Search Results

Search found 13534 results on 542 pages for 'python 2 1'.

Page 157/542 | < Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >

  • [Tkinter/Python] Different line widths with canvas.create_line?

    - by Sam
    Does anyone have any idea why I get different line widths on the canvas in the following example? from Tkinter import * bigBoxSize = 150 class cFrame(Frame): def __init__(self, master, cwidth=450, cheight=450): Frame.__init__(self, master, relief=RAISED, height=550, width=600, bg = "grey") self.canvasWidth = cwidth self.canvasHeight = cheight self.canvas = Canvas(self, bg="white", width=cwidth, height=cheight, border =0) self.drawGridLines() self.canvas.pack(side=TOP, pady=20, padx=20) def drawGridLines(self, linewidth = 10): self.canvas.create_line(0, 0, self.canvasWidth, 0, width= linewidth ) self.canvas.create_line(0, 0, 0, self.canvasHeight, width= linewidth ) self.canvas.create_line(0, self.canvasHeight, self.canvasWidth + 2, self.canvasHeight, width= linewidth ) self.canvas.create_line(self.canvasWidth, self.canvasHeight, self.canvasWidth, 1, width= linewidth ) self.canvas.create_line(0, bigBoxSize, self.canvasWidth, bigBoxSize, width= linewidth ) self.canvas.create_line(0, bigBoxSize * 2, self.canvasWidth, bigBoxSize * 2, width= linewidth) root = Tk() C = cFrame(root) C.pack() root.mainloop() It's really frustrating me as I have no idea what's happening. If anyone can help me out then that'd be fantastic. Thanks!

    Read the article

  • Python unicode search not giving correct answer

    - by user1318912
    I am trying to search hindi words contained one line per file in file-1 and find them in lines in file-2. I have to print the line numbers with the number of words found. This is the code: import codecs hypernyms = codecs.open("hindi_hypernym.txt", "r", "utf-8").readlines() words = codecs.open("hypernyms_en2hi.txt", "r", "utf-8").readlines() count_arr = [] for counter, line in enumerate(hypernyms): count_arr.append(0) for word in words: if line.find(word) >=0: count_arr[counter] +=1 for iterator, count in enumerate(count_arr): if count>0: print iterator, ' ', count This is finding some words, but ignoring some others The input files are: File-1: ???? ??????? File-2: ???????, ????-???? ?????-???, ?????-???, ?????_???, ?????_??? ????_????, ????-????, ???????_???? ????-???? This gives output: 0 1 3 1 Clearly, it is ignoring ??????? and searching for ???? only. I have tried with other inputs as well. It only searches for one word. Any idea how to correct this?

