Search Results

Search found 103784 results on 4152 pages for 'engr am'.

Page 155/4152 | < Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >

  • what browser is document.layers sniffing?

    - by mkoryak
    I am looking at some JS code from the 20th century, and they are using document.layers in code that is trying to get the current key code. What browser are they sniffing for? i am about to replace the code with something like this: var fn = function(event){ event = event || window.event; var code = event.charCode || event.keyCode; } but i am afraid of breaking something arcane and releasing the evil

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • UIPopoverController. Is is appropriate to embed a tableViewController within?

    - by dugla
    I am doing an iPad imaging app and I am considering UIPopoverController as my workhorse user interface element. The user will spend most of their time immersed in fullscreen content (in both portrait and landscape). When the user wants to select a different piece of content I want to use UIPopoverController to handle that. Is it appropriate to embed a tableViewController in a UIPopoverController to allow in-place scrolling or am I abusing the intended use of UIPopoverController? Thanks, Doug

    Read the article

  • How to hide specific header item in grid

    - by Vara Prasad.M
    Hi, I am using RadGrid and i am displaying the header item with months if the month data is null then i have to make invisible the entire column including the header text i am using Telerik version Grid. Please reply it fast Waiting for the reply, Thanks in Advance Vara Prasad.M

    Read the article

  • Removing New line character in Fields PHP

    - by Aruna
    Hi, i am trying to upload an excel file and to store its contents in the Mysql database. i am having a problem in saving the contents.. like My csv file is in the form of "1","aruna","IEEE paper" "2","nisha","JOurnal magazine" actually i am having 2 records and i am using the code <?php $string = file_get_contents( $_FILES["file"]["tmp_name"] ); //echo $string; foreach ( explode( "\n", $string ) as $userString ) { echo $userString; } ? since in the Csv record there is a new line inserted in between IEEE and paper it is dispaying me as 3 records.. How to remove this new line code wise and to modify the code so that only the new line between the records 1 and 2 is considered... Pls help me....

    Read the article

  • Python invalid syntax with "with" statement

    - by mrlanrat
    Hello all, I am working on writing a simple python application for linux (maemo). However I am getting SyntaxError: invalid syntax on line 23: with open(file,'w') as fileh: The code can be seen here: http://pastebin.com/MPxfrsAp I can not figure out what is wrong with my code, I am new to python and the "with" statement. So, what is causing this code to error, and how can I fix it? Is it something wrong with the "with" statement? Thanks!

    Read the article

  • Game login authentication and security.

    - by Charles
    First off I will say I am completely new to security in coding. I am currently helping a friend develop a small game (in Python) which will have a login server. I don't have much knowledge regarding security, but I know many games do have issues with this. Everything from 3rd party applications (bots) to WPE packet manipulation. Considering how small this game will be and the limited user base, I doubt we will have serious issues, but would like to try our best to limit problems. I am not sure where to start or what methods I should use, or what's worth it. For example, sending data to the server such as login name and password. I was told his information should be encrypted when sending, so in-case someone was viewing it (with whatever means), that they couldn't get into the account. However, if someone is able to capture the encrypted string, wouldn't this string always work since it's decrypted server side? In other words, someone could just capture the packet, reuse it, and still gain access to the account? The main goal I am really looking for is to make sure the players are logging into the game with the client we provide, and to make sure it's 'secure' (broad, I know). I have looked around at different methods such as Public and Private Key encryption, which I am sure any hex editor could eventually find. There are many other methods that seem way over my head at the moment and leave the impression of overkill. I realize nothing is 100% secure. I am just looking for any input or reading material (links) to accomplish the main goal stated above. Would appreciate any help, thanks.

    Read the article

  • Newbie question: How do you layout an icon, 2 text lines and a button?

