Search Results

Search found 24073 results on 963 pages for 'mount point'.

Page 156/963 | < Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >

  • NFS I/O monitoring

    - by Gordon
    I have a NFS mounted directory, and I'd like to monitor the I/O usage on it (MB/s reads and writes). What's the recommended way to do that ? This is the NFS client, I don't have access to the NFS server. I'm not interested in general I/O usage (otherwise I would use vmstat/iostat). It also has multiple NFS mounts, I'm interested in monitoring just one specific mount (or I might have used ethereal). Thanks!

    Read the article

  • Recover harddrive data

    - by gameshints
    I have a dell laptop that recently "died" (It would get the blue screen of death upon starting) and the hard drive would make a weird cyclic clicking noises. I wanted to see if I could use some tools on my linux machine to recover the data, so I plugged it into there. If I run "fdisk" I get: Disk /dev/sdb: 20.0 GB, 20003880960 bytes 64 heads, 32 sectors/track, 19077 cylinders Units = cylinders of 2048 * 512 = 1048576 bytes Disk identifier: 0x64651a0a Disk /dev/sdb doesn't contain a valid partition table Fine, the partition table is messed up. However if I run "testdisk" in attempt to fix the table, it freezes at this point, making the same cyclical clicking noises: Disk /dev/sdb - 20 GB / 18 GiB - CHS 19078 64 32 Analyse cylinder 158/19077: 00% I don't really care about the hard drive working again, and just the data, so I ran "gpart" to figure out where the partitions used to be. I got this: dev(/dev/sdb) mss(512) chs(19077/64/32)(LBA) #s(39069696) size(19077mb) * Warning: strange partition table magic 0x2A55. Primary partition(1) type: 222(0xDE)(UNKNOWN) size: 15mb #s(31429) s(63-31491) chs: (0/1/1)-(3/126/63)d (0/1/32)-(15/24/4)r hex: 00 01 01 00 DE 7E 3F 03 3F 00 00 00 C5 7A 00 00 Primary partition(2) type: 007(0x07)(OS/2 HPFS, NTFS, QNX or Advanced UNIX) (BOOT) size: 19021mb #s(38956987) s(31492-38988478) chs: (4/0/1)-(895/126/63)d (15/24/5)-(19037/21/31)r hex: 80 00 01 04 07 7E FF 7F 04 7B 00 00 BB 6F 52 02 So I tried to mount just to the old NTFS partition, but got an error: sudo mount -o loop,ro,offset=16123904 -t ntfs /dev/sdb /mnt/usb NTFS signature is missing. Ugh. Okay. But then I tried to get a raw data dump by running dd if=/dev/sdb of=/home/erik/brokenhd skip=31492 count=38956987 But the file got up to 59885568 bytes, and made the same cyclical clicking noises. Obviously there is a bad sector, but I don't know what to do about it! The data is still there... if I view that 57MB file in textpad... I can see raw data from files. How can I get my data back? Thanks for any suggestions, Solution: I was able to recover about 90% of my data: Froze harddrive in freezer Used Ddrescue to make a copy of the drive Since Ddrescue wasn't able to get enough of my drive to use testdisk to recover my partitions/file system, I ended up using photorec to recover most of my files

    Read the article

  • C# WinForm Drawing - how to clear and redraw

    - by StoneHeart
    Here is screen shot of my game. On the left is my problem, seem "old draw" still existing. On the right is what it should be. http://img682.imageshack.us/img682/1058/38995989.jpg drawing code Graphics g = e.Graphics; for (int i = 1; i < 27; i += 1) { for (int j = 0; j < 18; j += 1) { ZPoint zp = zpoints[i, j]; if (zp != null) { g.DrawImage(zp.sprite_index, new Point(zp.x, zp.y)); Image arrow; if (zp.sprite_index == spr_green_zpoint) { arrow = spr_green_arrows[zp.image_index]; } else if (zp.sprite_index == spr_red_zpoint) { arrow = spr_red_arrows[zp.image_index]; } else { arrow = spr_grey_arrows[zp.image_index]; } g.DrawImage(arrow, new Point(zp.x - 4, zp.y - 4)); } } } if (latest_p1 != -1 && latest_p2 != -1) { ZPoint zp = zpoints[latest_p1, latest_p2]; if (zp != null) { g.DrawImage(spr_focus, new Point(zp.x - 6, zp.y - 6)); } }

