Search Results

Search found 16800 results on 672 pages for 'alan long'.

Page 162/672 | < Previous Page | 158 159 160 161 162 163 164 165 166 167 168 169  | Next Page >

  • .NET consumer of ActiveX throwing TargetParameterCountException

    - by DevSolo
    I have a .NET (3.5 w/ Dev Studio 2008) app that hosts a visual Active X (written in C++ w/ Dev Studio 2003). Have access to all sources, but can't easily move the Active X control up to 2008. This as worked fine in the past. Made some changes to the Active X control and now, when calling one method on the Active X, I'm getting a TargetParameterCountException 100% of the time. The signature of the Active X method is: LONG CMyActive::License(LPCTSTR string1, LPCTSTR string2, LONG long1, LPCTSTR string3, LPCTSTR string4); When viewing the method in object browser of reflector, .NET sees it as: public virtual int License(string string1, string string2, int long1, string string3, string string4) I renamed the parameters for demonstration purpose (boss gets twitchy about any code). I left the method name, as it could be relevant. There are method calls prior that work. I just can't seen to figure out why I'm all of a sudden getting this exception. The HRESULT is 0x8002000e and a quick search seems to indicate that's a general one. Thanks to all for reading.

    Read the article

  • JPA 2.0 Provider Hibernate

    - by Rooh
    I have very strange problem we are using jpa 2.0 with hibernate annotations based Database generated through JPA DDL is true and MySQL as Database; i will provide some reference classes and then my porblem. @MappedSuperclass public abstract class Common implements serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; @ManyToOne @JoinColumn private Address address; //with all getter and setters //as well equal and hashCode } @Entity public class Parent extends Common{ private String name; @OneToMany(cascade = {CascadeType.MERGE,CascadeType.PERSIST}, mappedBy = "parent") private List<Child> child; //setters and rest of class } @Entity public class Child extends Common{ //some properties with getter/setters } @Entity public class Address implements Serializable{ @Id @GeneratedValue(strategy = GenerationType.AUTO) @Column(name = "id", updatable = false) private Long id; private String street; //rest of class with get/setter } as in code you can see that parents and child classes extends Common class so both have address property and id , the problem occurs when change the address refference in parent class it reflect same change in all child objects in list and if change address refference in child class then on merge it will change address refference of parent as well i am not able to figure out is it is problem of jpa or hibernate

    Read the article

  • IF-block brackets: best practice

    - by MasterPeter
    I am preparing a short tutorial for level 1 uni students learning JavaScript basics. The task is to validate a phone number. The number must not contain non-digits and must be 14 digits long or less. The following code excerpt is what I came up with and I would like to make it as readable as possible. if ( //set of rules for invalid phone number phoneNumber.length == 0 //empty || phoneNumber.length > 14 //too long || /\D/.test(phoneNumber) //contains non-digits ) { setMessageText(invalid); } else { setMessageText(valid); } A simple question I can not quite answer myself and would like to hear your opinions on: How to position the surrounding (outermost) brackets? It's hard to see the difference between a normal and a curly bracket. Do you usually put the last ) on the same line as the last condition? Do you keep the first opening ( on a line by itself? Do you wrap each individual sub-condition in brackets too? Do you align horizontally the first ( with the last ), or do you place the last ) in the same column as the if? Do you keep ) { on a separate line or you place the last ) on the same line with the last sub-condition and then place the opening { on a new line? Or do you just put the ) { on the same line as the last sub-condition? Community wiki.