    Read the article

  • Python - pickling fails for numpy.void objects

    - by I82Much
    >>> idmapfile = open("idmap", mode="w") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap") >>> unpickled = pickle.load(idmapfile) >>> unpickled == idMap False idMap[1] {1537: (552, 1, 1537, 17.793827056884766, 3), 1540: (4220, 1, 1540, 19.31205940246582, 3), 1544: (592, 1, 1544, 18.129131317138672, 3), 1675: (529, 1, 1675, 18.347782135009766, 3), 1550: (4048, 1, 1550, 19.31205940246582, 3), 1424: (1528, 1, 1424, 19.744396209716797, 3), 1681: (1265, 1, 1681, 19.596025466918945, 3), 1560: (3457, 1, 1560, 20.530569076538086, 3), 1690: (477, 1, 1690, 17.395542144775391, 3), 1691: (554, 1, 1691, 13.446117401123047, 3), 1436: (3010, 1, 1436, 19.596025466918945, 3), 1434: (3183, 1, 1434, 19.744396209716797, 3), 1441: (3570, 1, 1441, 20.589576721191406, 3), 1435: (476, 1, 1435, 19.640911102294922, 3), 1444: (527, 1, 1444, 17.98480224609375, 3), 1478: (1897, 1, 1478, 19.596025466918945, 3), 1575: (614, 1, 1575, 19.371648788452148, 3), 1586: (2189, 1, 1586, 19.31205940246582, 3), 1716: (3470, 1, 1716, 19.158674240112305, 3), 1590: (2278, 1, 1590, 19.596025466918945, 3), 1463: (991, 1, 1463, 19.31205940246582, 3), 1594: (1890, 1, 1594, 19.596025466918945, 3), 1467: (1087, 1, 1467, 19.31205940246582, 3), 1596: (3759, 1, 1596, 19.744396209716797, 3), 1602: (3011, 1, 1602, 20.530569076538086, 3), 1547: (490, 1, 1547, 17.994071960449219, 3), 1605: (658, 1, 1605, 19.31205940246582, 3), 1606: (1794, 1, 1606, 16.964881896972656, 3), 1719: (1826, 1, 1719, 19.596025466918945, 3), 1617: (583, 1, 1617, 11.894925117492676, 3), 1492: (3441, 1, 1492, 20.500667572021484, 3), 1622: (3215, 1, 1622, 19.31205940246582, 3), 1628: (2761, 1, 1628, 19.744396209716797, 3), 1502: (1563, 1, 1502, 19.596025466918945, 3), 1632: (1108, 1, 1632, 15.457141876220703, 3), 1468: (3779, 1, 1468, 19.596025466918945, 3), 1642: (3970, 1, 1642, 19.744396209716797, 3), 1518: (612, 1, 1518, 18.570245742797852, 3), 1647: (854, 1, 1647, 16.964881896972656, 3), 1650: (2099, 1, 1650, 20.439058303833008, 3), 1651: (540, 1, 1651, 18.552841186523438, 3), 1653: (613, 1, 1653, 19.237197875976563, 3), 1532: (537, 1, 1532, 18.885730743408203, 3)} >>> unpickled[1] {1537: (64880, 1638, 56700, -1.0808743559293829e+18, 152), 1540: (64904, 1638, 0, 0.0, 0), 1544: (54472, 1490, 0, 0.0, 0), 1675: (6464, 1509, 0, 0.0, 0), 1550: (43592, 1510, 0, 0.0, 0), 1424: (43616, 1510, 0, 0.0, 0), 1681: (0, 0, 0, 0.0, 0), 1560: (400, 152, 400, 2.1299736657737219e-43, 0), 1690: (408, 152, 408, 2.7201111331839077e+26, 34), 1435: (424, 152, 61512, 1.0122952080313192e-39, 0), 1436: (400, 152, 400, 20.250289916992188, 3), 1434: (424, 152, 62080, 1.0122952080313192e-39, 0), 1441: (400, 152, 400, 12.250144958496094, 3), 1691: (424, 152, 42608, 15.813941955566406, 3), 1444: (400, 152, 400, 19.625289916992187, 3), 1606: (424, 152, 42432, 5.2947192852601414e-22, 41), 1575: (400, 152, 400, 6.2537390010262572e-36, 0), 1586: (424, 152, 42488, 1.0122601755697111e-39, 0), 1716: (400, 152, 400, 6.2537390010262572e-36, 0), 1590: (424, 152, 64144, 1.0126357235581501e-39, 0), 1463: (400, 152, 400, 6.2537390010262572e-36, 0), 1594: (424, 152, 32672, 17.002994537353516, 3), 1467: (400, 152, 400, 19.750289916992187, 3), 1596: (424, 152, 7176, 1.0124003054161436e-39, 0), 1602: (400, 152, 400, 18.500289916992188, 3), 1547: (424, 152, 7000, 1.0124003054161436e-39, 0), 1605: (400, 152, 400, 20.500289916992188, 3), 1478: (424, 152, 42256, -6.0222748507426518e+30, 222), 1719: (400, 152, 400, 6.2537390010262572e-36, 0), 1617: (424, 152, 16472, 1.0124283313854301e-39, 0), 1492: (400, 152, 400, 6.2537390010262572e-36, 0), 1622: (424, 152, 35304, 1.0123190301052127e-39, 0), 1628: (400, 152, 400, 6.2537390010262572e-36, 0), 1502: (424, 152, 63152, 19.627988815307617, 3), 1632: (400, 152, 400, 19.375289916992188, 3), 1468: (424, 152, 38088, 1.0124213248931084e-39, 0), 1642: (400, 152, 400, 6.2537390010262572e-36, 0), 1518: (424, 152, 63896, 1.0127436235399031e-39, 0), 1647: (400, 152, 400, 6.2537390010262572e-36, 0), 1650: (424, 152, 53424, 16.752857208251953, 3), 1651: (400, 152, 400, 19.250289916992188, 3), 1653: (424, 152, 50624, 1.0126497365427934e-39, 0), 1532: (400, 152, 400, 6.2537390010262572e-36, 0)} The keys come out fine, the values are screwed up. I tried same thing loading file in binary mode; didn't fix the problem. Any idea what I'm doing wrong? Edit: Here's the code with binary. Note that the values are different in the unpickled object. >>> idmapfile = open("idmap", mode="wb") >>> pickle.dump(idMap, idmapfile) >>> idmapfile.close() >>> idmapfile = open("idmap", mode="rb") >>> unpickled = pickle.load(idmapfile) >>> unpickled==idMap False >>> unpickled[1] {1537: (12176, 2281, 56700, -1.0808743559293829e+18, 152), 1540: (0, 0, 15934, 2.7457842047810522e+26, 108), 1544: (400, 152, 400, 4.9518498821046956e+27, 53), 1675: (408, 152, 408, 2.7201111331839077e+26, 34), 1550: (456, 152, 456, -1.1349175514578289e+18, 152), 1424: (432, 152, 432, 4.5939047815653343e-40, 11), 1681: (408, 152, 408, 2.1299736657737219e-43, 0), 1560: (376, 152, 376, 2.1299736657737219e-43, 0), 1690: (376, 152, 376, 2.1299736657737219e-43, 0), 1435: (376, 152, 376, 2.1299736657737219e-43, 0), 1436: (376, 152, 376, 2.1299736657737219e-43, 0), 1434: (376, 152, 376, 2.1299736657737219e-43, 0), 1441: (376, 152, 376, 2.1299736657737219e-43, 0), 1691: (376, 152, 376, 2.1299736657737219e-43, 0), 1444: (376, 152, 376, 2.1299736657737219e-43, 0), 1606: (25784, 2281, 376, -3.2883343074537754e+26, 34), 1575: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1586: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1716: (24240, 2281, 376, -3.0093091599657311e-35, 26), 1590: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1463: (24240, 2281, 376, 2.1299736657737219e-43, 0), 1594: (24240, 2281, 376, -4123208450048.0, 196), 1467: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1596: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1602: (25784, 2281, 376, -5.9963281433905448e+26, 76), 1547: (25784, 2281, 376, -218106240.0, 139), 1605: (25784, 2281, 376, -3.7138649803377281e+27, 56), 1478: (376, 152, 376, 2.1299736657737219e-43, 0), 1719: (25784, 2281, 376, 2.1299736657737219e-43, 0), 1617: (25784, 2281, 376, -1.4411779941597184e+17, 237), 1492: (25784, 2281, 376, 2.8596493694487798e-30, 80), 1622: (25784, 2281, 376, 184686084096.0, 93), 1628: (1336, 152, 1336, 3.1691839245470052e+29, 179), 1502: (1272, 152, 1272, -5.2042207205116645e-17, 99), 1632: (1208, 152, 1208, 2.1299736657737219e-43, 0), 1468: (1144, 152, 1144, 2.1299736657737219e-43, 0), 1642: (1080, 152, 1080, 2.1299736657737219e-43, 0), 1518: (1016, 152, 1016, 4.0240902787680023e+35, 145), 1647: (952, 152, 952, -985172619034624.0, 237), 1650: (888, 152, 888, 12094787289088.0, 66), 1651: (824, 152, 824, 2.1299736657737219e-43, 0), 1653: (760, 152, 760, 0.00018310768064111471, 238), 1532: (696, 152, 696, 8.8978061885676389e+26, 125)} OK I've isolated the problem, but don't know why it's so. First, apparently what I'm pickling are not tuples (though they look like it), but instead numpy.void types. Here is a series to illustrate the problem. first = run0.detections[0] >>> first (1, 19, 1578, 82.637763977050781, 1) >>> type(first) <type 'numpy.void'> >>> firstTuple = tuple(first) >>> theFile = open("pickleTest", "w") >>> pickle.dump(first, theFile) >>> theTupleFile = open("pickleTupleTest", "w") >>> pickle.dump(firstTuple, theTupleFile) >>> theFile.close() >>> theTupleFile.close() >>> first (1, 19, 1578, 82.637763977050781, 1) >>> firstTuple (1, 19, 1578, 82.637764, 1) >>> theFile = open("pickleTest", "r") >>> theTupleFile = open("pickleTupleTest", "r") >>> unpickledTuple = pickle.load(theTupleFile) >>> unpickledVoid = pickle.load(theFile) >>> type(unpickledVoid) <type 'numpy.void'> >>> type(unpickledTuple) <type 'tuple'> >>> unpickledTuple (1, 19, 1578, 82.637764, 1) >>> unpickledTuple == firstTuple True >>> unpickledVoid == first False >>> unpickledVoid (7936, 1705, 56700, -1.0808743559293829e+18, 152) >>> first (1, 19, 1578, 82.637763977050781, 1)