    Read the article

  • TSQL - make a literal float value

    - by David B
    I understand the host of issues in comparing floats, and lament their use in this case - but I'm not the table author and have only a small hurdle to climb... Someone has decided to use floats as you'd expect GUIDs to be used. I need to retrieve all the records with a specific float value. sp_help MyTable -- Column_name Type Computed Length Prec -- RandomGrouping float no 8 53 Here's my naive attempt: --yields no results SELECT RandomGrouping FROM MyTable WHERE RandomGrouping = 0.867153569942739 And here's an approximately working attempt: --yields 2 records SELECT RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.867153569942739 - 0.00000001 AND 0.867153569942739 + 0.00000001 -- 0.867153569942739 -- 0.867153569942739 In my naive attempt, is that literal a floating point literal? Or is it really a decimal literal that gets converted later? If my literal is not a floating point literal, what is the syntax for making a floating point literal? EDIT: Another possibility has occurred to me... it may be that a more precise number than is displayed is stored in this column. It may be impossible to create a literal that represents this number. I will accept answers that demonstrate that this is the case. EDIT: response to DVK. TSQL is MSSQLServer's dialect of SQL. This script works, and so equality can be performed deterministically between float types: DECLARE @X float SELECT top 1 @X = RandomGrouping FROM MyTable WHERE RandomGrouping BETWEEN 0.839110948199148 - 0.000000000001 AND 0.839110948199148 + 0.000000000001 --yields two records SELECT * FROM MyTable WHERE RandomGrouping = @X I said "approximately" because that method tests for a range. With that method I could get values that are not equal to my intended value. The linked article doesn't apply because I'm not (intentionally) trying to straddle the world boundaries between decimal and float. I'm trying to work with only floats. This isn't about the non-convertibility of decimals to floats.

    Read the article

  • Read NTFS partition on RHEL 5.8

    - by Alex Farber
    I have RHEL 5.8 64 bit, and NTFS partition on the same disk. How can I get access to this partition? This answer Unable to mount NTFS drive with RHEL 6 doesn't work for me: [root@localhost alex]# rpm -Uvh http://download.fedora.redhat.com/pub/epel/6/i386/epel-release-6-5.noarch.rpm Retrieving http://download.fedora.redhat.com/pub/epel/6/i386/epel-release-6-5.noarch.rpm error: skipping http://download.fedora.redhat.com/pub/epel/6/i386/epel-release-6-5.noarch.rpm - transfer failed - Unknown or unexpected error

    Read the article

  • Signable, streamable, "readable" archive format?

    - by alexvoda
    Is there any archive format that offers the following: be digitally sign-able with a digital certificate from a trusted source like Verisign - for preventing changes to the file (I am not referring to read only, but in case the file was changed it should no longer be signed telling the user this is not the original file) be stream-able - be able to be opened even if not all of the content has been transfered (also not strictly linearly) be "readable" - be able to read the data without extracting to a temporary folder (AFAIK if you open a file in a zip archive it is extracted first, and this stays true even for zip based formats like OOXML. This is not what I want) be portable - support on at least Windows, Linux and Mac OS X is a must, or at least future support be free of patents - Be open source - also preferably a license that allows commercial use(as far as i know GPL a share-alike licence so it doesn't allow comercial use, BSD on the other hand alows it) Note: Though it may come in handy eventually I can not think right now of a scenario that would require both point 1 and point 2 simultaneously. Or lets leave it a be able to check the signature only when the whole file was downloaded. I am not interested in: being able to be compressed being supported on legacy systems Does any existing archive format fit this description (tar evolutions like DAR and pax come to mind) ? If there is, are there programing libraries available for the above mentioned OSs? If not, would it be hard to create such a thing? EDIT: clarrified piont 5 EDIT 2: added a note to clarify point 1 and 2 P.S.: This is my first question on StackOverflow

    Read the article

  • how to install debian from a rescue cd (via ssh)

    - by tommy
    situation: server with RAID 1 (2x1000GB) currently logged in via SSH (network based debian rescue cd) need to accomplish: install a debian based Xen (maybe with: http://wiki.xen.org/xenwiki/LiveCD ?) keep RAID 1 problem: I have no physical access to the server, so i can't just drop in a cd or plug-in a usb drive. Does anyone have an ideas (or a tutorial handy) on how I can mount the LiveCD (on a read-only rescue-cd??) and the install the distru without breaking the RAID?

    Read the article

  • A weird crash...