    Read the article

  • JAVA Procedure Error

    - by Sam....
    java.sql.SQLException: [Microsoft][SQLServer 2000 Driver for JDBC][SQLServer]Procedure 'STP_Insert_tblReceipt' expects parameter '@CPVFlag', which was not supplied. I m getting error at This Point when trying to call procedure... Everything is perfect ,,,Count of Question marks are similar to parameter provided cs = conn.prepareCall("{call STP_Insert_tblReceipt(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?, ?,?,?)}"); // cs = conn.prepareCall("{call STP_Receipt_Form_Insertion_Trial(?,?,?, ?,?,?, ?,?,?, ?,?,?, ?)}"); cs.setLong(1, Long.parseLong(txtMobileNo.getText())); cs.setString(2, String.valueOf(cboDistributor.getSelectedItem())); cs.setLong(3, Long.parseLong(txtBoxNo.getText())); cs.setInt(4, Integer.parseInt(txtFileNo.getText())); cs.setString(5, pickUp_date); cs.setString(6, rec_date); cs.setString(7, String.valueOf(cmbCtrlNo.getSelectedItem())); cs.setString(8, UserName); cs.setString(9, rec_date); cs.setString(10, RegionLocation); cs.setString(11, txtRemark.getText().trim()); cs.setString(12, txtSimNo.getText().trim()); cs.setInt(13, 2); cs.setString(14, String.valueOf(cmbAryanRegion.getSelectedItem())); cs.setString(15, String.valueOf(cboPickUpType.getSelectedItem())); cs.setString(16, String.valueOf(txtCafNo.getText())); cs.setString(17, distributorId); //cs.setString(18, circleName); cs.setString(18, cboCircle.getSelectedItem().toString()); cs.registerOutParameter(19, java.sql.Types.INTEGER); cs.setString(20, auditorName); cs.setString(21, retailerName); cs.setString(22, retailerCode); cs.setInt(23, mappedFlag); //cs.setString(24, distCode); cs.setString(24, cboDistCode.getSelectedItem().toString()); //cs.setString(25, zoneName); cs.setString(25, cboZone.getSelectedItem().toString()); cs.setString(26, comment); **cs.setInt(27, 1);** **this is for CPV Flag** After this cs.execute();

    Read the article

  • Facing error in apple multitasking code

    - by user366584
    Actually I am working for multitasking and facing error please assist me, as I need to work on background application and also in foreground application - (void)applicationDidEnterBackground:(UIApplication *)application { UIApplication* app = [UIApplication sharedApplication]; // Request permission to run in the background. Provide an // expiration handler in case the task runs long. NSAssert(bgTask == UIBackgroundTaskInvalid, nil); bgTask = [app beginBackgroundTaskWithExpirationHandler:^{ // Synchronize the cleanup call on the main thread in case // the task actually finishes at around the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }]; // Start the long-running task and return immediately. dispatch_async(dispatch_get_global_queue(DISPATCH_QUEUE_PRIORITY_DEFAULT, 0), ^{ // Do the work associated with the task. // Synchronize the cleanup call on the main thread in case // the expiration handler is fired at the same time. dispatch_async(dispatch_get_main_queue(), ^{ if (bgTask != UIBackgroundTaskInvalid) { [app endBackgroundTask:bgTask]; bgTask = UIBackgroundTaskInvalid; } }); }); }

    Read the article

  • Asp.net mvc retriev images from db and display on Page

    - by Trey Carroll
    //Inherits="System.Web.Mvc.ViewPage<FilmFestWeb.Models.ListVideosViewModel>" <h2>ListVideos</h2> <% foreach(BusinessObjects.Video vid in Model.VideoList){%> <div class="videoBox"> <%= Html.Encode(vid.Name) %> <img src="<% vid.ThumbnailImage; %>" /> </div> <%} %> //ListVideosViewModel public class ListVideosViewModel { public IList<Video> VideoList { get; set; } } //Video public class Video { public long VideoId { get; set; } public long TeamId { get; set; } public string Name { get; set; } public string Tags { get; set; } public string TeamMembers { get; set; } public string TranscriptFileName { get; set; } public string VideoFileName { get; set; } public int TotalNumRatings { get; set; } public int CumulativeTotalScore { get; set; } public string VideoUri { get; set; } public Image ThumbnailImage { get; set; } } I am getting the "red x" that I usually associate with image file not found. I have verified that my database table shows <binary data> after the stored proc that uploads the image executes. Any insight or advice would be greatly appreciated.

    Read the article

  • wsdl xml parsing , maxlength problem after encoding of text

    - by MichaelD
    We are working together with another firm. our application communicates with the other application through WCF on our side and a custom implemented java wsdl handler on the other side. They specify the wsdl format and one of the rules is that a specific string cannot contain more then 15 characters. (normally it's 60, but i take 15 for easy example reasons) When we try to send the following string to them we get an error that the string is too long according to the wsdl: "example & test" this is a string of 14 characters, so it should be allowed the microsoft wcf parser translates this to "example &amp; test" . This encoded string is 18 characters long. Now what is the standaard behavior to check a maxlength defined in a message? Is it the encoded message or the decoded message? I would think it's the decoded message , but i ain't sure. If it is the encoded message, how should we handle this so we would know how we have to split the string?

