Search Results

Search found 5414 results on 217 pages for 'regular'.

Page 158/217 | < Previous Page | 154 155 156 157 158 159 160 161 162 163 164 165  | Next Page >

  • How can I handle validation of non-latin script input in PHP?

    - by Matt
    I am trying to adapt a php application to handle non-latin scripts (specifically: Japanese, simplified Chinese and Arabic). The app's data validation routines make frequent use of regular expressions to check input, but I am not sure how to adapt the \w character type to other languages without installing additional locales on the system (which I cannot rely on). Previous developers to have worked on the app have simply added needed characters to the regexes as the number of languages we supported grew (you frequently see "[\wÀÁÂÃÄÅÆÇÈÉ... etc" in the code), but I can't really do this for all the alphabets I need to support now. Does anybody out there have some advice on how to tackle this?

    Read the article

  • valid xml element in java replaceAll doesnt seem working well

    - by John
    Im trying to create a xml file from a POJO , in which i have a property that stores urls, I have been using the below method to replace all & in the url String to make the xml conform to standards and pass it as an html char entity but the string does not change. public static String forHrefAmpersand(String aURL){ return aURL.replaceAll("&", "&"); } the value might be www.abc.com/controller?a=1&next=showResults I have even tried changing the above method to use "/" as i read replaceAll uses regular expression but replaceAll is not working as exprected, Can anyone tell me what is the mistake im doing ? Thanks in advance

    Read the article

  • Searching for URL's Relative to Site Root in Javascript Source

    - by James
    Hi, I am working on a web site with several other developers and we have had problems where people commit JavaScript code with AJAX calls that use URL's relative to the site root. An example would be /Home/Index which will not work if the site is hosted in a virtual directory. To get round the problem we use a $.url() method to convert it to a full path, e.g. $("#container").load($.url("/Home/Index")) I am trying to write a unit test that will search each JavaScript file and find places where the $.url method is not being used. The only problem is that I cannot seem to write a regex expression to do this. I have tried the following: (?!\$\.url\()"(/\w*)+" But this does not work. I cannot find a way to say that I don't want the $.url in front. Does anyone know if this is possible? Note that I need regular expressions that are compatible with .NET Thanks.

    Read the article

  • boost test case for function taking user input

    - by oadams
    I have a function that takes in user input via std::cin: std::getline(std::cin, in); and creates a corresponding data structure by matching it with a regular expression. The function then returns this data structure. I'm using boost.test and I want to create a unit test to check that the output data type is correct given some inputs. However I don't know how to go about it since the input isn't passed as an argument to the function. EDIT: Is there a simple way to create a boost test case that feeds the function a string via standard input?

    Read the article

  • Question in Flex (parser)

    - by shkk
    Hello... I want to ask you a question about Flex, the program for parsing code. Supposing I have an instruction like this one, in the rules part: "=" BEGIN(attribution); <attribution>{var_name} { fprintf(yyout, "="); ECHO; } <attribution>";" BEGIN(INITIAL); {var_name} is a regular expression that matches a variable's name, and all I want to do is to copy at the output all the attribution instructions, such as a = 3; or b = a; My rule though cannot write with fprintf the left member of the attribution, but only = 3; or =a; One solution for that might be that, after I make the match "=" and I am in the attribution state, to go 2 positions back as to get the left operand as well. How can I do that in Flex?

    Read the article

  • open window with dynamic content

    - by julio
    Is it possible to open a window from PHP that has predefined content? It's obvious how you can open a window from a javascript link that frames an existing page, or just do a target=_blank from a regular a tag that references an existing page. But I am generating a bit of content, and want that content to be opened in a new link (or streamed to the viewer)-- something like (clearly psuedo code!): $content = "Hello World. <br />Nice to meet you!"; <a href="#" target="_blank" content=$content>Open up!</a> Is this possible? Thanks!

    Read the article

  • JQuery create new select option

    - by nav
    Hi I have the below functions in regular javascript creating select options. Is there a way I can do this with JQuery without having to use the form object? function populate(form) { form.options.length = 0; form.options[0] = new Option("Select a city / town in Sweden",""); form.options[1] = new Option("Melbourne","Melbourne"); } Below is how I call the function above: populate(document.form.county); //county is the id of the dropdownlist to populate. Many Thanks,

    Read the article

  • PHP reg expr. replace ALL URLs except img src URLs

    - by zilveer
    Hi, I have searched but havent been able to find my answer. It follows like: I would like to replace all URL in a string to links except the URLs within img src tag. I have a regular expression for replacing all the URLs to links, but would like it to NOT replace the URLs within img src="" attribute. How can i do this? Here is the code for replacing all URLs: /*** make sure there is an http:// on all URLs ***/ $str = preg_replace("/([^\w\/])(www\.[a-z0-9\-]+\.[a-z0-9\-]+)/i", "$1http://$2",$str); /*** make all URLs links ***/ $str = preg_replace("/([\w]+:\/\/[\w-?&;#~=\.\/\@]+[\w\/])/i","<a target=\"_blank\" href=\"$1\">$1</a>",$str); /Regards

    Read the article

  • Creating Slugs from Titles?

    - by James Jeffery
    I have everything in place to create slugs from titles, but there is one issue. My RegEx replaces spaces with hyphens. But when a user types "Hi     there" (multiple spaces) the slug ends up as "Hi-----there". When really it should be "Hi-there". Should I create the regular expression so that it only replaces a space when there is a character either side? Or is there an easier way to do this?

    Read the article

  • Are there design-time watch windows for Visual Studio 2008/2010?

    - by Jeff
    There are many times when I need to test a little snippet of .net code but rebuilding and publishing the entire project or writing a suite of unit tests just seems like overkill. For example, I am writing a regular expression right now and I want to see if it the pattern is matching on the right parts. I could go and find a million other utilities that do that sort of thing, but that is not exactly my point. FireBug has an exact analogue to what I want - the FireBug console. There is a text box where the user can enter some JavaScript and FireBug will execute it on the spot and display the return value. I would love to be able to enter something like (new Regex("b+")).Replace("abc", "x") and see the results without having to do all the overhead. Does VS have anything like this?

    Read the article

  • XAMPP on windows 7 not working properly

    - by 404Error
    Hey there, I just installed XAMPP lite on Windows 7. I have two drives - C: for the OS and regular files, and an external drive E:. I installed XAMPP lite on E: (on the root), and its been giving me problems. Apache works well enough, but MySQL doesn't work. When I go to http://localhost/phpmyadmin/, it gives me the following error: Error MySQL said: #2003 - Can't connect to MySQL server on 'localhost' (10061) Connection for controluser as defined in your configuration failed. Any ideas as to what could be the problem? I used the zip file for XAMPP lite, the 32 bit version. This is on Windows 7 Home premium. Thanks!

    Read the article

  • Yet another URL prefix regex question (to be used in C#).

    - by Hamish Grubijan
    Hi, I have seen many regular expressions for Url validation. In my case I want the Url to be simpler, so the regex should be tighter: Valid Url prefixes look like: http[s]://[www.]addressOrIp[.something]/PageName.aspx[?] This describe a prefix. I will be appending ?x=a&y=b&z=c later. I just want to check if the web page is live before accessing it, but even before that I want to make sure that it is properly configured. I want to treat bad url and host is down conditions differently, although when in doubt, I'd rather give a host is down message, because that is an ultimate test anyway. Hopefully that makes sense. I guess what I am trying to say - the regex does not need be too aggressive, I just want it to cover say 95% of the cases. This is C# - centric, so Perl regex extensions are not helpful to me; let's stick to the lowest common denominator. Thanks!

