Search Results

Search found 103805 results on 4153 pages for 'am poru'.

Page 155/4153 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • Removing New line character in Fields PHP

    - by Aruna
    Hi, i am trying to upload an excel file and to store its contents in the Mysql database. i am having a problem in saving the contents.. like My csv file is in the form of "1","aruna","IEEE paper" "2","nisha","JOurnal magazine" actually i am having 2 records and i am using the code <?php $string = file_get_contents( $_FILES["file"]["tmp_name"] ); //echo $string; foreach ( explode( "\n", $string ) as $userString ) { echo $userString; } ? since in the Csv record there is a new line inserted in between IEEE and paper it is dispaying me as 3 records.. How to remove this new line code wise and to modify the code so that only the new line between the records 1 and 2 is considered... Pls help me....

    Read the article

  • Unable to import nltk in NetBeans

    - by afs
    Hello all, I am trying to import NLTK in my python code and I get this error: Traceback (most recent call last): File "/home/afs/NetBeansProjects/NER/getNE_followers.py", line 7, in import nltk ImportError: No module named nltk I am using NetBeans: 6.7.1, Python 2.6 NLTK. My NLTK module is installed in /usr/local/lib/python2.6/dist-packages/nltk/ and I have added this in Python paths in Netbeans. What am I missing here? Thanks in advance.

    Read the article

  • TortoiseSVN for Mac PC?

    - by George2
    Hello everyone, I am using a MacBook Pro running Mac OS X 10.5. I am new to this development environment, and previously worked on Windows. I find there is no TortoiseSVN for Mac PC, and I am wondering any alternative (better free and easy to use GUI tools) tools for Mac? thanks in advance, George

    Read the article

  • Hadoop streaming with Python and python subprocess

    - by Ganesh
    I have established a basic hadoop master slave cluster setup and able to run mapreduce programs (including python) on the cluster. Now I am trying to run a python code which accesses a C binary and so I am using the subprocess module. I am able to use the hadoop streaming for a normal python code but when I include the subprocess module to access a binary, the job is getting failed. As you can see in the below logs, the hello executable is recognised to be used for the packaging, but still not able to run the code. . . packageJobJar: [/tmp/hello/hello, /app/hadoop/tmp/hadoop-unjar5030080067721998885/] [] /tmp/streamjob7446402517274720868.jar tmpDir=null JarBuilder.addNamedStream hello . . 12/03/07 22:31:32 INFO mapred.FileInputFormat: Total input paths to process : 1 12/03/07 22:31:32 INFO streaming.StreamJob: getLocalDirs(): [/app/hadoop/tmp/mapred/local] 12/03/07 22:31:32 INFO streaming.StreamJob: Running job: job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:31:32 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:31:32 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:31:33 INFO streaming.StreamJob: map 0% reduce 0% 12/03/07 22:32:05 INFO streaming.StreamJob: map 100% reduce 100% 12/03/07 22:32:05 INFO streaming.StreamJob: To kill this job, run: 12/03/07 22:32:05 INFO streaming.StreamJob: /usr/local/hadoop/bin/../bin/hadoop job -Dmapred.job.tracker=master:54311 -kill job_201203062329_0057 12/03/07 22:32:05 INFO streaming.StreamJob: Tracking URL: http://master:50030/jobdetails.jsp?jobid=job_201203062329_0057 12/03/07 22:32:05 ERROR streaming.StreamJob: Job not Successful! 12/03/07 22:32:05 INFO streaming.StreamJob: killJob... Streaming Job Failed! Command I am trying is : hadoop jar contrib/streaming/hadoop-*streaming*.jar -mapper /home/hduser/MARS.py -reducer /home/hduser/MARS_red.py -input /user/hduser/mars_inputt -output /user/hduser/mars-output -file /tmp/hello/hello -verbose where hello is the C executable. It is a simple helloworld program which I am using to check the basic functioning. My Python code is : #!/usr/bin/env python import subprocess subprocess.call(["./hello"]) Any help with how to get the executable run with Python in hadoop streaming or help with debugging this will get me forward in this. Thanks, Ganesh

    Read the article

  • SQL Query with ORDER BY Part 2

    - by Brett
    Hi SQL'ers, This is a followup question to: SQL Query with ORDER BY But I think the SQL logic is going to be quite different, so I am posting it as separate question. I am trying to extend my sql SELECT query it and having some trouble: I have the table: id type radius ------------------------- 1 type1 0.25 2 type2 0.59 3 type1 0.26 4 type1 0.78 5 type3 0.12 6 type2 0.45 7 type3 0.22 8 type3 0.98 and I am trying to learn how to SELECT the second smallest radius for each given type. So the returned recordset should look like: id type radius ------------------------- 3 type1 0.26 2 type2 0.59 7 type3 0.22 (Note: in the referenced question, I was looking for the lowest radius, not the second lowest radius). I am assuming I have to use LIMIT and OFFSET, but if I use the MIN() won't that return a distinct record containing the minimum radius? Does anyone have any thoughts on how to attack this? Many thanks, Brett

    Read the article

  • How to get the sending email address from outlook 2007

    - by Naresh
    I am working on outlook add-in project using Visual studio 2008 for MS Outlook 2007 in C#. Here I am explaining my problem... I got multiple accounts (3 Accounts) with my outlook 2007. I need to get accounts form Account box in New Mail Message window. When we click New Mail Message, a new window will appear from which we can send a new mail. Here (On this window) we can see Account Dropdown (Left side) under the Send Button. If we have multiple accounts with outlook, we can see all the accounts in Account Drop Down if we click on Account Box. If we click on the particular email, a right mark will appear to that Email Account and a message can bee seen on the top of the Send button is "This message will be sent via [email protected]". So, I want to get these email accounts into a string and that particular email account (which has right mark) into another string. I got these 3 email accounts into a string. But, I am not getting the particular email account(which has the right mark when we send a new email). I am using this code.... using Outlook = Microsoft.Office.Interop.Outlook; using Office = Microsoft.Office.Core; using Microsoft.Office.Interop.Outlook; Outlook._Application myOutlookApp = new Outlook.Application(); Outlook.Accounts myAccounts = myOutlookApp.Session.Accounts; foreach (Outlook.Account account in myAccounts) { string emailAddress = account.SmtpAddress; } I am able to get all the accounts from the above code..But, I just want to get the email address which we will use for sending an email at that particular moment..

    Read the article

  • Java input method for Virtual Keyboad

    - by shekhar
    Hi, I am facing problem in implementing Input method for Virtual Keyboard, currently I am using robot class for sending input to any application from virtual keyboard. but for that I need to create mapping of key-code and unicode, which is not consistent on different keyboard layout, can I directly pass the UNICODE to any application using Input method without worry about mapping between keycode and unicode. any useful link or sample code will be useful. It is simple Java program which is always on top of any application and work as onscreen keyboard. using a mouse while you press any button (key) of the keyboard, the corresponding character will be typed in the application running below. This is working perfectly for English Alphabets. I am facing problem while I am doing for unicode.

    Read the article

  • UIPopoverController. Is is appropriate to embed a tableViewController within?

    - by dugla
    I am doing an iPad imaging app and I am considering UIPopoverController as my workhorse user interface element. The user will spend most of their time immersed in fullscreen content (in both portrait and landscape). When the user wants to select a different piece of content I want to use UIPopoverController to handle that. Is it appropriate to embed a tableViewController in a UIPopoverController to allow in-place scrolling or am I abusing the intended use of UIPopoverController? Thanks, Doug

    Read the article

  • Skip sanitization for videos in html5lib

    - by pug
    I am using a wmd-editor in django, much like this one in which I am typing. I would like to allow the users to embed videos in it. For that I am using the Markdown video extension here. The problem is that I am also sanitizing user input using html5lib sanitization and it doesn't allow object tags which are required to embed the videos. One solution could be to check the input for urls of well-known video sites and skip the sanitization in those cases. Is there a better solution?

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • How to use variables with regex?

    - by dontoo
    This is the input string: 23x^45*y or 2x^2 or y^4*x^3. I am matching ^[0-9]+ after letter x. In other words I am matching x followed by ^ followed by numbers. Problem is that I don't know that I am matching x, it could be any letter that I stored as variable in my char array. For example: foreach (char cEle in myarray) // cEle is letter in char array x, y, z, ... { match CEle in regex(input) //PSEUDOCODE } I am new to regex and I new that this can be done if I define regex variables, but I don't know how.

    Read the article

  • Managing Lotus Notes Mail Format using C#

    - by Pari
    Hi, I am accessing mail body and fetching it in another mail. But i am not getting original format of previous mail in new mail. Problem i am facing in this situation are: Not getting images in destination mail. Font is also varying. I am accessing mail body as follows: NotesRichTextItem rtItem = (NotesRichTextItem)docInbox.GetFirstItem("Body"); String Body = rtItem.GetFormattedText(false , 0); String bodyFormat = rtItem.type.ToString(); also tried this code: NotesItem itemBody = docInbox.GetFirstItem("Body"); String bodyFormat = itemBody.type.ToString(); String Body = itemBody.Text; But not getting solution in both case.