    Read the article

  • Unit Testing Private Method in Resource Managing Class (C++)

    - by BillyONeal
    I previously asked this question under another name but deleted it because I didn't explain it very well. Let's say I have a class which manages a file. Let's say that this class treats the file as having a specific file format, and contains methods to perform operations on this file: class Foo { std::wstring fileName_; public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it //Long method to figure out what checksum it is. //Return the checksum. } }; Let's say I'd like to be able to unit test the part of this class that calculates the checksum. Unit testing the parts of the class that load in the file and such is impractical, because to test every part of the getChecksum() method I might need to construct 40 or 50 files! Now lets say I'd like to reuse the checksum method elsewhere in the class. I extract the method so that it now looks like this: class Foo { std::wstring fileName_; static int calculateChecksum(const std::vector<unsigned char> &fileBytes) { //Long method to figure out what checksum it is. } public: Foo(const std::wstring& fileName) : fileName_(fileName) { //Construct a Foo here. }; int getChecksum() { //Open the file and read some part of it return calculateChecksum( something ); } void modifyThisFileSomehow() { //Perform modification int newChecksum = calculateChecksum( something ); //Apply the newChecksum to the file } }; Now I'd like to unit test the calculateChecksum() method because it's easy to test and complicated, and I don't care about unit testing getChecksum() because it's simple and very difficult to test. But I can't test calculateChecksum() directly because it is private. Does anyone know of a solution to this problem?

    Read the article

  • How accurately (in terms of time) does Windows play audio?

    - by MusiGenesis
    Let's say I play a stereo WAV file with 317,520,000 samples, which is theoretically 1 hour long. Assuming no interruptions of the playback, will the file finish playing in exactly one hour, or is there some occasional tiny variation in the playback speed such that it would be slightly more or slightly less (by some number of milliseconds) than one hour? I am trying to synchronize animation with audio, and I am using a System.Diagnostics.Stopwatch to keep the frames matching the audio. But if the playback speed of WAV audio in Windows can vary slightly over time, then the audio will drift out of sync with the Stopwatch-driven animation. Which leads to a second question: it appears that a Stopwatch - while highly granular and accurate for short durations - runs slightly fast. On my laptop, a Stopwatch run for exactly 24 hours (as measured by the computer's system time and a real stopwatch) shows an elapsed time of 24 hours plus about 5 seconds (not milliseconds). Is this a known problem with Stopwatch? (A related question would be "am I crazy?", but you can try it for yourself.) Given its usage as a diagnostics tool, I can see where a discrepancy like this would only show up when measuring long durations, for which most people would use something other than a Stopwatch. If I'm really lucky, then both Stopwatch and audio playback are driven by the same underlying mechanism, and thus will stay in sync with each other for days on end. Any chance this is true?

    Read the article

  • How to use Java on Google App Engine without exceeding minute quotas?

    - by Geo
    A very simple java code inside a doGet() servlet is getting more than a second of cpu time on GAE. I have read some quota related documentation and apparently I am not doing anything wrong. //Request the user Agent info String userAgent = req.getHeader("User-Agent"); I wanted to know what was using the CPU the most, I use a google help recommendation. //The two lines below will get the CPU before requesting User-Agent Information QuotaService qs = QuotaServiceFactory.getQuotaService(); long start = qs.getCpuTimeInMegaCycles(); //Request the user Agent info String userAgent = req.getHeader("User-Agent"); //The three lines below will get the CPU after requesting User-Agent Information // and informed it to the application log. long end = qs.getCpuTimeInMegaCycles(); double cpuSeconds = qs.convertMegacyclesToCpuSeconds(end - start); log.warning("CPU Seconds on geting User Agent: " + cpuSeconds); The only thing that the code above tells me is that inspecting the header will use more than a second (1000ms) of cpu time, which for Google is a warning on the log panel. That seems to be a very simple request and still is using more than a second of cpu. What I am missing?