    - by Nima
    Hi, I have a piece of code that runs in debug mode in VS2008, C++. The problem is that when I am debugging the code line by line, at a very weird point of the code, it crashes and says: debug assertion faild. Expression: _BLOCK_TYPE_IS_VALID(pHead-nBlockUse) The crash point is on the first closed curly bracket (after mesh-edges[e].needsUpdate=false;) I don't understand why on a curly bracket? does that make sense to you guys? Can anybody help me understanding what is going on..? for(int e=0; e<mesh->edges.size(); e++) { if(mesh->edges[e].valid && mesh->edges[e].v[0]>=0 && mesh->edges[e].v[1]>=0 && mesh->points[mesh->edges[e].v[0]].writable && mesh->points[mesh->edges[e].v[1]].writable) { //update v_hat and its corresponding error DecEdge Current = DecEdge(e); pair<Point, float> ppf = computeVhat(e); Current.v_hat = ppf.first; Current.error = ppf.second; edgeSoup.push(Current); mesh->edges[e].needsUpdate=false; } }

    Read the article

  • Software Raid 10 corrupted superblock after dual disk failure, how do I recover it?

    - by Shoshomiga
    I have a software raid 10 with 6 x 2tb hard drives (raid 1 for /boot), ubuntu 10.04 is the os. I had a raid controller failure that put 2 drives out of sync, crashed the system and initially the os didnt boot up and went into initramfs instead, saying that drives were busy but I eventually managed to bring the raid up by stopping and assembling the drives. The os booted up and said that there were filesystem errors, I chose to ignore because it would remount the fs in read-only mode if there was a problem. Everything seemed to be working fine and the 2 drives started to rebuild, I was sure that it was a sata controller failure because I had dma errors in my log files. The os crashed soon after that with ext errors. Now its not bringing up the raid, it says that there is no superblock on /dev/sda2, even if I assemble manually with all the device names. I also did a memtest and changed the motherboard in addition to everything else. EDIT: This is my partition layout Disk /dev/sdb: 2000.4 GB, 2000398934016 bytes 255 heads, 63 sectors/track, 243201 cylinders, total 3907029168 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 4096 bytes I/O size (minimum/optimal): 4096 bytes / 4096 bytes Disk identifier: 0x0009c34a Device Boot Start End Blocks Id System /dev/sdb1 * 2048 511999 254976 83 Linux /dev/sdb2 512000 3904980991 1952234496 83 Linux /dev/sdb3 3904980992 3907028991 1024000 82 Linux swap / Solaris All 6 disks have the same layout, partition #1 is for raid 1 /boot, partition #2 is for raid 10 far plan, partition #3 is swap, but sda did not have swap enabled EDIT2: This is the output of mdadm --detail /dev/md1 Layout : near=1, far=2 Chunk Size : 64k UUID : a0feff55:2018f8ff:e368bf24:bd0fce41 Events : 0.3112126 Number Major Minor RaidDevice State 0 8 34 0 spare rebuilding /dev/sdc2 1 0 0 1 removed 2 8 18 2 active sync /dev/sdb2 3 8 50 3 active sync /dev/sdd2 4 0 0 4 removed 5 8 82 5 active sync /dev/sdf2 6 8 66 - spare /dev/sde2 EDIT3: I ran ddrescue and it has copied everything from sda except a single 4096 byte sector that I suspect is the raid superblock EDIT4: Here is some more info too long to fit here lshw: http://pastebin.com/2eKrh7nF mdadm --detail /dev/sd[abcdef]1 (raid1): http://pastebin.com/cgMQWerS mdadm --detail /dev/sd[abcdef]2 (raid10): http://pastebin.com/V5dtcGPF dumpe2fs of /dev/sda2 (from the ddrescue cloned drive): http://pastebin.com/sp0GYcJG I tried to recreate md1 based on this info with the command mdadm --create /dev/md1 -v --assume-clean --level=10 --raid-devices=6 --chunk=64K --layout=f2 /dev/sda2 missing /dev/sdc2 /dev/sdd2 missing /dev/sdf2 But I can't mount it, I also tried to recreate it based on my initial mdadm --detail /dev/md1 but it still doesn't mount It also warns me that /dev/sda2 is an ext2fs file system but I guess its because of ddrescue