    - by Keith Barrows
    I am trying to extend a sample I found at http://developer.android.com/resources/articles/layout-tricks-efficiency.html. I am a brand new MonoDroid developer, just installed it yesterday, and trying to jump right into UI design and so far it is not clicking for me completely. I have this main.xml: <?xml version="1.0" encoding="utf-8"?> <RelativeLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="fill_parent" android:layout_height="?android:attr/listPreferredItemHeight" android:padding="6dip"> <ImageView android:id="@+id/icon" android:layout_width="wrap_content" android:layout_height="fill_parent" android:layout_alignParentTop="true" android:layout_alignParentBottom="true" android:layout_marginRight="6dip" android:src="@drawable/icon" /> <TextView android:id="@+id/secondLine" android:layout_width="200dip" android:layout_height="26dip" android:layout_toRightOf="@id/icon" android:layout_alignParentBottom="true" android:layout_alignParentRight="true" android:singleLine="true" android:ellipsize="marquee" android:text="Second line which is a long line of text and needs to scroll" /> <TextView android:id="@+id/firstLine" android:layout_width="200dip" android:layout_height="wrap_content" android:layout_toRightOf="@id/icon" android:layout_alignParentRight="true" android:layout_alignParentTop="true" android:layout_above="@id/secondLine" android:layout_alignWithParentIfMissing="true" android:singleLine="true" android:ellipsize="marquee" android:gravity="center_vertical" android:text="First line" /> <Button android:id="@+id/logonButton" android:layout_width="50dip" android:layout_height="wrap_content" android:layout_toRightOf="@id/secondLine" android:layout_alignParentRight="true" android:layout_alignParentTop="true" android:gravity="center_vertical" android:text="Login" /> /> </RelativeLayout> What I am trying to do is have an icon on the left, 2 lines of text stacked in the middle and a button on the right. When I run this in my emulator I am seeing: The second line is not scrolling. The button does not show up. Is there by any chance a simple WYSIWYG editor for layout? Or is there an app to give me a quick view of my layout XML? Something like FireBug in FireFox would be fine. Barring the slim chance there are UI helpers for Droid, what am I doing wrong? :)

    Read the article

  • Uploading to TwitVid using x_verify_credentials_authorization

    - by deepa
    Hi, I am developing an iPhone application that uploads videos to TwitVid using the library TwitVid-iPhone-OAuth3. I have selected this library since Twitter is shifting to OAuth mechanism of authentication. 1) Does this new library allows to upload without user-name and password parameters? 2) I am using the following steps for uploading videos (assumed that new library allows to upload without user-name and password parameters). But, I am getting the error 'Incorrect Signature'. I am not able to identify the mistake that I am doing here. Could you please help me out to solve this problem. Authenticate the app using OAuth (MGTwitterEngine etc) which redirects the user to the web-page asking for log-in and app authentication. If the user authenticates the app, access token will obtained as final step. Upload the video to TwitVid using the following code snippet: OAuth *authorizer = [[OAuth alloc] initWithConsumerKey: @"my_consumer_key" andConsumerSecret: @"my_consumer_secret"]; authorizer.oauth_token = //The key-part of the access token obtained in step 2 authorizer.oauth_token_secret = //The secret-part of the access token obtained in step 2 authorizer.oauth_token_authorized = YES; //Since authenticated in steps 1 and 2 NSString *authHeader = [authorizer oAuthHeaderForMethod: @"POST" andUrl: @"https://api.twitter.com/1/account/verify_credentials.xml" andParams: nil]; twitVid = [[TwitVid alloc] init]; [mTwitVid setDelegate: self]; [mTwitVid authenticateWithXVerifyCredentialsAuthorization: authHeader xAuthServiceProvider: nil]; Thanks and Regards, Deepa

    Read the article

  • SIMPLE PHP MVC Framework!

    - by Allen
    I need a simple and basic MVC example to get me started. I dont want to use any of the available packaged frameworks. I am in need of a simple example of a simple PHP MVC framework that would allow, at most, the basic creation of a simple multi-page site. I am asking for a simple example because I learn best from simple real world examples. Big popular frameworks (such as code ignighter) are to much for me to even try to understand and any other "simple" example I have found are not well explained or seem a little sketchy in general. I should add that most examples of simple MVC frameworks I see use mod_rewrite (for URL routing) or some other Apache-only method. I run PHP on IIS. I need to be able to understand a basic MVC framework, so that I could develop my own that would allow me to easily extend functionality with classes. I am at the point where I understand basic design patterns and MVC pretty well. I understand them in theory, but when it comes down to actually building a real world, simple, well designed MVC framework in PHP, i'm stuck. I would really appreciate some help! Edit: I just want to note that I am looking for a simple example that an experienced programmer could whip up in under an hour. I mean simple as in bare bones simple. I dont want to use any huge frameworks, I am trying to roll my own. I need a decent SIMPLE example to get me going.

    Read the article

  • localization in iphone

    - by shishir.bobby
    HI all, i m working on an app,which need localization. I am using a tab bars, having five tabs, and navigation controller. i am able to change title according to locales,but the navigation controllers rightbarbutton which navigates to previuos view, showing English(united states), when i change local to english. What i am doing wrong. plz suggest me some solution. regard shishir

    Read the article

  • java jama array problem

    - by agazerboy
    Hi All, I asked a question before but duffymo said it is not clear so i am going to post it again here. I am using Jama api for SVD calculation. I know very well about jama and SVD. Jama does not work if your column are more than rows. I have this situation. What should I do?? any help? I can't transpose the matrix too as it can produce wrong results. Thanks. P.S: I am calculating LSI with the help of jama. I am going like column(docs) and rows ( terms )

    Read the article

  • Scala type conversion error, need help!

    - by Mansoor Ashraf
    Hello I am getting a weird error when trying to use a Java map in Scala. This is the snippet of code val value:Double = map.get(name) if (value eq null) map.put(name, time) else map.put(name, value + time) the map is defined as val map=new ConcurrentHashMap[String,Double] and this is the error I am getting error: type mismatch; found : Double required: ?{val eq: ?} Note that implicit conversions are not applicable because they are ambiguous: both method double2Double in object Predef of type (Double)java.lang.Double and method doubleWrapper in object Predef of type (Double)scala.runtime.RichDouble are possible conversion functions from Double to ?{val eq: ?} if (value eq null) map.put(name, time) I am new to Scala so I am having a hard time parsing the stacktrace. Any help would be appreciated

    Read the article

  • Validating Application Settings Key Values in Isolated Storage for Windows Phone Applications

    - by Martin Anderson
    Hello everyone. I am very new at all this c# Windows Phone programming, so this is most probably a dumb question, but I need to know anywho... IsolatedStorageSettings appSettings = IsolatedStorageSettings.ApplicationSettings; if (!appSettings.Contains("isFirstRun")) { firstrunCheckBox.Opacity = 0.5; MessageBox.Show("isFirstRun not found - creating as true"); appSettings.Add("isFirstRun", "true"); appSettings.Save(); firstrunCheckBox.Opacity = 1; firstrunCheckBox.IsChecked = true; } else { if (appSettings["isFirstRun"] == "true") { firstrunCheckBox.Opacity = 1; firstrunCheckBox.IsChecked = true; } else if (appSettings["isFirstRun"] == "false") { firstrunCheckBox.Opacity = 1; firstrunCheckBox.IsChecked = false; } else { firstrunCheckBox.Opacity = 0.5; } } I am trying to firstly check if there is a specific key in my Application Settings Isolated Storage, and then wish to make a CheckBox appear checked or unchecked depending on if the value for that key is "true" or "false". Also I am defaulting the opacity of the checkbox to 0.5 opacity when no action is taken upon it. With the code I have, I get the warnings Possible unintended reference comparison; to get a value comparison, cast the left hand side to type 'string' Can someone tell me what I am doing wrong. I have explored storing data in an Isolated Storage txt file, and that worked, I am now trying Application Settings, and will finally try to download and store an xml file, as well as create and store user settings into an xml file. I want to try understand all the options open to me, and use which ever runs better and quicker

    Read the article

  • FileUtils.mv adding linebreaks in Windows

    - by Lowgain
    I am streaming wav data from a flash application. If I get the data and do the following: f = File.open('c:/test.wav') f << wav_data.pack('c'*wav_data.length) f.close The wav file works perfectly. If I do this: f = Tempfile.new('test.wav') f << wav_data.pack('c'*wav_data.length) f.close FileUtils.mv(f.path, 'c:/') The file is there, but sounds all garbled. Checking in a hex editor shows that everywhere the working file had an 0A (or \n), the garbled version had 0D0A (or \r\n) I am using this in conjuction with rails+paperclip, and am going to be using a combination of Heroku and S3 for the live app, so I am hoping this problem will solve itself, but I'd like to get this working on my local machine for the time being. Does anybody know of any reason FileUtils.mv would be doing this, and if there is a way to change its behaviour?

    Read the article

  • Facebook Connect - Mobile

    - by Jayrox
    I am currently in the process of creating a mobile version of my web app. The app is being developed with Facebook's PHP Client Library. The issue: I am using the following mobile url to allow users to log in using the mobile devices: http://m.facebook.com/tos.php?api_key=APIKEY&v=1.0&next=http%3A%2F%2Ftweelay.net%2Fm.php&cancel=http%3A%2F%2Ftweelay.net%2Fm.php APIKEY being my app's actual Facebook API key. In the url I am telling Facebook to redirect the user back to http://tweelay.net/m.php when the user signs in or clicks cancel on the log in screen. I am pulling my hair trying to figure out why it keeps sending the user to http://m.tweelay.net/m.php which is currently an invalid end point. I have gone through all of my app's settings on Facebook and I cant find any that reference http://m.tweelay.net and going through all of my source code I cant find any that reference the m. sub-domain either.

    Read the article

  • Convert latitude and longitude into northings and eastings

    - by Rippo
    Hi I have the following UK postcode dy8 3xt and know that the latitude and longitude is:- 54.452772 -2.156082 I also know that the Eastings, Northings for the postcode is:- 389490 283880 However I am struggling to find the equation that converts lat/long to northings and Eastings, I would prefer to have the equation in both in jScript and c# (I am being greedy)! Can anyone help? EDIT Thanks for your help so far guys, I am starting to learn something here esp. the terminology... Some more info, if you click on this link you can see the results I am looking for. The postcode I entered projects to lat/lng using WG S84 and the grid ref projects to OSGB. So my question is how is this done? WHAT I LEARNT Thanks to all that answered, I finally got led to here which I can confirm works great

    Read the article

  • Need help figuring out scala compiler errors.

    - by klactose
    Hello all, I have been working on a project in scala, but I am getting some error messages that I don't quite understand. The classes that I am working with are relatively simple. For example: abstract class Shape case class Point(x: Int, y: Int) extends Shape case class Polygon(points: Point*) extends Shape Now suppose that I create a Polygon: val poly = new Polygon(new Point(2,5), new Point(7,0), new Point(3,1)) Then if I attempt to determine the location and size of the smallest possible rectangle that could contain the polygon, I get various errors that I don't quite understand. Below are snippets of different attempts and the corresponding error messages that they produce. val upperLeftX = poly.points.reduceLeft(Math.min(_.x, _.x)) Gives the error: "missing parameter type for expanded function ((x$1) = x$1.x)" val upperLeftX = poly.points.reduceLeft((a: Point, b: Point) => (Math.min(a.x, b.x))) Gives this error: "type mismatch; found : (Point, Point) = Int required: (Any, Point) = Any" I am very confused about both of these error messages. If anyone could explain more clearly what I am doing incorrectly, I would really appreciate it. Yes, I see that the second error says that I need type "Any" but I don't understand exactly how to implement a change that would work as I need it. Obviously simply changing "a: Point" to "a: Any" is not a viable solution, so what am I missing?

    Read the article

  • Trying to debug a 'Assertion failure in -[UIActionSheet showInView:]' error....