    Read the article

  • Setting acquired location to a text view: How to maintain?

    - by Mark
    Hi, I have built an app for the Motorola Droid which should automatically update a server with the phone's location. After the user performs a particular task on the main activity screen, an alarm is set to update the user's location periodically, using a service. The alarm is explicitly stopped when the user completes another task. Thing is, I have set up a location manager within the main activity's onCreate() method which is supposed to place the first acquired lat/long into two textview fields. Even though the manifest is set up for acquiring coarse and fine coords and I'm using requestLocationUpdates (String provider, long minTime, float minDistance, LocationListener listener), with minTime and minDistance set to zero, I'm not seeing the coords coming up on the screen. With that, I'm not recording any locations on the server. When I seed the textviews with sample coords, they are being recorded fine on the server. I am not at a computer that can run the IDE, so don't currently have the code, but am desperate for some help on this. One other thing is that the main activity screen calls a photography app before the user manually clicks "send data". I'm suspicious that I may need to override the main activity's onResume() method to do this location acquisition. Please help, thanks. Mark.

    Read the article

  • How to produce 64 bit masks?

    - by egiakoum1984
    Based on the following simple program the bitwise left shit operator works only for 32 bits. Is it true? #include <iostream> #include <stdlib.h> using namespace std; int main(void) { long long currentTrafficTypeValueDec; int input; cout << "Enter input:" << endl; cin >> input; currentTrafficTypeValueDec = 1 << (input - 1); cout << currentTrafficTypeValueDec << endl; cout << (1 << (input - 1)) << endl; return 0; } The output of the program: Enter input: 30 536870912 536870912 Enter input: 62 536870912 536870912 How could I produce 64-bit masks?

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • Using "wildcards" in a vlist array to delete rows in Excel

    - by KMinner
    Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • Need Help finding an appropriate task asignment algoritm for a collage project involving coordinatin

    - by Trif Mircea
    Hello. I am a long time lurker here and have found over time many answers regarding jquery and web development topics so I decided to ask a question of my own. This time I have to create a c++ project for collage which should help manage the workflow of a company providing all kinds of services through in the field teams. The ideas I have so far are: client-server application; the server is a dispatcher where all the orders from clients get and the clients are mobile devices (PDAs) each team in the field having one a order from a client is a task. Each task is made up of a series of subtasks. You have a database with estimations on how long a task should take to complete you also know what tasks or subtasks each team on the field can perform based on what kind of specialists made up the team (not going to complicate the problem by adding needed materials, it is considered that if a member of a team can perform a subtask he has the stuff needed) Now knowing these factors, what would a good task assignment algorithm be? The criteria is: how many tasks can a team do, how many tasks they have in the queue, it could also be location, how far away are they from the place but I don't think I can implement that.. It needs to be efficient and also to adapt quickly is the human dispatcher manually assigns a task. Any help or leads would be really appreciated. Also I'm not 100% sure in the idea so if you have another way you would go about creating such an application please share, even if it just a quick outline. I have to write a theoretical part too so even if the ideas are far more complex that what i outlined that would be ok ; I'd write those and implement what I can.

    Read the article

  • Uncrackable anti-piracy protection/DRM even possible? [closed]

    - by some guy
    I hope that this is programming-related enough. You have probably heard about Ubisofts recent steps against piracy. (New DRM requires a constant connection to the Ubisoft server) Many people including me see this as intolerable because the only ones suffering from it at the end are the paying customers. Now to the actual question(s): Ubisoft justified this by calling this mechanism "Uncrackable, only playable by the paying customers". Is a so called uncrackable DRM even possible? You can reverse-engineer and modify everything, even if it takes long. Isn't Ubisoft already lying by calling something not crackable? I mean, hey - With the game you get all its content (textures, models, you know) and some anti-piracy mechanism hardcoded into it. How could that be "uncrackable"? You can just patch the unwanted mechanisms out ---- "Pirates" play the cracked game without problems and the paying customers are the idiots by having constant problems with the game and being unable to play it without a (working) internet connection. What are the points Ubisoft sees in this? If they are at least a bit intelligent and informed they know their anti-piracy protection won't last long. All they get is lower sales, angry customers and happy pirates and crackers.

