Search Results

Search found 51448 results on 2058 pages for 'log files'.

Page 156/2058 | < Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >

  • Windows script to create directories of 3,000 files

    - by uhpl1
    We have some email archiving that is dumping all the emails into a directory. Because of some performance reasons with the server, I want to setup an automated task that will run a script once a day and if there is more than 3,000 (or whatever number) of files in the main directory, create a new directory with the date and move all the main directory files into it. I'm sure someone has already written something similar, so if anyone could point me at it that would be great. Batch file or Powershell would both be fine.

    Read the article

  • best way to record local modifications to an application's configuration files

    - by Menelaos Perdikeas
    I often install applications in Linux which don't come in package form but rather one just downloads a tarball, unpacks it, and runs the app out of the exploded folder. To adjust the application to my environment I need to modify the default configuration files, perhaps add an odd script of my own and I would like to have a way to record all these modifications automatically so I can apply them to another environment. Clearly, the modifications can not be reproduced verbatim as things like IP addresses or username need to change from system to system; still an exhaustive record to what was changed and added would be useful. My solution is to use a pattern involving git. Basically after I explode the tarball I do a git init and an initial commit and then I can save to a file the output of git diff and a cat of all files appearing as new in the git status -s. But I am sure there are more efficient ways. ???

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • tool for advanced ID3 tags handling and audio files ordering

    - by Juhele
    I have following problem – some of my files do not have complete ID3 tags and some have typos or small differences in writing - so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override “artist” in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but artist is missing etc. Without touching the audio quality, of course (but this should be no problem, I think). I already tried tools in Winamp, Songbird and other players and currently most advanced free tool I tried is Tagscanner. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Wrong owner and group for files created under a samba shared directory

    - by agmao
    I am trying to make writing to a shared samba directory work. I got a very weird problem. Now the shared directory is writable from a client machine. But the files created under the samba share directory have weird owner and group names. I am writing to the shared directory as user mike under the client machine, but the file created always has user and group name as steve instead... Does anybody know why that would happen...? Another thing I just noticed is that on the samba server, the files have owner and user name as samba, which I created for samba clients. Thanks a lot

    Read the article

  • get a set of files that have been modified after a certain date

    - by jcollum
    Does anyone have a handy powershell script that gets a set of files from TFS based on a modification date? I'd like to say "give me all the files in this folder (or subfolder) that were modified after X/Y/ZZZZ" and dump those files to a folder other than the folder they would normally go to. I know enough powershell to hack about and get this done, eventually, but I'm hoping to avoid that.

    Read the article

  • multiple FileSystemWatchers to monitor files on local system?

    - by Jason Crowes
    We're writing a text editor like tool for our internal accounting package system that has actions that can be done by our own Xml language specs. These macro commands are specified in Xml files and we need the ability to monitor if files openned have bean modified externally. The only problem is that there maybe 20-30 files with different paths openned at any one time. Would it be good to use multiple FileSystemWatchers for this scenario? Or would it be better to monitor the root drive and catch specific events that match an open file in the editor (though lots of events could be raised). Some are local drives (C,D,E) others are their network drives (U,X,G,H). Files are quite chunky too about 300-400Kb.

    Read the article

  • CVS list of files only in working directories

    - by Joshua Berry
    Is it possible to get a list of files that are in the working directory tree, but not in the current branch/tag? I currently diff the working copy with another directory updated to the same module and tag/branch but without the local non-repo files. It works, but doesn't honor the .cvsignore files. I figure there must be an option using a variation of 'cvs diff'. Thanks in advance.

    Read the article

  • Prevent Chrome from automatically opening downloaded PDF and Image files

    - by Phoenix
    When I download a PDF or image in Google Chrome on my Mac, is it possible to prevent Chrome from automatically opening it in my default application for that file type (e.g., Preview)? I notice that Chrome does not do this for other downloaded files such as audio and ZIP archives. I still want to be able to preview files in Chrome; I just want to prevent it from automatically launching my image/PDF viewer application after I download them. For example: I click on a link in an email to a PDF document or an image file. Chrome displays the contents in the browser. I press Cmd-S and save the file to my computer. When the download finishes, the file opens automatically in Preview.app. It's that last step that I would like to bypass.

    Read the article

  • Advanced ID3 tags handling and audio files ordering

    - by Juhele
    Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Share files - Ubuntu 12.4 and Windows 7 - one network - password not accepted

    - by gotqn
    I have three machines - two with windows 7 and one with Ubuntu 12.4 version. There are in the same network connected by modem. The two machines shares file with no problem, but they can not see the machine with Ubuntu. On the other hand, I am able to see the share files of the windows machines from the Ubuntu's Network. When I select a folder, it wants the network password - I changed it several times in order to be sure that I am entering the correct one but in every case it says that the password is wrong. I have read some topics about files sharing between Linux and windows in which it is said that I should use samba, but is there a more easy way to do this, using the build it options?

    Read the article

  • Compile multiple C files with make

    - by Mohit Deshpande
    (I am running Linux Ubuntu 9.10, so the extension for an executable is executablefile.out) I am just getting into modular programming (programming with multiple files) in C and I want to know how to compile multiple files in a single makefile. For example, what would be the makefile to compile these files: main.c, dbAdapter.c, dbAdapter.h? (By the way, If you haven't figured it out yet, the main function is in main.c) Also could someone post a link to the documentation of a makefile?