    - by dsobol
    I am working through "Beginning iPad Application Development" and am getting hung up in Chapter 3 where I have created a project that works with an Action Sheet. As it stands now, my application loads into the simulator just fine with no errors that I am aware of, but as it runs, it crashes with the following errors showing up in the debugger window: 2010-05-31 19:44:39.703 UsingViewsActionSheet[49538:207] * Assertion failure in -[UIActionSheet showInView:], /SourceCache/UIKit_Sim/UIKit-1145.66/UIAlert.m:7073 2010-05-31 19:44:39.705 UsingViewsActionSheet[49538:207] * Terminating app due to uncaught exception 'NSInternalInconsistencyException', reason: 'Invalid parameter not satisfying: view != nil' I am sure that this is the block where the app breaks based upon my use of breakpoints. //Implement viewDidLoad to do additional setup after loading the view, typically from a nib. - (void)viewDidLoad { UIActionSheet *action = [[UIActionSheet alloc] initWithTitle:@"This is my Action Sheet!" delegate:self cancelButtonTitle:@"OK" destructiveButtonTitle:@"Delete Message!" otherButtonTitles:@"Option 1", @"Option 2", @"Option 3", nil]; [action showInView:self.view]; // <-- This line seems to trigger the crash.... [action release]; [super viewDidLoad]; } Am I missing something obvious, or is there more to the problem than is shown here? I have looked at the abstract for showInView and cannot divine anything there yet. I appreciate any and all asssitance. Regards, Steve O'Sullivan

    Read the article

  • WCF RIA Services Silverlight 3.0

    - by John
    Hi, I have downloaded WCF RIA Services Beta from the following website: WCF RIA Services Beta for Visual Studio 2008 SP1 http://www.microsoft.com/downloads/details.aspx?FamilyID=76bb3a07-3846-4564-b0c3-27972bcaabce&displaylang=en#filelist But I am unable to add a reference to the following assembly : system.Windows.Ria.Data I searched at the downloaded location c:\Program files\Microsoft SDK's\RIA Services but i am unable to find this dll. Would appreciate if you could point me what I am missing here.

    Read the article

  • In which order is model binding and validation done in ASP.NET MVC 2?

    - by Simon Bartlett
    I am using ASP.NET MVC 2, and am using a view-model per view approach. I am also using Automapper to map properties from my domain-model to the view-model. Take this example view-model (with Required data annotation attributes for validation purposes): public class BlogPost_ViewModel { public int Id { get; set; } [Required] public string Title { get; set; } [Required] public string Text { get; set; } } In the post editor view I am using a rich text editor (CKeditor). Because CKeditor is a HTML editor, I ideally need CKeditor to HTMLencode the user's input when the form is submitted, so that ASP.NET's input validation does not complain. This is not a problem as CKeditor has this functionality built in, however I need CKeditor's output decoded before mapping back to the domain object (via Automapper). I am wanting to add a new property (to the view-model above) to solve this, as follows: public string HTMLEncodedText { get { return HTMLEncode(Text); } set { Text = HTMLDecode(value); } } I can then bind this property to CKeditor in the view, but still use Automapper to map the 'Text' property in the controller - all without having to turn input-validation off. My question is: do you know how the model binding and validation process in ASP.NET MVC 2 works? Are all model properties binded before validation is carried out? Or is each individual property get validated when it is being set. I think ideally for my idea to work, all properties need to be set before the model is validated.