    Read the article

  • GSM Cell Towers Location & Triangulation Algorithm (Similar to OpenCellID / Skyhook / Google's MyLocation)

    - by ranabra
    Hi all, assuming I have a Fingerprint DB of Cell towers. The data (including Long. & Lat. CellID, signal strength, etc) is achieved by 'wardriving', similar to OpenCellID.org. I would like to be able to get the location of the client mobile phone without GPS (similar to OpenCellID / Skyhook Wireless/ Google's 'MyLocation'), which sends me info on the Cell towers it "sees" at the moment: the Cell tower connected to, and another 6 neighboring cell towers (assuming GSM). I have read and Googled it for a long time and came across several effective theories, such as using SQL 2008 Spatial capabilities, or using an euclidean algorithm, or Markov Model. However, I am lacking a practical solution, preferably in C# or using SQL 2008 :) The location calculation will be done on the server and not on the client mobile phone. the phone's single job is to send via HTTP/GPRS, the tower it's connected to and other neighboring cell towers. Any input is appreciated, I have read so much and so far haven't really advanced much. Thanx

    Read the article

  • Thread Safety of C# List<T> for readers

    - by ILIA BROUDNO
    I am planning to create the list once in a static constructor and then have multiple instances of that class read it (and enumerate through it) concurrently without doing any locking. In this article http://msdn.microsoft.com/en-us/library/6sh2ey19.aspx MS describes the issue of thread safety as follows: Public static (Shared in Visual Basic) members of this type are thread safe. Any instance members are not guaranteed to be thread safe. A List can support multiple readers concurrently, as long as the collection is not modified. Enumerating through a collection is intrinsically not a thread-safe procedure. In the rare case where an enumeration contends with one or more write accesses, the only way to ensure thread safety is to lock the collection during the entire enumeration. To allow the collection to be accessed by multiple threads for reading and writing, you must implement your own synchronization. The "Enumerating through a collection is intrinsically not a thread-safe procedure." Statement is what worries me. Does this mean that it is thread safe for readers only scenario, but as long as you do not use enumeration? Or is it safe for my scenario?

    Read the article

  • Android ListView: how to select an item?

    - by mmo
    I am having trouble with a ListView I created: I want an item to get selected when I click on it. My code for this looks like: protected void onResume() { ... ListView lv = getListView(); lv.setOnItemSelectedListener(new OnItemSelectedListener() { public void onItemSelected(AdapterView<?> adapterView, View view, int pos, long id) { Log.v(TAG, "onItemSelected(..., " + pos + ",...) => selected: " + getSelectedItemPosition()); } public void onNothingSelected(AdapterView<?> adapterView) { Log.v(TAG, "onNothingSelected(...) => selected: " + getSelectedItemPosition()); } }); lv.setOnItemClickListener(new OnItemClickListener() { public void onItemClick(AdapterView<?> adapterView, View view, int pos, long id) { lv.setSelection(pos); Log.v(TAG, "onItemClick(..., " + pos + ",...) => selected: " + getSelectedItemPosition()); } }); ... } When I run this and click e.g. on the second item (i.e. pos=1) I get: 04-03 23:08:36.994: V/DisplayLists(663): onItemClick(..., 1,...) => selected: -1 i.e. even though the OnItemClickListener is called with the proper argument and calls a setSelection(1), there is no item selected (and hence also OnItemSelectedListener.onItemSelected(...) is never called) and getSelectedItemPosition() still yields -1 after the setSelection(1)-call. What am I missing? Michael PS.: My list does have =2 elements...

    Read the article

  • Return latitude/longitude based on entered address

    - by Don
    I'm building a php based application for a client to enter in addresses for their customers' buildings. They'd like the ability to view the location on a map (either as individuals or grouped in a city search). What I'm trying to accomplish is a lookup once the address is entered into a form that populates the database, so after they enter in the addresss, city, state, zip (these are all US locations) they could click a "get lat/long info" link/button that would check to make sure the data is complete, then would lookup the address and return the latitude/longitude into the appropriate form fields. Then the form could be submitted to store the info, and I could later just pull the lat/long when plotting on a map. 1) Does this make sense, or would I be better off just doing the lookup when it's time to plot it? 2) Does anyone have any pointers to solve this problem? I've seen some of the Google/Yahoo API's but it looks like this is more based on the plotting a point part. I may be able to modify it to suit my needs, but I'm just trying to cut some research time posting here with the hopes one of you may have a more direct route. I'll RTFM if I have to... Thanks, D.