    Read the article

  • Storage of various linux config files

    - by stantona
    I'm using git to track/store all my various config files required for linux. They're organized as if they live in my home directory, eg: .Xresources .config/ Awesome rc.lua .xmodmap .zshrc vim/ <- submodule emacs/ <- submodule etc I use git submodules for other things like vim/emacs configuration (since I also want to keep those separate repos). I'm thinking of creating a shell script to create the various links to these files. The goal is to make it easier to setup another linux painlessly. Is this a reasonable idea? Is there a preferred approach? I'm mostly interested in hearing how others people store their configs.

    Read the article

  • How restore qmail backup files

    - by Maysam
    We are using qmail as our mail application on a linux server. A few weeks ago our server crashed and we had everything installed from scratch and our users started to send & receive email again. The problem is they have lost their old emails. We have a back up of the whole qmail directory. But I don't know how to restore the old emails without losing the new ones. It's worth mentioning that I don't have any problem with restoring old sent mails. When I copy email files into .sent-mail/cur directory, I have them restored in sent box of users, but restoring files in /cur directory doesn't work for inbox emails and I can't get them restored.

    Read the article

  • How to make NetBeans IDE 6.8 show svn commit status (especially for "dirty" files)

    - by Andrew M. Andrews III
    I just switched from Eclipse to NetBeans IDE 6.8 for my PHP/Ajax development. Eclipse always showed a little hard disk symbol over the file icon for files that were in sync with the svn repository, and an asterisk for files with changes that have not been committed. Is there a way to see the commit status in NetBeans? If not, what is your preferred way of recognizing which files to commit?

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Using windows CopyFile function to copy all files with certain name format

    - by Ben313
    Hello! I am updating some C code that copys files with a certain name. basically, I have a directory with a bunch of files named like so: AAAAA.1.XYZ AAAAA.2.ZYX AAAAA.3.YZX BBBBB.1.XYZ BBBBB.2.ZYX Now, In the old code, they just used a call to ShellExecute and used xcopy.exe. to get all the files starting with AAAAA, they just gave xcopy the name of the file as AAAAA.* and it knew to copy all of the files starting with AAAAA. now, im trying to get it to copy with out having to use the command line, and I am running into trouble. I was hoping CopyFile would be smart enough to handle AAAAA.* as the file to be copied, but it doesnt at all do what xcopy did. So, any Ideas on how to do this without the external call to xcopy.exe?

    Read the article

  • unable to transfer files from handy cam to PC

    - by user143989
    I am using a Windows 7 PC,I am using sony dcr -sr88 handy cam . I need to transfer all my videos from handycam to my PC. when i try to connect to the PC through USB. it detects the usb drive in the Handycam on my PC and shows the used memory. But when i open the folder it shows "folder is empty". How i can copy the files? I have tried following: Changed the USB cable CHanged the USB port I can play the videos through handicam, but those files not visible in PC when connected in USB mode. Please help ..bit urgent!

    Read the article

  • Mixing two wav music files of different size

    - by iphoneDev
    Hi, I want to mix audio files of different size into a one single .wav file. There is a sample through which we can mix files of same size [(http://www.modejong.com/iOS/#ex4 )(Example 4)]. I modified the code to get the mixed file as a .wav file. But I am not able to understand that how to modify this code for unequal sized files. If someone can help me out with some code snippet,i'll be really thankful.

    Read the article

  • rsync server, uploaded files permissions incorrect

    - by fred basset
    I'm trying to setup an rsync server on my Ubuntu machine. Transfer from a local PC to the server via rsync does work, but the resultant uploaded files have no r,w or x bits set, e.g. ---------- 1 fredb fredb 0 Aug 30 20:50 sk_upgrade_20120830_033450.txt ---------- 1 fredb fredb 0 Aug 30 20:50 sk_user_20120827_184534.txt ---------- 1 fredb fredb 0 Aug 30 20:50 sk_user_20120830_033450.txt My rsyncd.conf file is: motd file = /etc/rsyncd.motd [workspace] path = /tmp comment = rsync server uid = nobody gid = nobody read only = false auth users = fredb secrets file = /etc/rsyncd.scrt How can I get the target files permissions correct? Also once I've solved this problem how can I transfer without a password? TY, Fred

    Read the article

  • Best Place to Store Config Files and Log Files on Windows for My Program?

    - by Dave
    I need to store log files and config files for my application. Where is the best place to store them? Right now I'm just using the current directory, which ends up putting them in the Program Files directory where my program lives. The log files will probably be accessed by the user somewhat regularly, so %APPDATA% seems a little hard to get to. Is a directory under %USERPROFILE%\My Documents the best? It needs to work for all versions of Windows from 2000 forward.

    Read the article

  • hosting acounts for large uploads

    - by Phil Jackson
    Hi, im wondering if anyone knows of any host providers ( uk preferably ) that deals mostly with accepting large file uploads. Most hosts only let you push something like 1.5mb ( thats taking into account the connection and the max execution time ). What i am looking for is a host specificaly for storing files on. I was going to create an upload script onto my application which posted the file to the external host and then return back ( using headers so the user doen't even know they have left ). Does anyone know of a host for this?

    Read the article

< Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >