Search Results

Search found 103782 results on 4152 pages for 'tath am'.

Page 154/4152 | < Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >

  • prepend to a file one liner shell?

    - by elmarco
    This is probably a complex solution. I am looking for a simple operator like "", but for prepending. I am afraid it does not exist. I'll have to do something like mv $F tmp cat header tmp $F Anything smarter? (I am not fond of tmp files)

    Read the article

  • Embedding a swf using fbml in a facebook app

    - by abhishekgupta92
    Hi, I am using FBML to embed a swf file into my facebook application, but it shows the message that movie is not loaded. The piece of code that I am using for this is: echo " < fb:swf imgstyle=\"border-width:3px; border-color:white;\" swfsrc='apsolute url of the .swf in the server where I am hosting' width='340' height='270' flashvars='' swfbgcolor='333333' wmode='opaque' /";

    Read the article

  • How to remove the error "Cant find PInvoke DLL SQLite.interop.dll"

    - by Shailesh Jaiswal
    I am developing windows mobile application. I am using the SQLlite database. I am using the following code to connect to this database as follows SQLiteConnection cn = new SQLiteConnection(); SQLiteDataReader SQLiteDR; cn.ConnectionString = @"Data Source=F:\CompNetDB.db3"; cn.Open(); SQLiteCommand cmd = new SQLiteCommand(); cmd.CommandText = "select * from CustomerInfo"; cmd.CommandType = CommandType.Text; cmd.Connection = cn; SQLiteDR = cmd.ExecuteReader(); In the above case I am getting the error "Cant find PInvike DLL SQLite.interop.dll". I have added the DLL System.Data.SQLLite from the \SQLite.NET\bin\compactframework this folder. This is the folder which is installed by default when I installed the SQLite. In the same folder there is one DLL file named SQLlite.Interop.66.DLL. When I try to add reference to this dll it is giving error that dll can not be added. Are the two dlls SQLlite.Interop.dll & System.Interop.066.dll same ? In the above code how to solve the error "Cant find PInvoke.SQLite.Interop.dll" Please can you tell whether there is mistake in my code or I am missing something in my application?

    Read the article

  • How to get the sending email address from outlook 2007

    - by Naresh
    I am working on outlook add-in project using Visual studio 2008 for MS Outlook 2007 in C#. Here I am explaining my problem... I got multiple accounts (3 Accounts) with my outlook 2007. I need to get accounts form Account box in New Mail Message window. When we click New Mail Message, a new window will appear from which we can send a new mail. Here (On this window) we can see Account Dropdown (Left side) under the Send Button. If we have multiple accounts with outlook, we can see all the accounts in Account Drop Down if we click on Account Box. If we click on the particular email, a right mark will appear to that Email Account and a message can bee seen on the top of the Send button is "This message will be sent via [email protected]". So, I want to get these email accounts into a string and that particular email account (which has right mark) into another string. I got these 3 email accounts into a string. But, I am not getting the particular email account(which has the right mark when we send a new email). I am using this code.... using Outlook = Microsoft.Office.Interop.Outlook; using Office = Microsoft.Office.Core; using Microsoft.Office.Interop.Outlook; Outlook._Application myOutlookApp = new Outlook.Application(); Outlook.Accounts myAccounts = myOutlookApp.Session.Accounts; foreach (Outlook.Account account in myAccounts) { string emailAddress = account.SmtpAddress; } I am able to get all the accounts from the above code..But, I just want to get the email address which we will use for sending an email at that particular moment..

    Read the article

  • Skip sanitization for videos in html5lib

    - by pug
    I am using a wmd-editor in django, much like this one in which I am typing. I would like to allow the users to embed videos in it. For that I am using the Markdown video extension here. The problem is that I am also sanitizing user input using html5lib sanitization and it doesn't allow object tags which are required to embed the videos. One solution could be to check the input for urls of well-known video sites and skip the sanitization in those cases. Is there a better solution?