    Read the article

  • Systems design question: DB connection management in load-balanced n-tier

    - by aoven
    I'm wondering about the best approach to designing a DB connection manager for a load-balanced n-tier system. Classic n-tier looks like this: Client -> BusinessServer -> DBServer A load-balancing solution as I see it would then look like this: +--> ... +--+ +--> BusinessServer +--+--> SessionServer --+ Client -> Gateway --+--> BusinessServer +--| +--> DBServer +--> BusinessServer +--+--------------------+ +--> ... +--+ As pictured, the business server component is being load-balanced via multiple instances, and a hardware gateway is distributing the load among them. Session server probably needs to be situated outside the load-balancing array, because it manages state, which mustn't be duplicated. Barring any major errors in design so far, what is the best way to implement DB connection management? I've come up with a couple of options, but there may be others I'm not aware of: Introduce a new Broker component between the DBServer and the other components and let it handle the DB connections. The upside is that all the connections can be managed from a single point, which is very convenient. The downside is that now there is an additional "single point of failure" in the system. Other components must go through it for every request that involves DB in some way, which also makes this a bottleneck. Move the DB connection management into BusinessServer and SessionServer components and let each handle its own DB connections. The upside is that there is no additional "single point of failure" or bottleneck components. The downside is that there is also no control over possible conflicts and deadlocks apart from what DBServer itself can provide. What else can be done? FWIW: Technology is .NET, but none of the vendor-specific stacks are used (e.g. no WCF, MSMQ or the like).

    Read the article

  • Float addition promoted to double?

    - by Andreas Brinck
    I had a small WTF moment this morning. Ths WTF can be summarized with this: float x = 0.2f; float y = 0.1f; float z = x + y; assert(z == x + y); //This assert is triggered! (Atleast with visual studio 2008) The reason seems to be that the expression x + y is promoted to double and compared with the truncated version in z. (If i change z to double the assert isn't triggered). I can see that for precision reasons it would make sense to perform all floating point arithmetics in double precision before converting the result to single precision. I found the following paragraph in the standard (which I guess I sort of already knew, but not in this context): 4.6.1. "An rvalue of type float can be converted to an rvalue of type double. The value is unchanged" My question is, is x + y guaranteed to be promoted to double or is at the compiler's discretion? UPDATE: Since many people has claimed that one shouldn't use == for floating point, I just wanted to state that in the specific case I'm working with, an exact comparison is justified. Floating point comparision is tricky, here's an interesting link on the subject which I think hasn't been mentioned.

    Read the article

  • Read floppy from OpenVMS machine

    - by Goyuix
    I have a floppy I need to read the contents from - unfortunately it was formatted and the data written on an OpenVMS server. I believe the floppy is formatted "Files-11" and I can see parts of the MFT [equivalent] and file contents through a hex editor, however I would love to be able to mount this and actually read the files off. Is there a Files-11 FUSE module or other kernel module I can install to read this format? Any standalone utilities that can understand a floppy image taken with dd?

    Read the article

  • Error with mounting partiotn ubuntu

    - by Master
    I have ext3 partition and i get this error mount: wrong fs type, bad option, bad superblock on /dev/sdb1, missing codepage or helper program, or other error In some cases useful info is found in syslog - try dmesg | tail or so Command in fstab is /dev/sdb1 /media/Server ext3 defaults 0 0

    Read the article

  • Auto-implemented getters and setters vs. public fields

    - by tclem
    I see a lot of example code for C# classes that does this: public class Point { public int x { get; set; } public int y { get; set; } } Or, in older code, the same with an explicit private backing value and without the new auto-implemented properties: public class Point { private int _x; private int _y; public int x { get { return _x; } set { _x = value; } } public int y { get { return _y; } set { _y = value; } } } My question is why. Is there any functional difference between doing the above and just making these members public fields, like below? public class Point { public int x; public int y; } To be clear, I understand the value of getters and setters when you need to do some translation of the underlying data. But in cases where you're just passing the values through, it seems needlessly verbose.

    Read the article

  • Creating a really public Windows network share

    - by Timur Aydin
    I want to create a shared folder under Windows (actually, Windows XP, Vista, and Win 7) which can be mounted from a linux system without prompting for a username/password. But before attempting this, I first wanted to establish that this works between two Windows 7 machines. So, on machine A (The server that will hold the public share), I created a folder and set its permissions such that Everyone has read/write access. Then I visited Control Panel - Network and Sharing Center - Advanced Sharing Settings and then selected "Turn off password protected sharing". Then, on machine B (The client that wants to access the public share with no username/password prompt), I tried to "map network driver" and I was immediately prompted by a password prompt. Some search on google suggested changing "Acconts: Limit local account use of blank passwords to console logon only" to "Disabled". Tried that, no luck, still getting username/password prompt. If I enter the username/password, I am not prompted for it again and can use the share as long as the session is active. But still, I really need to access the share without any username/password transaction whatsoever and this is not just a convenience related thing. Here is the actual reason: The device that will access this windows network share is an embedded system running uclinux. It will mount this share locally and then play media files. Its only user interface is a javascript based web page. So, if there is going to be any username/password transaction, I would have to ask the user to enter them over the web page, which will be ridiculously insecure and completely exposed to packet sniffing. After hours of doing experiments, I have found one way to make this happen, but I am not really very fond of it... I first create a new user (shareuser) and give it a password (sharepass). Then I open Group Policy Editor and set "Deny log on locally" to "A\shareuser". Then, I create a folder on A and share it so that shareuser has Read access to it. This way, shareuser cannot login to A, but can access the shared folder. And, if someone discovers the shareuser/sharepass through network sniffing, they can just access the shared folder, but can't logon to A. The same thing can be achieved by enabling the Guest user and then going to Group Policy Editor and deleting the "Guest" from the "Deny access to this computer from the network" setting. Again, Guest can mount the public share, but logging in to A as Guest won't be possible, because Guest is already not allowed to log in by default. So my question would be, how can I create a network share that is truly public, so that it can be mounted from a linux machine without requiring a password? Sorry for the long question, but I wanted to explain the reason for really needing this...

    Read the article

  • Google Maps API v3 not working

    - by user1496322
    I've been banging my head on the wall after going through the documentation on this several times! I can't seem to get past the API error to get the map to appear on my site. I am getting the following error message from the web page where I want the map to be displayed: ~~~~~~~~~~~ Google has disabled use of the Maps API for this application. The provided key is not a valid Google API Key, or it is not authorized for the Google Maps Javascript API v3 on this site. If you are the owner of this application, you can learn about obtaining a valid key here: https://developers.google.com/maps/documentation/javascript/tutorial#Obtaining_Key ~~~~~~~~~~~ I have (several times now) gone into my account and 1) enabled the Maps v3 API service. 2) Generated a new API key. and 3) added my allowed referrers to the key. (both www.domain.com and domain.com URLs) I have the following added to the head of the web page: < script src="http://maps.googleapis.com/maps/api/js?sensor=false&key=MY_API_KEY_HERE" type="text/JavaScript" language="JavaScript" And... I have the following javascript function that executes when a link is clicked on the page: alert("viewMap()"); var map = new GMap3(document.getElementById("map_canvas")); var geocoder = new GClientGeocoder(); var address = "1600 Amphitheatre Parkway, Mountain View"; alert("Calling getLatLng ..."); geocoder.getLatLng(address, function(point) { var latitude = point.y; var longitude = point.x; // do something with the lat lng alert("Lat:"+latitude+" - Lng:"+longitude); }); The initial 'viewMap' alert is displayed and then is followed by the 'Google has disbled use...' error message. The error console is also showing 'GMap3 is not defined'. Can anyone please assist with showing me the errors of my ways?!?!? Thank you in advance for any help you can provide. -Dennis

    Read the article

  • Cannot call DLL import entry in C# from C++ project. EntryPointNotFoundException

    - by kriau
    I'm trying to call from C# a function in a custom DLL written in C++. However I'm getting the warning during code analysis and the error at runtime: Warning: CA1400 : Microsoft.Interoperability : Correct the declaration of 'SafeNativeMethods.SetHook()' so that it correctly points to an existing entry point in 'wi.dll'. The unmanaged entry point name currently linked to is SetHook. Error: System.EntryPointNotFoundException was unhandled. Unable to find an entry point named 'SetHook' in DLL 'wi.dll'. Both projects wi.dll and C# exe has been compiled in to the same DEBUG folder, both files reside here. There is only one file with the name wi.dll in the whole file system. C++ function definition looks like: #define WI_API __declspec(dllexport) bool WI_API SetHook(); I can see exported function using Dependency Walker: as decorated: bool SetHook(void) as undecorated: ?SetHook@@YA_NXZ C# DLL import looks like (I've defined these lines using CLRInsideOut from MSDN magazine): [DllImport("wi.dll", EntryPoint = "SetHook", CallingConvention = CallingConvention.Cdecl)] [return: MarshalAsAttribute(UnmanagedType.I1)] internal static extern bool SetHook(); I've tried without EntryPoint and CallingConvention definitions as well. Both projects are 32-bits, I'm using W7 64 bits, VS 2010 RC. I believe that I simply have overlooked something.... Thanks in advance.