    Read the article

  • Database insertion not happening

    - by Pramod Setlur
    int i=0; ContentValues values = null; for ( SortedMap.Entry<Integer, String> entry : mapDefect.entrySet() ) { if( i++ < count ) continue; if( i < arrlst.size() ) { values = new ContentValues(); Log.d("MAP", "Id :"+entry.getKey()+"Des :"+entry.getValue()+"Co :"+ arrlst.get(i)); values.put( MARKER_COORD, arrlst.get( i ) ); values.put( MARKER_ID, entry.getKey() ); values.put( DEFECT_DESCRIPTION, entry.getValue() ); values.put( IMAGE_ID_F, imageID + 1 ); Log.d( "Err", "in insertNewDefectsDescription" ); long rowId = db.insert( TABLE_DEFECTS, null, values ); long rowId1 = rowId; i++; } } So, I want to access the arraylist only after the count variable, which is why the:- if(i++<count) continue; But, when I insert a break point at the 'insert' line, it is not working. The line is not executing at all, and hence the data is not being inserted into the database. What has gone wrong?? The 'values' are null.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • The CLR has been unable to transition from COM context [...] for 60 seconds

    - by BlueRaja The Green Unicorn
    I am getting this error on code that used to work. I have not changed the code. Here is the full error: The CLR has been unable to transition from COM context 0x3322d98 to COM context 0x3322f08 for 60 seconds. The thread that owns the destination context/apartment is most likely either doing a non pumping wait or processing a very long running operation without pumping Windows messages. This situation generally has a negative performance impact and may even lead to the application becoming non responsive or memory usage accumulating continually over time. To avoid this problem, all single threaded apartment (STA) threads should use pumping wait primitives (such as CoWaitForMultipleHandles) and routinely pump messages during long running operations. And here is the code that caused it: var openFileDialog1 = new System.Windows.Forms.OpenFileDialog(); openFileDialog1.DefaultExt = "mdb"; openFileDialog1.Filter = "Management Database (manage.mdb)|manage.mdb"; //Stalls indefinitely on the following line, then gives the CLR error //one minute later. The dialog never opens. if(openFileDialog1.ShowDialog() == DialogResult.OK) { .... } Yes, I am sure the dialog is not open in the background, and no, I don't have any explicit COM code or unmanaged marshalling or multithreading. I have no idea why the OpenFileDialog won't open - any ideas?

    Read the article

  • [hibernate - jpa] @OneToOne annotoation problem (i think...)

    - by blow
    Hi all, im new in hibernate and JPA and i have some problems with annotations. My target is to create this table in db (PERSON_TABLE with personal-details) ID ADDRESS NAME SURNAME MUNICIPALITY_ID First of all, i have a MUNICIPALITY table in db containing all municipality of my country. I mapped this table in this ENTITY: @Entity public class Municipality implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String country; private String province; private String name; @Column(name="cod_catasto") private String codCatastale; private String cap; public Municipality() { } ... Then i make an EMBEDDABLE class Address containing fields that realize a simple address... @Embeddable public class Address implements Serializable { @OneToOne(cascade=CascadeType.ALL) @JoinColumn(name="id_municipality") private Municipality municipality; @Column(length=45) private String address; public Address() { } ... Finally i embedded this class into Person ENTITY @Entity public class Person implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String name; private String surname; @Embedded private Address address; public Person() { } ... All works good when i have to save a new Person record, in fact hibernate creates a PERSON_TABLE as i want, but if i try to retrieve a Person record i have an exception. HQL is simply "from Person" The excpetion is (Entities is the package containing all classes above-mentioned): org.hibernate.AnnotationException: @OneToOne or @ManyToOne on Entities.Person.address.municipality references an unknown entity: Entities.Municipality Is the @OneToOne annotation the problem? Thanks.

    Read the article

< Previous Page | 158 159 160 161 162 163 164 165 166 167 168 169  | Next Page >