    Read the article

  • Sanitizing incoming XML via WCF

    - by Clark
    I am consuming a Java webservice from .net using WCF. I am getting an error on deserialization of a response from the Java service The byte 0x00 is not valid at this location. Line 1, position 725. I know from some research that this is an incorrectly encoded null, but I am unlikely to get the provider to change it, so I would like to sanitize the null out before WCF deserializes the return message. Any Ideas? I am using c#, but answers in any CLR language will do.

    Read the article

  • Convert String to java.util.Date

    - by Vinayak.B
    Hi Folks, I storing the date to SQLite database in the format d-MMM-yyyy,HH:mm:ss aaa And again retrieving it with the same format, the problem now is, I am gettin every thing fine exepth the Hour. Hour I am geting 00 every time, Here the print statement String date--->29-Apr-2010,13:00:14 PM After convrting Date--->1272479414000--Thu Apr 29 00:00:14 GMT+05:30 2010 Please where I am doing wrong. Cheers, Vinayak

    Read the article

  • SQL Query with ORDER BY Part 2

    - by Brett
    Hi SQL'ers, This is a followup question to: SQL Query with ORDER BY But I think the SQL logic is going to be quite different, so I am posting it as separate question. I am trying to extend my sql SELECT query it and having some trouble: I have the table: id type radius ------------------------- 1 type1 0.25 2 type2 0.59 3 type1 0.26 4 type1 0.78 5 type3 0.12 6 type2 0.45 7 type3 0.22 8 type3 0.98 and I am trying to learn how to SELECT the second smallest radius for each given type. So the returned recordset should look like: id type radius ------------------------- 3 type1 0.26 2 type2 0.59 7 type3 0.22 (Note: in the referenced question, I was looking for the lowest radius, not the second lowest radius). I am assuming I have to use LIMIT and OFFSET, but if I use the MIN() won't that return a distinct record containing the minimum radius? Does anyone have any thoughts on how to attack this? Many thanks, Brett

    Read the article

  • Unable to import nltk in NetBeans

    - by afs
    Hello all, I am trying to import NLTK in my python code and I get this error: Traceback (most recent call last): File "/home/afs/NetBeansProjects/NER/getNE_followers.py", line 7, in import nltk ImportError: No module named nltk I am using NetBeans: 6.7.1, Python 2.6 NLTK. My NLTK module is installed in /usr/local/lib/python2.6/dist-packages/nltk/ and I have added this in Python paths in Netbeans. What am I missing here? Thanks in advance.

    Read the article

  • What this Url ending means .....&123 ?

    - by simple
    Hey I am having some issues while using Nggalley plugin for wordpress the plugin makes use of a JW player and JW player needs an XML - so it requests link like this http://nextgen-gallery.com/index.php?callback=imagerotator&gid=1&149 The lay &xxx really creaps me out couse I am using it for joomla and joomla doesn't like this I am assuming that this has to do with wordpress but still unsure. what does this ending of URL really mean? PS. I would never ever use wordpress plugin in joomla but my client uses and I have to fix it

    Read the article

  • Managing Lotus Notes Mail Format using C#

    - by Pari
    Hi, I am accessing mail body and fetching it in another mail. But i am not getting original format of previous mail in new mail. Problem i am facing in this situation are: Not getting images in destination mail. Font is also varying. I am accessing mail body as follows: NotesRichTextItem rtItem = (NotesRichTextItem)docInbox.GetFirstItem("Body"); String Body = rtItem.GetFormattedText(false , 0); String bodyFormat = rtItem.type.ToString(); also tried this code: NotesItem itemBody = docInbox.GetFirstItem("Body"); String bodyFormat = itemBody.type.ToString(); String Body = itemBody.Text; But not getting solution in both case.