    Read the article

  • parse unformatted string into dictionary with python

    - by user553131
    I have following string. DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) Key: a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO I need to create dictionary so it would be like { "DATE": "12242010", "Key Type": "Nod32 Anti-Vir (30d trial)", "Key": "a5B2s-sH12B-hgtY3-io87N-srg98-KLMNO" } The problem is that string is unformatted DATE: 12242010Key Type: Nod32 Anti-Vir (30d trial) there is no space after Date before Key Type also it would be nice to have some validation for Key, eg if there are 5 chars in each box of key and number of boxes I am a beginner in python and moreover in regular expressions. Thanks a lot.

    Read the article

  • How do I link (dependency) properties in my ViewModel?

    - by mos
    Simplified example: I have an object that models a user. Users have a first name and a last name. The UserViewModel has a dependency property for my Models.User object. In the declaration of the UserView's xaml, I want to bind a couple of TextBlocks to the first and last name properties. What is the correct way to do this? Should I have readonly DependencyProperties for the name fields, and when the dependency property User is set, update them? Can the name fields be regular C# properties instead? Or, should I bind like this: <TextBlock Text="{Binding User.FirstName}" />

    Read the article

  • Prevent RegEx Hang on Large Matches...

    - by developerjay
    This is a great regular expression for dates... However it hangs indefinitely on this one page I tried... I wanted to try this page ( http://pleac.sourceforge.net/pleac%5Fpython/datesandtimes.html ) for the fact that it does have lots of dates on it and I want to grab all of them. I don't understand why it is hanging when it doesn't on other pages... Why is my regexp hanging and/or how could I clean it up to make it better/efficient ? Python Code: monthnames = "(?:Jan\w*|Feb\w*|Mar\w*|Apr\w*|May|Jun\w?|Jul\w?|Aug\w*|Sep\w*|Oct\w*|Nov(?:ember)?|Dec\w*)" pattern1 = re.compile(r"(\d{1,4}[\/\\\-]+\d{1,2}[\/\\\-]+\d{2,4})") pattern4 = re.compile(r"(?:[\d]*[\,\.\ \-]+)*%s(?:[\,\.\ \-]+[\d]+[stndrh]*)+[:\d]*[\ ]?(PM)?(AM)?([\ \-\+\d]{4,7}|[UTCESTGMT\ ]{2,4})*"%monthnames, re.I) patterns = [pattern4, pattern1] for pattern in patterns: print re.findall(pattern, s) btw... when i say im trying it against this site.. I'm trying it against the webpage source.

    Read the article

  • Get "2:35pm" instead of "02:35PM" from Python date/time?

    - by anonymous coward
    I'm still a bit slow with Python, so I haven't got this figured out beyond what's obviously in the docs, etc. I've worked with Django a bit, where they've added some datetime formatting options via template tags, but in regular python code how can I get the 12-hour hour without a leading zero? Is there a straightforward way to do this? I'm looking at the 2.5 and 2.6 docs for "strftime()" and there doesn't seem to be a formatting option there for this case. Should I be using something else? Feel free to include any other time-formatting tips that aren't obvious from the docs. =)

    Read the article

  • c# performance- create font

    - by user85917
    I have performance issues in this code segment which I think is caused by the "new Font". Will it be faster if fonts are static/global ? if (row.StartsWith(TILD_BEGIN)) { rtbTrace.SelectionColor = Color.Maroon; rtbTrace.SelectionFont = new Font(myFont, (float)8.25, FontStyle.Regular); if (row.StartsWith(BEGIN) ) rtbTrace.AppendText(Environment.NewLine + row + Environment.NewLine); else rtbTrace.AppendText(Environment.NewLine + row.Substring(1) + Environment.NewLine); continue; } if (row.StartsWith(EXCL_BEGIN)) { -- similar block } if (row.StartsWith(DLR_BEGIN)) { -- similar block } . . .

    Read the article

  • Just how much do I want to make virtual?

    - by Alex
    I am writing an abstract superclass where literally every method is going to be overridden. There is some default functionality I could implement, but most of the time it's enough to leave the implementation to the subclass writer. Since just about every method is going to be overwritten, how much should I make virtual and how much should I just leave as regular methods? In the current incarnation, everything is virtual, but I still haven't let this loose to anyone to use, so the design is flexible. What advantages/disadvantages are there to virtual functions? Links to good reading material about this would be appreciated.

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

  • Magento - how to create different prices for different sizes of a products?

    - by Lisa Li
    Hi, I am trying to set different prices for different sizes of a few products I have in my store. I am not really sure how to do that propely. The problem is that I already have the regular size defined as a simple product. Now, I want to add a smaller size as well, that can be chosen from the same product page, and I need to set the weight of the smaller size, so postage is calculated properly. Any suggestions? Many thanks!

    Read the article

  • Change selected value of drop down list with jQuery

    - by Phairoh
    I have a drop down list with known values. What I'm trying to do is set the drop down list to a particular value that I know exists using jQuery. Using regular JavaScript, I would do something like: ddl = document.getElementById("ID of element goes here"); ddl.value = 2; // 2 being the value I want to set it to. However, I need to do this with jQuery because I'm using a CSS class for my selector (stupid ASP.NET client ids...). Here are a few things I've tried: $("._statusDDL").val(2); // doesn't find 2 as a value $("._statusDDL").children("option").val(2) // also failed. How can I do it with jQuery?

    Read the article

  • Replace non-html links with <A> tags

    - by tombazza
    I have a block of code that will take a block of text like the following: Sample text sample text http://www.google.com sample text Using the preg_replace_callback method and the following regular expression: preg_replace_callback('/http:\/\/([,\%\w.\-_\/\?\=\+\&\~\#\$]+)/', create_function( '$matches', '$url = $matches[1]; $anchorText = ( strlen($url) > 35 ? substr($url, 0, 35).\'...\' : $url); return \'<a href="http://\'. $url .\'">\'. $anchorText .\'</a>\';'), $str); Will convert the sample text to look like: Sample text sample text < a href="http://www.google.com"http://www.google.com< /a sample text My problem now is that we have introduced a rich text editor that can create links before being sent to the script. I need to update this piece of code so that it will ignore any URLs that are already inside an tag.

    Read the article

  • How to publish to Facebook fan/business pages (not user profiles)

    - by Jeff Putz
    I'm trying to figure out if fan/business pages are conceptually similar to regular user pages. My end goal is to publish events from a third-party Web site (new content, announcements, etc.) into the FB page that promotes the third-party site. I'm not sure where to start exactly. Been looking at the .NET Facebook SDK, and it seems focused on FB apps and authentication. Not sure where I should be looking. Help is appreciated!

    Read the article

  • How do I compute a variable in Javascript if and only if it is used?

    - by LLer
    This is what I'm doing right now. var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = function() { return x; }; return x; } It works but only if foo is called as a function like so foo(); But what if I want to call it as a normal variable with a value? I could modify the code to be var foo = function() { var x = someComplicatedComputationThatMayTakeMoreTime(); this.foo = x; return x; } That would allow me to only call it once as a function and after that as a regular variable. But it's still not what I want. Plus it gets complicated if it accidentally gets called as a function again, returning an error. Is this even possible in Javascript?

    Read the article

  • How to make validation for a textbox that accept only comma(,) & digit in asp.net application?

    - by prateeksaluja20
    I am working on a website. I am using C# 2008. I want to make a text box that accept only numbers & comma(,). for example-919981424199,78848817711,47171111747 or there may be a single number like 919981424199. I was able to do one thing My text box only containing number by using this Regular Expression validation.in its property-Validation Expression i wrote "[0-9]+". This is working but now my requirement is to send bulk SMS & each number is separated by (,). I tried a lot but not getting the ans. so please help me to sort out this problem.

    Read the article

< Previous Page | 154 155 156 157 158 159 160 161 162 163 164 165  | Next Page >