    Read the article

  • Winform radiobutton data binding

    - by Rajarshi
    I am following the "Presentation Model" design pattern suggested by Martin Fowler for my GUI architecture in a Windows Forms project. "The essence of a Presentation Model is of a fully self-contained class that represents all the data and behavior of the UI window, but without any of the controls used to render that UI on the screen. A view then simply projects the state of the presentation model onto the glass...." - Martin Fowler Read more about this pattern at www.martinfowler.com/eaaDev/PresentationModel.html I am finding the concept very fluid and easy to understand except this one issue of data binding RadioButtons to properties on the Data/Domain object. Suposing I have a Windows Form with 3 radio buttons to depict some "Mode" options as - Auto Manual Import How can I use boolean properties on Data/Domain Objects to DataBind to these buttons? I have tried many ways but to no avail. For example I would like to code like - rbtnAutoMode.DataBindings.Add("Text", myBusinessObject, "IsAutoMode"); rbtnManualMode.DataBindings.Add("Text", myBusinessObject, "IsManualMode"); rbtnImportMode.DataBindings.Add("Text", myBusinessObject, "IsImportMode"); There should be a fourth property like "SelectedMode" on the data/domain object which at the end should depict a single value like "SelectedMode = Auto". I am trying to update this property when any of the "IsAutoMode", "IsManualMode" or "IsImportMode" is changed, e.g. through the property setters. I have INotifyPropertyChanged implemented on my data/domain object so, updating any data/domain object property automatically updates my UI controls, that's not an issue. There is a good example of binding 2 radio buttons here - http://stackoverflow.com/questions/344964/how-do-i-use-databinding-with-windows-forms-radio-buttons but I am missing the link while implementing the same with 3 buttons. I am having very erratic behaviors for the Radio Buttons. I hope I was able to explain reasonably. I am actually in a hurry and could not put a detailed code on post, but any help in this regard is appreciated. There is a simple solution to this issue by exposing a method like - public void SetMode(Modes mode) { this._selectedMode = mode; } which could be called from the "CheckedChanged" event of the Radio Buttons from the UI and would perfectly set the "SelectedMode" on the business object, but I need to stretch the limits to verify whether this can be done by DataBinding.

    Read the article

  • java jama array problem

    - by agazerboy
    Hi All, I asked a question before but duffymo said it is not clear so i am going to post it again here. I am using Jama api for SVD calculation. I know very well about jama and SVD. Jama does not work if your column are more than rows. I have this situation. What should I do?? any help? I can't transpose the matrix too as it can produce wrong results. Thanks. P.S: I am calculating LSI with the help of jama. I am going like column(docs) and rows ( terms )

    Read the article

  • How to get stack trace of a running process from within a Visual Studio add-in?

    - by Jack
    I am writing a Visual Studio add-in in C# which will run while I am debugging a process in the same Visual Studio window and I need access to that the process' stack trace from within my add-in. I tried putting this code into my add-in but it returns the add-in's stack trace, not the process I am debugging. System.Diagnostics.StackTrace stacktrace = new System.Diagnostics.StackTrace(true); System.Diagnostics.StackFrame stackframe = stacktrace.GetFrame(0); Any help would be appreciated.

    Read the article

  • Zend: How to authenticate using OpenId on local server.

    - by NAVEED
    I am using zend framework. Now I want to authenticate users with other already registered accounts using RPX. I am following the 3 steps as described at RPX site: 1- Get the Widget 2- Receive Tokens 3- Choose Providers I created a controller(person) and action(signin) to show widget and my own signin form. When following action (http://test.dev/#person/personsignin) is called then my own login form and widget is shown successfully. # is used in above URL for AJAX indication. public function personsigninAction() { $this->view->jsonEncoded = true; // Person Signin Form $PersonSigninForm = new Form_PersonSignin(); $this->view->PersonSigninForm = $PersonSigninForm; $this->view->PersonSigninForm->setAction( $this->view->url() ); $request = $this->getRequest(); if ( $request->isPost() ) { } } There are two problems while login using openid widget: When I am authenticated from outside(for example: Yahoo) then I am redirected to http://test.dev, therefor indexAction in called in indexController and home page is shown. I want to redirect to http://test.dev/#person/personsignin after authentication and want to set session in isPost() condition of personsigninAction() (described above). For now I consider indexAction to be called when outside authentication is done. Now I posted the code from http://gist.github.com/291396 in indexAction to follow step 3 mentioned above. But it is giving me following error: An error occured: Invalid parameter: apiKey Am I using the right way to use this. This is my very first attempt to this stuff. Can someone tell me the exact steps using my above actions? Thanks.