    Read the article

  • Python RegExp exception

    - by Jasie
    How do I split on all nonalphanumeric characters, EXCEPT the apostrophe? re.split('\W+',text) works, but will also split on apostrophes. How do I add an exception to this rule? Thanks!

    Read the article

  • python cairoplot store previous readings..

    - by krisdigitx
    hi, i am using cairoplot, to make graphs, however the file from where i am reading the data is growing huge and its taking a long time to process the graph is there any real-time way to produce cairo graph, or at least store the previous readings..like rrd. -krisdigitx

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • varargs in lambda functions in Python

    - by brain_damage
    Is it possible a lambda function to have variable number of arguments? For example, I want to write a metaclass, which creates a method for every method of some other class and this newly created method returns the opposite value of the original method and has the same number of arguments. And I want to do this with lambda function. How to pass the arguments? Is it possible? class Negate(type): def __new__(mcs, name, bases, _dict): extended_dict = _dict.copy() for (k, v) in _dict.items(): if hasattr(v, '__call__'): extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) return type.__new__(mcs, name, bases, extended_dict) class P(metaclass=Negate): def __init__(self, a): self.a = a def yes(self): return True def maybe(self, you_can_chose): return you_can_chose But the result is totally wrong: >>>p = P(0) >>>p.yes() True >>>p.not_yes() # should be False Traceback (most recent call last): File "<pyshell#150>", line 1, in <module> p.not_yes() File "C:\Users\Nona\Desktop\p10.py", line 51, in <lambda> extended_dict["not_" + k] = lambda s, *args, **kw: not v(s, *args, **kw) TypeError: __init__() takes exactly 2 positional arguments (1 given) >>>p.maybe(True) True >>>p.not_maybe(True) #should be False True

    Read the article

  • Python string formatting too slow

    - by wich
    I use the following code to log a map, it is fast when it only contains zeroes, but as soon as there is actual data in the map it becomes unbearably slow... Is there any way to do this faster? log_file = open('testfile', 'w') for i, x in ((i, start + i * interval) for i in range(length)): log_file.write('%-5d %8.3f %13g %13g %13g %13g %13g %13g\n' % (i, x, map[0][i], map[1][i], map[2][i], map[3][i], map[4][i], map[5][i]))

    Read the article

  • python logparse search specific text

    - by krisdigitx
    hi, I am using this function in my code to return the strings i want from reading the log file, I want to grep the "exim" process and return the results, but running the code gives no error, but the output is limited to three lines, how can i just get the output only related to exim process.. #output: {'date': '13', 'process': 'syslogd', 'time': '06:27:33', 'month': 'May'} {'date': '13', 'process': 'exim[23168]:', 'time': '06:27:33', 'month': 'May'} {'May': ['syslogd']} #function: def generate_log_report(logfile): report_dict = {} for line in logfile: line_dict = dictify_logline(line) print line_dict try: month = line_dict['month'] date = line_dict['date'] time = line_dict['time'] #process = line_dict['process'] if "exim" in line_dict['process']: process = line_dict['process'] break else: process = line_dict['process'] except ValueError: continue report_dict.setdefault(month, []).append(process) return report_dict