    Read the article

  • Calling via adb in Power shell

    - by Imran Nasir
    As you may know, the command for calling via adb is: .\adb.exe shell am start -a android.intent.action.CALL tel:"656565" This works well but when I use textbox, it takes garbage value... .\adb.exe shell am start -a android.intent.action.CALL tel:$textbox1.Text I have tried this also but failed $button21_Click={ #TODO: Place custom script here $textbox1.Clear .\adb.exe shell am start -a android.intent.action.CALL tel:$textbox1.Text } Please help

    Read the article

  • Paypal Payflow Link ASP.Net MVC Open Source Framework

    - by runxc1 Bret Ferrier
    I am looking at creating a site using ASP.Net MVC which of coarse has a paid membership option and needs to allow recuring payments via Paypal. I am thinking of using Paypals Payflow Link as the site will be fairly small. I am looking for an Open Source example or Framework that I can use with Payflow Link. Are there any good .Net Frameworks that only handle the payment system. The rest of the app will be custom app.

    Read the article

  • Zend: How to authenticate using OpenId on local server.

    - by NAVEED
    I am using zend framework. Now I want to authenticate users with other already registered accounts using RPX. I am following the 3 steps as described at RPX site: 1- Get the Widget 2- Receive Tokens 3- Choose Providers I created a controller(person) and action(signin) to show widget and my own signin form. When following action (http://test.dev/#person/personsignin) is called then my own login form and widget is shown successfully. # is used in above URL for AJAX indication. public function personsigninAction() { $this->view->jsonEncoded = true; // Person Signin Form $PersonSigninForm = new Form_PersonSignin(); $this->view->PersonSigninForm = $PersonSigninForm; $this->view->PersonSigninForm->setAction( $this->view->url() ); $request = $this->getRequest(); if ( $request->isPost() ) { } } There are two problems while login using openid widget: When I am authenticated from outside(for example: Yahoo) then I am redirected to http://test.dev, therefor indexAction in called in indexController and home page is shown. I want to redirect to http://test.dev/#person/personsignin after authentication and want to set session in isPost() condition of personsigninAction() (described above). For now I consider indexAction to be called when outside authentication is done. Now I posted the code from http://gist.github.com/291396 in indexAction to follow step 3 mentioned above. But it is giving me following error: An error occured: Invalid parameter: apiKey Am I using the right way to use this. This is my very first attempt to this stuff. Can someone tell me the exact steps using my above actions? Thanks.

    Read the article

  • Problem in calling Excel function

    - by Newbie
    I am facing a problem while making Excel's LinEST function. My program goes like MyExcel.Application xl = new MyExcel.Application(); MyExcel.WorksheetFunction wsf = xl.WorksheetFunction; List<int> x = new List<int> { 1, 2, 3, 4 }; List<int> y = new List<int> { 11, 12, 45, 42 }; object o = wsf.LinEst(x, y, true, true); And the namespace is using MyExcel = Microsoft.Office.Interop.Excel; The program is compiling smoothly but at runtime it is throwing an error {System.Runtime.InteropServices.COMException (0x80020005): Type mismatch. (Exception from HRESULT: 0x80020005 (DISP_E_TYPEMISMATCH)) Actually this is the first time I am using Excel function .. so I am unable to proceed further. If any one has run thru this kind of situation and has solved, please help me. I am using C# 3.0 Thanks

    Read the article

  • Java Junit testing problem

    - by agazerboy
    Hi All, I am using Junit 4. My whole program is working fine. I am trying to write a test case. But there is one error... here is very basic sample test public class di extends TestCase{ private static Records testRec; public void testAbc() { Assert.assertTrue( "There should be some thing.", di.testRec.getEmployee() > 0); } } and when i run this it give me error that fName can not be null if i use super and do like this public TestAgnes() { super("testAbc"); } it work all fine. It wasn't this before with JUnit 3.X am I doing wrong or they changed it :( Sorry if I am not clear Is there any way to executre test without super? or calling functions etc. ?

    Read the article

  • How to use variables with regex?

    - by dontoo
    This is the input string: 23x^45*y or 2x^2 or y^4*x^3. I am matching ^[0-9]+ after letter x. In other words I am matching x followed by ^ followed by numbers. Problem is that I don't know that I am matching x, it could be any letter that I stored as variable in my char array. For example: foreach (char cEle in myarray) // cEle is letter in char array x, y, z, ... { match CEle in regex(input) //PSEUDOCODE } I am new to regex and I new that this can be done if I define regex variables, but I don't know how.