    Read the article

  • Linux - quota per directory?

    - by depesz
    I have following scenarios: Single partition mounted as /, with lots of disk space. There is a range of directories (/pg/tbs1, /pg/tbs2, /pg/tbs3 and so on), and I would like to limit total size of these directories. One option is to make some big files, and then mkfs them, and mount over loopback, and then set quota, but this makes expansion a bit problematic. Is there any other way to make the quota work per directory?

    Read the article

  • Methods of cooling with no more room in case?

    - by Wesley
    Hi all, I've got an HP DC7100 and an HP m8530f. The DC7100 is a small form factor desktop while the m8530f has a mATX board with lots of extra features like front I/O and HP Personal Media Drive bay. Both of these have very little space (especially the DC7100) and don't have any other places to mount fans. What other possible ways of cooling are there, if there isn't much space left inside the case? Thanks in advance.

    Read the article

  • Why doesn't this data binding work?

    - by Qwertie
    I have a ViewModel class that contains a list of points, and I am trying to bind it to a Polyline. The Polyline picks up the initial list of points, but does not notice when additional points are added even though I implement INotifyPropertyChanged. What's wrong? <StackPanel> <Button Click="Button_Click">Add!</Button> <Polyline x:Name="_line" Points="{Binding Pts}" Stroke="Black" StrokeThickness="5"/> </StackPanel> C# side: // code-behind _line.DataContext = new ViewModel(); private void Button_Click(object sender, RoutedEventArgs e) { // The problem is here: NOTHING HAPPENS ON-SCREEN! ((ViewModel)_line.DataContext).AddPoint(); } // ViewModel class public class ViewModel : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public PointCollection Pts { get; set; } public ViewModel() { Pts = new PointCollection(); Pts.Add(new Point(1, 1)); Pts.Add(new Point(11, 11)); } public void AddPoint() { Pts.Add(new Point(25, 13)); if (PropertyChanged != null) PropertyChanged(this, new PropertyChangedEventArgs("Pts")); } }

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • how to add text in a created table in a richtextbox?

    - by francops henri
    I created a table in richtextbox like this : //Since too much string appending go for string builder StringBuilder tableRtf = new StringBuilder(); //beginning of rich text format,dont customize this begining line tableRtf.Append(@"{\rtf1 "); //create 5 rows with 3 cells each for (int i = 0; i < 5; i++) { tableRtf.Append(@"\trowd"); //A cell with width 1000. tableRtf.Append(@"\cellx1000"); //Another cell with width 2000.end point is 3000 (which is 1000+2000). tableRtf.Append(@"\cellx2000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx3000"); //Another cell with width 1000.end point is 4000 (which is 3000+1000) tableRtf.Append(@"\cellx4000"); tableRtf.Append(@"\intbl \cell \row"); //create row } tableRtf.Append(@"\pard"); tableRtf.Append(@"}"); this.misc_tb.Rtf = tableRtf.ToString(); Now I want to know how I can put text in headers and in each cells. Do you have an idea? Thanks

    Read the article

  • Creating rescue / install USB flash disk for CentOS

    - by wwwpanda
    For CentOS installation CDs, you can install OS, as well as booting into "rescue" mode so that you can do a chroot mount on the system partition for problem solving, even the system is installed in hardware RAID drives. How can we create a similar thing but on usb flash drive? I tried to do it with unetbootin, but when booting into the USB, eventually the CentOS setup still requires presence of CDs. Ultimately, I want to use this usb flash drive for remote disaster recovery through say HP iLo remote console / Dell iDrac etc.

    Read the article

  • What is the state of ext3 support in Mac OS X 10.6? [closed]

    - by gzuki
    Possible Duplicate: Mount ext2/ext3 in Mac OS X Snow Leopard I have a 1tb hard drive, I want it to have one partition that can serve as an interchange between linux (ubuntu) and mac (snow leopard). HFS+ scares me a bit, and I can't seem to get a clear picture on whether or not something like fuse can reliably write ext3 partitions in mac. Any good advice on this topic? Should I just pick HFS+ or ext3 and hope for the best (or just deal with only getting read-only on one OS)?

    Read the article

< Previous Page | 152 153 154 155 156 157 158 159 160 161 162 163  | Next Page >