    Read the article

  • Dynamic Operator Overloading on dict classes in Python

    - by Ishpeck
    I have a class that dynamically overloads basic arithmetic operators like so... import operator class IshyNum: def __init__(self, n): self.num=n self.buildArith() def arithmetic(self, other, o): return o(self.num, other) def buildArith(self): map(lambda o: setattr(self, "__%s__"%o,lambda f: self.arithmetic(f, getattr(operator, o))), ["add", "sub", "mul", "div"]) if __name__=="__main__": number=IshyNum(5) print number+5 print number/2 print number*3 print number-3 But if I change the class to inherit from the dictionary (class IshyNum(dict):) it doesn't work. I need to explicitly def __add__(self, other) or whatever in order for this to work. Why?

    Read the article

  • Python recursion with list returns None

    - by newman
    def foo(a): a.append(1) if len(a) > 10: print a return a else: foo(a) Why this recursive function returns None (see transcript below)? I can't quite understand what I am doing wrong. In [263]: x = [] In [264]: y = foo(x) [1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1] In [265]: print y None

    Read the article

  • Efficient way in Python to remove an element from a comma-separated string

    - by ensnare
    I'm looking for the most efficient way to add an element to a comma-separated string while maintaining alphabetical order for the words: For example: string = 'Apples, Bananas, Grapes, Oranges' subtraction = 'Bananas' result = 'Apples, Grapes, Oranges' Also, a way to do this but while maintaining IDs: string = '1:Apples, 4:Bananas, 6:Grapes, 23:Oranges' subtraction = '4:Bananas' result = '1:Apples, 6:Grapes, 23:Oranges' Sample code is greatly appreciated. Thank you so much.

    Read the article

  • strip spaces in python.

    - by Richard
    ok I know that this should be simple... anyways say: line = "$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49" I want to strip out the spaces. I thought you would just do this line = line.strip() but now line is still '$W5M5A,100527,142500,730301c44892fd1c,2,686.5 4,333.96,0,0,28.6,123,75,-0.4,1.4*49' instead of '$W5M5A,100527,142500,730301c44892fd1c,2,686.54,333.96,0,0,28.6,123,75,-0.4,1.4*49' any thoughts?

    Read the article

  • (Python) Converting a dictionary to a list?

    - by Daria Egelhoff
    So I have this dictionary: ScoreDict = {"Blue": {'R1': 89, 'R2': 80}, "Brown": {'R1': 61, 'R2': 77}, "Purple": {'R1': 60, 'R2': 98}, "Green": {'R1': 74, 'R2': 91}, "Red": {'R1': 87, 'Lon': 74}} Is there any way how I can convert this dictionary into a list like this: ScoreList = [['Blue', 89, 80], ['Brown', 61, 77], ['Purple', 60, 98], ['Green', 74, 91], ['Red', 87, 74]] I'm not too familiar with dictionaries, so I really need some help here. Thanks in advance!

    Read the article

  • Find last match with python regular expression

    - by SDD
    I wanto to match the last occurence of a simple pattern in a string, e.g. list = re.findall(r"\w+ AAAA \w+", "foo bar AAAA foo2 AAAA bar2) print "last match: ", list[len(list)-1] however, if the string is very long, a huge list of matches is generated. Is there a more direct way to match the second occurence of "AAAA" or should I use this workaround?