    Read the article

  • Converting From Castle Windsor To StructureMap In An MVC2 Project

    - by alphadogg
    I am learning about best practices in MVC2 and I am knocking off a copy of the "Who Can Help Me" project (http://whocanhelpme.codeplex.com/) off Codeplex. In it, they use Castle Windsor for their DI container. One "learning" task I am trying to do is convert this subsystem in this project to use StructureMap. Basically, at Application_Start(), the code news up a Windsor container. Then, it goes through multiple assemblies, using MEF: public static void Register(IContainer container) { var catalog = new CatalogBuilder() .ForAssembly(typeof(IComponentRegistrarMarker).Assembly) .ForMvcAssembly(Assembly.GetExecutingAssembly()) .ForMvcAssembliesInDirectory(HttpRuntime.BinDirectory, "CPOP*.dll") // Won't work in Partial trust .Build(); var compositionContainer = new CompositionContainer(catalog); compositionContainer .GetExports<IComponentRegistrar>() .Each(e => e.Value.Register(container)); } and any class in any assembly that has an IComponentRegistrar interface will get its Register() method run. For example, the controller registrar's Register() method implementation basically is: public void Register(IContainer container) { Assembly.GetAssembly(typeof(ControllersRegistrarMarker)).GetExportedTypes() .Where(IsController) .Each(type => container.AddComponentLifeStyle( type.Name.ToLower(), type, LifestyleType.Transient )); } private static bool IsController(Type type) { return typeof(IController).IsAssignableFrom(type); } Hopefully, I am not butchering WCHM too much. I am wondering how does one do this with StructureMap?

    Read the article

  • General ODBC Error in VBA

    - by raam
    Hi am populating the data from MS Access By Using VBA i am using below mentioned code.if i am run the same code in MS 2007 then It run properly but if i am run the same code in MS 2003 it gives the "General ODBC Error" how to solve this problem Any help would be appreciated!! Thanks in advance Sub Button2_Click() Dim varConnection As String Dim varSQL As String Dim cal, cal1, x varConnection = "ODBC; DSN=MS Access Database;DBQ=D:\Box\Generate.mdb;Driver={Driver do Microsoft Access (*.mdb)}" ' varSQL = "SELECT * FROM Empdata" With ActiveSheet.QueryTables.Add(Connection:=varConnection, Destination:=ActiveSheet.Range("C7")) .CommandText = varSQL .Name = "Query-39008" .Refresh BackgroundQuery = False End With End Sub

    Read the article

  • How does MSN filter spam?

    - by Marius
    I am trying to create a newsletter for our business. The last few days have been spent testing, and one of things I have noticed is that MSN seemingly randomly filters out some of my test messages. This is super-frustrating. I like the PEAR Mail MIME-package, and have been using that. I may send one email from one of our servers, resulting in the message getting through, and in the next minute, the same message sent from our other server ends up in the junk folder. Then if I add an attachment to the email, and the same message passes though the filter from the server that was previously blocked. I think. What the ####? Is this like throwing a dice, without me having any control over what is trash, and what isn't? I have sent email from several servers, all of which are shared. But I am unsure this is the problem. The problem is that it is seemingly random how MSN filters email. Some emails get through, and some other don't for seemingly irrational reasons. I am running out of ideas, but I am not giving up. Therefore I am writing to you for HARDCORE technical info on how MSN filters spam.

    Read the article

  • Hopping from a C++ to a Perl/Unix job

    - by rocknroll
    Hi all, I have been a C++ / Linux Developer till now and I am adept in this stack. Of late I have been getting opportunities that require Perl, Unix (with knowledge of C++,shell scripting) expertise. Organizations are showing interest even though I don't have much scripting experience to boast off. The role is more in a Support, maintenance project involving SQL as well. Off late I am in a fix whether to forgo these offers or not. I don't know the dynamics of an IT organization and thus on one hand I fear that my C++ experience will be nullified and on the positive side I am getting to work on a new technology stack which will only add to my skill set. I am sure, most of you at some point of time have encountered such dilemmas and would have taken some decision. I want you to share your perspectives on such a scenario where a person is required to change his/her technology stack when changing his/her job. What are the merits and demerits in going with either of the choices? Also I know that C++ isn't going anywhere in the near future. What about perl? I have no clue as to what the future holds for perl developer? Whether there are enough opportunities for a perl developer? I am asking this question here because most of my fellow programmers face this career choice dilemma. Thanks.

    Read the article

< Previous Page | 151 152 153 154 155 156 157 158 159 160 161 162  | Next Page >