    Read the article

  • ssL HTTPS for windows mobile 6::unable to read transport connection

    - by Santhosh
    Hi am trying Https ssl connection in my C# application...i am getting "Unable to read transport connection" for the line WebResponse response = (HttpWebResponse)request.GetResponse(); I am forcing Certificate to be accepted ServicePointManager.CertificatePolicy = new MyPolicy(); public class MyPolicy : ICertificatePolicy { public bool CheckValidationResult(ServicePoint sp, X509Certificate cert, WebRequest req, int problem) { return true; } } Working fine in WM5 may i plz know the wat is goin wrong?plz thanks in advance

    Read the article

  • Unable to add a trac repository to mylyn in eclipse

    - by user592748
    Trac is running on a server on port 8002. With tunneling, I am able to access Trac on my machine using localhost:8002. I am able to login, create tickets using my browser. I want to integrate this trac project with Mylyn in Eclipse. I have installed mylyn with the Trac connector. I try adding task repositories in eclipse. I am able to successfully validate the settings, however, I am not able to add it as a task repository. Any help appreciated.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Winform radiobutton data binding

    - by Rajarshi
    I am following the "Presentation Model" design pattern suggested by Martin Fowler for my GUI architecture in a Windows Forms project. "The essence of a Presentation Model is of a fully self-contained class that represents all the data and behavior of the UI window, but without any of the controls used to render that UI on the screen. A view then simply projects the state of the presentation model onto the glass...." - Martin Fowler Read more about this pattern at www.martinfowler.com/eaaDev/PresentationModel.html I am finding the concept very fluid and easy to understand except this one issue of data binding RadioButtons to properties on the Data/Domain object. Suposing I have a Windows Form with 3 radio buttons to depict some "Mode" options as - Auto Manual Import How can I use boolean properties on Data/Domain Objects to DataBind to these buttons? I have tried many ways but to no avail. For example I would like to code like - rbtnAutoMode.DataBindings.Add("Text", myBusinessObject, "IsAutoMode"); rbtnManualMode.DataBindings.Add("Text", myBusinessObject, "IsManualMode"); rbtnImportMode.DataBindings.Add("Text", myBusinessObject, "IsImportMode"); There should be a fourth property like "SelectedMode" on the data/domain object which at the end should depict a single value like "SelectedMode = Auto". I am trying to update this property when any of the "IsAutoMode", "IsManualMode" or "IsImportMode" is changed, e.g. through the property setters. I have INotifyPropertyChanged implemented on my data/domain object so, updating any data/domain object property automatically updates my UI controls, that's not an issue. There is a good example of binding 2 radio buttons here - http://stackoverflow.com/questions/344964/how-do-i-use-databinding-with-windows-forms-radio-buttons but I am missing the link while implementing the same with 3 buttons. I am having very erratic behaviors for the Radio Buttons. I hope I was able to explain reasonably. I am actually in a hurry and could not put a detailed code on post, but any help in this regard is appreciated. There is a simple solution to this issue by exposing a method like - public void SetMode(Modes mode) { this._selectedMode = mode; } which could be called from the "CheckedChanged" event of the Radio Buttons from the UI and would perfectly set the "SelectedMode" on the business object, but I need to stretch the limits to verify whether this can be done by DataBinding.

    Read the article

  • Index out of bounds error

    - by sprasad12
    Hello, I am working on a program where i am recreating the saved widgets back on to the boundary panel. When i am creating them i am also trying to put the values into the ArrayList so that if i want to update and save the opened project i should be able to do so by getting the values from the ArrayList. Here is how the code looks like: for(int i = 0; i < result.length; i++){ if(ename.contains(result[i].getParticipateEntityName())){ ername.add(ename.indexOf(result[i].getParticipateEntityName()), result[i].getParticipateRelatioshipName()); etotalpartial.add(ename.indexOf(result[i].getParticipateEntityName()), result[i].getTotalPartial()); }else if(wename.contains(result[i].getParticipateEntityName())){ wrname.add(wename.indexOf(result[i].getParticipateEntityName()), result[i].getParticipateRelatioshipName()); } } Here ename, ername, etotalpartial, wename and wrname are all ArrayList. This piece of code is included in an asynchronous class method. When i run the code i get error at "ername.add(ename......". Here is the error stack: java.lang.IndexOutOfBoundsException: Index: 1, Size: 0 at java.util.ArrayList.add(ArrayList.java:367) at com.e.r.d.client.ERD1$16.onSuccess(ERD1.java:898) at com.e.r.d.client.ERD1$16.onSuccess(ERD1.java:1) at com.google.gwt.user.client.rpc.impl.RequestCallbackAdapter.onResponseReceived(RequestCallbackAdapter.java:216) at com.google.gwt.http.client.Request.fireOnResponseReceived(Request.java:287) at com.google.gwt.http.client.RequestBuilder$1.onReadyStateChange(RequestBuilder.java:393) at sun.reflect.GeneratedMethodAccessor16.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at com.google.gwt.dev.shell.MethodAdaptor.invoke(MethodAdaptor.java:103) at com.google.gwt.dev.shell.MethodDispatch.invoke(MethodDispatch.java:71) at com.google.gwt.dev.shell.OophmSessionHandler.invoke(OophmSessionHandler.java:157) at com.google.gwt.dev.shell.BrowserChannel.reactToMessagesWhileWaitingForReturn(BrowserChannel.java:1713) at com.google.gwt.dev.shell.BrowserChannelServer.invokeJavascript(BrowserChannelServer.java:165) at com.google.gwt.dev.shell.ModuleSpaceOOPHM.doInvoke(ModuleSpaceOOPHM.java:120) at com.google.gwt.dev.shell.ModuleSpace.invokeNative(ModuleSpace.java:507) at com.google.gwt.dev.shell.ModuleSpace.invokeNativeObject(ModuleSpace.java:264) at com.google.gwt.dev.shell.JavaScriptHost.invokeNativeObject(JavaScriptHost.java:91) at com.google.gwt.core.client.impl.Impl.apply(Impl.java) at com.google.gwt.core.client.impl.Impl.entry0(Impl.java:188) at sun.reflect.GeneratedMethodAccessor9.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at com.google.gwt.dev.shell.MethodAdaptor.invoke(MethodAdaptor.java:103) at com.google.gwt.dev.shell.MethodDispatch.invoke(MethodDispatch.java:71) at com.google.gwt.dev.shell.OophmSessionHandler.invoke(OophmSessionHandler.java:157) at com.google.gwt.dev.shell.BrowserChannel.reactToMessages(BrowserChannel.java:1668) at com.google.gwt.dev.shell.BrowserChannelServer.processConnection(BrowserChannelServer.java:401) at com.google.gwt.dev.shell.BrowserChannelServer.run(BrowserChannelServer.java:222) at java.lang.Thread.run(Thread.java:619) I am not sure what i am doing wrong. Any input will be of great help. Thank you.

    Read the article

  • what browser is document.layers sniffing?

    - by mkoryak
    I am looking at some JS code from the 20th century, and they are using document.layers in code that is trying to get the current key code. What browser are they sniffing for? i am about to replace the code with something like this: var fn = function(event){ event = event || window.event; var code = event.charCode || event.keyCode; } but i am afraid of breaking something arcane and releasing the evil

    Read the article

  • Removing New line character in Fields PHP

    - by Aruna
    Hi, i am trying to upload an excel file and to store its contents in the Mysql database. i am having a problem in saving the contents.. like My csv file is in the form of "1","aruna","IEEE paper" "2","nisha","JOurnal magazine" actually i am having 2 records and i am using the code <?php $string = file_get_contents( $_FILES["file"]["tmp_name"] ); //echo $string; foreach ( explode( "\n", $string ) as $userString ) { echo $userString; } ? since in the Csv record there is a new line inserted in between IEEE and paper it is dispaying me as 3 records.. How to remove this new line code wise and to modify the code so that only the new line between the records 1 and 2 is considered... Pls help me....

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 150 151 152 153 154 155 156 157 158 159 160 161  | Next Page >