    Read the article

  • python - from matrix to dictionary in single line

    - by Sanich
    matrix is a list of lists. I've to return a dictionary of the form {i:(l1[i],l2[i],...,lm[i])} Where the key i is matched with a tuple the i'th elements from each list. Say matrix=[[1,2,3,4],[9,8,7,6],[4,8,2,6]] so the line: >>> dict([(i,tuple(matrix[k][i] for k in xrange(len(matrix)))) for i in xrange(len(matrix[0]))]) does the job pretty well and outputs: {0: (1, 9, 4), 1: (2, 8, 8), 2: (3, 7, 2), 3: (4, 6, 6)} but fails if the matrix is empty: matrix=[]. The output should be: {} How can i deal with this?

    Read the article

  • Pass in a value into Python Class through command line

    - by chrissygormley
    Hello, I have got some code to pass in a variable into a script from the command line. The script is: import sys, os def function(var): print var class function_call(object): def __init__(self, sysArgs): try: self.function = None self.args = [] self.modulePath = sysArgs[0] self.moduleDir, tail = os.path.split(self.modulePath) self.moduleName, ext = os.path.splitext(tail) __import__(self.moduleName) self.module = sys.modules[self.moduleName] if len(sysArgs) > 1: self.functionName = sysArgs[1] self.function = self.module.__dict__[self.functionName] self.args = sysArgs[2:] except Exception, e: sys.stderr.write("%s %s\n" % ("PythonCall#__init__", e)) def execute(self): try: if self.function: self.function(*self.args) except Exception, e: sys.stderr.write("%s %s\n" % ("PythonCall#execute", e)) if __name__=="__main__": test = test() function_call(sys.argv).execute() This works by entering ./function <function> <arg1 arg2 ....>. The problem is that I want to to select the function I want that is in a class rather than just a function by itself. The code I have tried is the same except that function(var): is in a class. I was hoping for some ideas on how to modify my function_call class to accept this. Thanks for any help.

    Read the article

  • Python - Compress Ascii String

    - by n0idea
    I'm looking for a way to compress an ascii-based string, any help? I need also need to decompress it. I tried zlib but with no help. What can I do to compress the string into lesser length? code: def compress(request): if request.POST: data = request.POST.get('input') if is_ascii(data): result = zlib.compress(data) return render_to_response('index.html', {'result': result, 'input':data}, context_instance = RequestContext(request)) else: result = "Error, the string is not ascii-based" return render_to_response('index.html', {'result':result}, context_instance = RequestContext(request)) else: return render_to_response('index.html', {}, context_instance = RequestContext(request))

    Read the article

  • how to send some data to the Thread module on python and google-map-engine

    - by zjm1126
    from google.appengine.ext import db class Log(db.Model): content = db.StringProperty(multiline=True) class MyThread(threading.Thread): def run(self,request): #logs_query = Log.all().order('-date') #logs = logs_query.fetch(3) log=Log() log.content=request.POST.get('content',None) log.put() def Log(request): thr = MyThread() thr.start(request) return HttpResponse('') error is : Exception in thread Thread-1: Traceback (most recent call last): File "D:\Python25\lib\threading.py", line 486, in __bootstrap_inner self.run() File "D:\zjm_code\helloworld\views.py", line 33, in run log.content=request.POST.get('content',None) NameError: global name 'request' is not defined

    Read the article

  • Optimizing BeautifulSoup (Python) code

    - by user283405
    I have code that uses the BeautifulSoup library for parsing, but it is very slow. The code is written in such a way that threads cannot be used. Can anyone help me with this? I am using BeautifulSoup for parsing and than save into a DB. If I comment out the save statement, it still takes a long time, so there is no problem with the database. def parse(self,text): soup = BeautifulSoup(text) arr = soup.findAll('tbody') for i in range(0,len(arr)-1): data=Data() soup2 = BeautifulSoup(str(arr[i])) arr2 = soup2.findAll('td') c=0 for j in arr2: if str(j).find("<a href=") > 0: data.sourceURL = self.getAttributeValue(str(j),'<a href="') else: if c == 2: data.Hits=j.renderContents() #and few others... c = c+1 data.save() Any suggestions? Note: I already ask this question here but that was closed due to incomplete information.

    Read the article

< Previous Page | 153 154 155 156 157 158 159 160 161 162 163 164  | Next Page >