoo secondary entries on my DNS server (8.8.8.8 and 8.8.4.4), it obvious stop accessing websites (like microsoft.com), but now the computer CAN ping "something.fdserver". I don´t know If I explained correctly... and my English is terrible... but inside the server is all working as it supposed to work. But in the workstation machines, it work only if I remove the secondary DNS!! If you need any details, just ask! thanks!

    Read the article

  • Unable to create new virtual hosts using MAMP with OSX Mavericks

    - by user2961676
    I have been using virtual hosts on my Mac with MAMP, which has worked up until now. I have 2 working virtual hosts that i created in the same manner, which still work, but for some reason I am unable to create any new virtual hosts. When i attempt to go to a newly crated virtual host in my browser it generates a 404 Not Found error. The only thing i can think of possibly after i updated OSX to Mavericks, but i'm not sure what that would have done, or why the old virtual hosts still work. See excerpt below from vhosts.conf file. So, franklin.dev works, jamiepjones.dev works, but sheilahixson.dev does not. <VirtualHost *:80> DocumentRoot "/Users/jamiejones/Sites/franklin" ServerName franklin.dev ErrorLog "logs/franlkin.dev-error_log" CustomLog "logs/franklin.dev-access_log" common </VirtualHost> <VirtualHost *:80> DocumentRoot "/Users/jamiejones/Sites/jamiepjones-wp" ServerName jamiepjones.dev ErrorLog "logs/jamiepjones.dev-error_log" CustomLog "logs/jamiepjones.dev-access_log" common </VirtualHost> <VirtualHost *:80> DocumentRoot "/Users/jamiejones/Sites/sheilahixson” ServerName sheilahixson.dev ServerAlias www.sheilahixson.dev ErrorLog "logs/sheilahixson.dev-error_log" CustomLog "logs/sheilahixson.dev-access_log" common </VirtualHost> and hosts file: 127.0.0.1 localhost 255.255.255.255 broadcasthost ::1 localhost fe80::1%lo0 localhost 127.0.0.1 jamies-MacBook-Pro.Belkin # MAMP PRO - Do NOT remove this entry! 127.0.0.1 hixson # MAMP PRO - Do NOT remove this entry! 127.0.0.1 franklin.dev 127.0.0.1 jamiepjones.dev 127.0.0.1 sheilahixson.dev Please help!

    Read the article

  • CopSSH SFTP -- limit users access to their home directory only

    - by bradvido
    Let me preface this by saying I've read and followed these instructions at the FAQ many times: http://www.itefix.no/i2/node/37 It does not do what the title claims... It allows every user access to every other user's home directory, as well as access to all subfolders below the copssh installation path. I'm only using this for SFTP access and I need my users to be sandboxed into only their home directory. If you know a fool-proof way to lock users down so they can see only their home directory and its subfolders, stop reading now and reply with the solution. The details: Here is exactly what i tried as I followed the FAQ. My copSSH installation directory is: C:\Program Files\CopSSH net localgroup sftp_users /ADD **Create a user group to hold all my SFTP users cacls c:\ /c /e /t /d sftp_users **For that group, deny access at the top level and all levels below cacls "C:\Program Files\CopSSH" /c /e /t /r sftp_users **Allow my user group access to the copSSH installation directory and its subdirectories For each sftp user, I create a new windows user account, then I: net localgroup sftp_users sftp_user_1 /add **Add my user to the group I've created Open the activate user wizard for CopSSH, choosing the user, "/bin/sftponly" and Remove copssh home directory if it exists **Remains checked Create keys for public key authentication **Remains checked Create link to user's real home directory **Remains checked This works, however, every user has access to every other user's home directory as well as the CopSSH root directory.... So I tried denying access for all users to the user home directory: cacls "C:\Program Files\CopSSH\home" /c /e /t /d sftp_users **Deny access for users to the user home directory Then I tried adding permissions on a user-by-user basis for each users home\username folder. However,these permission were not allowed by windows because of the above deny rule i created at the home directory was being inherited and over-riding my allow rule. The next step for me would be to remove the deny rule at the home directory and for each user folder, add a deny rule for every user it doesn't belong to, and add an allow rule for the one user it does belong to. However, as my user list gets long, this will become very cumbersome. Thanks for the help!

    Read the article

  • Easy line break removal from text fields and/or selections

    - by AmV
    I'm looking for a tool that allows me to easily re-wrap text (i.e. remove line breaks, but not paragraph breaks from a text selection or the current text field that is being edited), and that works at least with text fields in my browser (Chrome) and on Windows. Bonus points for anything that works outside the browser, and that works in-place (i.e. that doesn't require copy-pasting the text through a separate window or using something like http://www.textfixer.com/tools/remove-line-breaks.php) Browser extensions, GreaseMonkey scripts or applications that also work on Linux and/or Mac (or even better, that are multi-platform) are all welcomed. Here is an example of how the tool should behave. If I have the following in a text field: This is a test for SuperUser.com. This is a test for SuperUser.com. This is a test for SuperUser.com. This is a test for SuperUser.com This is a test for SuperUser.com. This is a test for SuperUser.com. This is a test for SuperUser.com. This is a test for SuperUser.com I'd like to have an easy tool that allows me to, for example, select the text, and with a keyboard shortcut convert it to: This is a test for SuperUser.com. This is a test for SuperUser.com. This a test for SuperUser.com. This is a test for SuperUser.com This is a test for SuperUser.com. This is a test for SuperUser.com. This a test for SuperUser.com. This is a test for SuperUser.com Thanks in advance!

    Read the article

< Previous Page | 147 148 149 150 151 152 153 154 155 156 157 158  | Next Page >