    Read the article

  • What this Url ending means .....&123 ?

    - by simple
    Hey I am having some issues while using Nggalley plugin for wordpress the plugin makes use of a JW player and JW player needs an XML - so it requests link like this http://nextgen-gallery.com/index.php?callback=imagerotator&gid=1&149 The lay &xxx really creaps me out couse I am using it for joomla and joomla doesn't like this I am assuming that this has to do with wordpress but still unsure. what does this ending of URL really mean? PS. I would never ever use wordpress plugin in joomla but my client uses and I have to fix it

    Read the article

  • Index out of bounds error

    - by sprasad12
    Hello, I am working on a program where i am recreating the saved widgets back on to the boundary panel. When i am creating them i am also trying to put the values into the ArrayList so that if i want to update and save the opened project i should be able to do so by getting the values from the ArrayList. Here is how the code looks like: for(int i = 0; i < result.length; i++){ if(ename.contains(result[i].getParticipateEntityName())){ ername.add(ename.indexOf(result[i].getParticipateEntityName()), result[i].getParticipateRelatioshipName()); etotalpartial.add(ename.indexOf(result[i].getParticipateEntityName()), result[i].getTotalPartial()); }else if(wename.contains(result[i].getParticipateEntityName())){ wrname.add(wename.indexOf(result[i].getParticipateEntityName()), result[i].getParticipateRelatioshipName()); } } Here ename, ername, etotalpartial, wename and wrname are all ArrayList. This piece of code is included in an asynchronous class method. When i run the code i get error at "ername.add(ename......". Here is the error stack: java.lang.IndexOutOfBoundsException: Index: 1, Size: 0 at java.util.ArrayList.add(ArrayList.java:367) at com.e.r.d.client.ERD1$16.onSuccess(ERD1.java:898) at com.e.r.d.client.ERD1$16.onSuccess(ERD1.java:1) at com.google.gwt.user.client.rpc.impl.RequestCallbackAdapter.onResponseReceived(RequestCallbackAdapter.java:216) at com.google.gwt.http.client.Request.fireOnResponseReceived(Request.java:287) at com.google.gwt.http.client.RequestBuilder$1.onReadyStateChange(RequestBuilder.java:393) at sun.reflect.GeneratedMethodAccessor16.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at com.google.gwt.dev.shell.MethodAdaptor.invoke(MethodAdaptor.java:103) at com.google.gwt.dev.shell.MethodDispatch.invoke(MethodDispatch.java:71) at com.google.gwt.dev.shell.OophmSessionHandler.invoke(OophmSessionHandler.java:157) at com.google.gwt.dev.shell.BrowserChannel.reactToMessagesWhileWaitingForReturn(BrowserChannel.java:1713) at com.google.gwt.dev.shell.BrowserChannelServer.invokeJavascript(BrowserChannelServer.java:165) at com.google.gwt.dev.shell.ModuleSpaceOOPHM.doInvoke(ModuleSpaceOOPHM.java:120) at com.google.gwt.dev.shell.ModuleSpace.invokeNative(ModuleSpace.java:507) at com.google.gwt.dev.shell.ModuleSpace.invokeNativeObject(ModuleSpace.java:264) at com.google.gwt.dev.shell.JavaScriptHost.invokeNativeObject(JavaScriptHost.java:91) at com.google.gwt.core.client.impl.Impl.apply(Impl.java) at com.google.gwt.core.client.impl.Impl.entry0(Impl.java:188) at sun.reflect.GeneratedMethodAccessor9.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at com.google.gwt.dev.shell.MethodAdaptor.invoke(MethodAdaptor.java:103) at com.google.gwt.dev.shell.MethodDispatch.invoke(MethodDispatch.java:71) at com.google.gwt.dev.shell.OophmSessionHandler.invoke(OophmSessionHandler.java:157) at com.google.gwt.dev.shell.BrowserChannel.reactToMessages(BrowserChannel.java:1668) at com.google.gwt.dev.shell.BrowserChannelServer.processConnection(BrowserChannelServer.java:401) at com.google.gwt.dev.shell.BrowserChannelServer.run(BrowserChannelServer.java:222) at java.lang.Thread.run(Thread.java:619) I am not sure what i am doing wrong. Any input will be of great help. Thank you.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to hide specific header item in grid

    - by Vara Prasad.M
    Hi, I am using RadGrid and i am displaying the header item with months if the month data is null then i have to make invisible the entire column including the header text i am using Telerik version Grid. Please reply it fast Waiting for the reply, Thanks in Advance Vara Prasad.M

    Read the article

  • Hopping from a C++ to a Perl/Unix job

    - by rocknroll
    Hi all, I have been a C++ / Linux Developer till now and I am adept in this stack. Of late I have been getting opportunities that require Perl, Unix (with knowledge of C++,shell scripting) expertise. Organizations are showing interest even though I don't have much scripting experience to boast off. The role is more in a Support, maintenance project involving SQL as well. Off late I am in a fix whether to forgo these offers or not. I don't know the dynamics of an IT organization and thus on one hand I fear that my C++ experience will be nullified and on the positive side I am getting to work on a new technology stack which will only add to my skill set. I am sure, most of you at some point of time have encountered such dilemmas and would have taken some decision. I want you to share your perspectives on such a scenario where a person is required to change his/her technology stack when changing his/her job. What are the merits and demerits in going with either of the choices? Also I know that C++ isn't going anywhere in the near future. What about perl? I have no clue as to what the future holds for perl developer? Whether there are enough opportunities for a perl developer? I am asking this question here because most of my fellow programmers face this career choice dilemma. Thanks.

    Read the article

  • FileUtils.mv adding linebreaks in Windows

    - by Lowgain
    I am streaming wav data from a flash application. If I get the data and do the following: f = File.open('c:/test.wav') f << wav_data.pack('c'*wav_data.length) f.close The wav file works perfectly. If I do this: f = Tempfile.new('test.wav') f << wav_data.pack('c'*wav_data.length) f.close FileUtils.mv(f.path, 'c:/') The file is there, but sounds all garbled. Checking in a hex editor shows that everywhere the working file had an 0A (or \n), the garbled version had 0D0A (or \r\n) I am using this in conjuction with rails+paperclip, and am going to be using a combination of Heroku and S3 for the live app, so I am hoping this problem will solve itself, but I'd like to get this working on my local machine for the time being. Does anybody know of any reason FileUtils.mv would be doing this, and if there is a way to change its behaviour?

    Read the article

  • localization in iphone

    - by shishir.bobby
    HI all, i m working on an app,which need localization. I am using a tab bars, having five tabs, and navigation controller. i am able to change title according to locales,but the navigation controllers rightbarbutton which navigates to previuos view, showing English(united states), when i change local to english. What i am doing wrong. plz suggest me some solution. regard shishir

    Read the article

  • Unable to add a trac repository to mylyn in eclipse

    - by user592748
    Trac is running on a server on port 8002. With tunneling, I am able to access Trac on my machine using localhost:8002. I am able to login, create tickets using my browser. I want to integrate this trac project with Mylyn in Eclipse. I have installed mylyn with the Trac connector. I try adding task repositories in eclipse. I am able to successfully validate the settings, however, I am not able to add it as a task repository. Any help appreciated.

    Read the article

  • Converting From Castle Windsor To StructureMap In An MVC2 Project

    - by alphadogg
    I am learning about best practices in MVC2 and I am knocking off a copy of the "Who Can Help Me" project (http://whocanhelpme.codeplex.com/) off Codeplex. In it, they use Castle Windsor for their DI container. One "learning" task I am trying to do is convert this subsystem in this project to use StructureMap. Basically, at Application_Start(), the code news up a Windsor container. Then, it goes through multiple assemblies, using MEF: public static void Register(IContainer container) { var catalog = new CatalogBuilder() .ForAssembly(typeof(IComponentRegistrarMarker).Assembly) .ForMvcAssembly(Assembly.GetExecutingAssembly()) .ForMvcAssembliesInDirectory(HttpRuntime.BinDirectory, "CPOP*.dll") // Won't work in Partial trust .Build(); var compositionContainer = new CompositionContainer(catalog); compositionContainer .GetExports<IComponentRegistrar>() .Each(e => e.Value.Register(container)); } and any class in any assembly that has an IComponentRegistrar interface will get its Register() method run. For example, the controller registrar's Register() method implementation basically is: public void Register(IContainer container) { Assembly.GetAssembly(typeof(ControllersRegistrarMarker)).GetExportedTypes() .Where(IsController) .Each(type => container.AddComponentLifeStyle( type.Name.ToLower(), type, LifestyleType.Transient )); } private static bool IsController(Type type) { return typeof(IController).IsAssignableFrom(type); } Hopefully, I am not butchering WCHM too much. I am wondering how does one do this with StructureMap?

    Read the article

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >