Search Results

Search found 50510 results on 2021 pages for 'static files'.

Page 162/2021 | < Previous Page | 158 159 160 161 162 163 164 165 166 167 168 169  | Next Page >

  • Getting data from closed files with concatenate formula

    - by Pav
    Each day a program is creating an excel file for me with some data for the current day. Like what is the price for products, how many people are available today and things like that. Based on all this I need to make some forecasts and workplace allocations for workers. The problem is, that I need to drag all this information manually all the time. So to make it automatic I placed the formula in cells like: ='c:\ABC\[ABC 29-01-14.xlsx]sheet'!a1 Everything works fine, but next day I have to change file name for "ABC 30-01-14" for each cell, what is the same as entering the data manually. So I used "concatenate" formula to change date according to today's date automatically. I used "indirect" formula to turn it in to a real formula, not text string, and realized that it is working only for open files, not closed. Is there any way to do this for closed files without VBA, because I don't know it, or with VBA but explained for an idiot.

    Read the article

  • Considering modified files for rebuild

    - by harik
    I have a C++ project, I am using Bakefile for build process, Makefiles are generated for msvc, mingw, gnu etc for cross-platform support. Now the problem is that if I change any .h files (which are included in other .cpp files) and performing a rebuild does not recompile modified files. But changing any .cpp file gets recompiled. Based on modified time-stamp of any file which is included in the project I expect to consider that file for rebuild. Am I missing something which required to be added as a tag in .bkl files? Please help.

    Read the article

  • visual-studio-2008 versioninfo for all files updated from one place

    - by ravenspoint
    The version information, displayed when the mouse cursor hovers over the file in windows explorer, is set for a file built by visual studio in the VERSION resource. I would like to set the version in one place for all the files built by a solution, preferably when I change the version in the install properties. Is there a way to do this? The motivation for this is that if the version is not updated for a file, then the installer will leave previous versions of files instead of replacing them with new files. This happens even when the 'RemovePreviousVersions' property is set. In order to save the tedious and error prone task of updating the version in every file built and installed, I remove the version resource from all files - which is not elegant.

    Read the article

  • Preventing logrotate's dateext from overwriting files

    - by Thirler
    I'm working with a system where I would like to use the dateext function of logrotate (or some other way) to add the date to a logfile when it is rotated. However in this system it is important that no logging is missing and dateext will overwrite any existing files (which will happen if logrotate is called twice on a day). Is there a reliable way to prevent dateext to overwrite existing files, but instead make another file?. It is acceptable that either no rotate happens or a file is created with a less predictable name (date with an extra number, or the time or something).

    Read the article

  • How to programmatically cut/copy/get files to/from Windows clipboard in a systam standard compliand

    - by Ivan
    How to put a cut/copy reference to specific files and/or folders into Windows clipboard so that when I open standard Windows Explorer window, go to somewhere and press Ctrl+V - the files are pasted? If I copy or cut some files/folders in Windows Explorer, how do I get this info (full names and whether they were cut or copied) in my Program? I program in C#4, but other languages ways are also interesting to know.

    Read the article

  • Which open source repository or version control systems store files' original mtime, ctime and atime

    - by sampablokuper
    I want to create a personal digital archive. I want to be able to check digital files (some several years old, some recent, some not yet created) into that archive and have them preserved, along with their metadata such as ctime, atime and mtime. I want to be able to check these files out of that archive, modify their contents and commit the changes back to the archive, while keeping the earlier commits and their metadata intact. I want the archive to be very reliable and secure, and able to be backed up remotely. I want to be able to check files in and out of the archive from PCs running Linux, Mac OS X 10.5+ or Win XP+. I want to be able to check files in and out of the archive from PCs with RAM capacities lower than the size of the files. E.g. I want to be able to check in/out a 13GB file using a PC with 2GB RAM. I thought Subversion could do all this, but apparently it can't. (At least, it couldn't a couple of years ago and as far as I know it still can't; correct me if I'm wrong.) Is there a libre VCS or similar capable of all these things? Thanks for your help.

    Read the article

  • Advanced ID3 tags handling and audio files ordering

    - by Juhele
    Some of my files do not have complete ID3 tags and some have typos or small differences in writing – so finally, my portable player sees “Mr. President” as different artist from “Mr President” and so on. I would need some tool which could search similar tags and then allow me to correct the typos or for example override artist in all selected files by manually entered text. The same with empty tag items – sometimes, the track name, album etc. is OK, but the artist is missing etc. I'd like to do this without touching the audio quality, of course (but this should be no problem, I think). I already tried tools like: Winamp Songbird other players Tagscanner – the most advanced free tool I tried. However, it is not able to to solve the problem with similar tags. Do you know such tool? Preferably free and for Windows, if possible. However, if you know some commercial app able to do this, please let me know.

    Read the article

  • Webserver sending corrupt or corrupting served files

    - by NotIan
    EDIT: Looks like the problem was a rootkit that corrupted a bunch of low level linux commands, including top, ps, ifconfig, netstat and others. The problem was resolved by taking all web files off the server and wiping it. A dedicated server we operate is having a strange issue. Files are not be sent complete or are showing up with garbage data. Example: http://sustainablefitness.com/images/banner_bootcamps.jpg To make matters more confusing this corruption does NOT happen when the files are served as https, (I would post a link, but I don't have enough rep points, just add an 's' after http in the link above.) When I throw load at the server, I get dozens of (swapd)s in top this is the only thing that really jumps out. I can't post images but ( imgur.com / ZArSq.png ) is a screenshot of top. I have tried a lot of stuff so far, I am willing to try anything that I can. A dedicated server we operate is having a strange issue. Files are not be sent complete or are showing up with garbage data. Example: http://sustainablefitness.com/images/banner_bootcamps.jpg To make matters more confusing this corruption does NOT happen when the files are served as https, (I would post a link, but I don't have enough rep points, just add an 's' after http in the link above.) When I throw load at the server, I get dozens of (swapd)s in top this is the only thing that really jumps out. I can't post images but ( imgur.com / ZArSq.png ) is a screenshot of top. I have tried a lot of stuff so far, I am willing to try anything that I can.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • 403 Forbidden serving static files from VirtualBox shared folder with nginx (Ubuntu 10.04LTS guest, Windows 7 host)

    - by Chris Pratt
    I'm working on a local development VM and trying to test serving my site with gunicorn and nginx as a reverse proxy for static resources only. The site loads minus static resources with user nginx; in nginx.conf. Attempting to load a static resource individually reveals a 403 Forbidden error. For background. The static resources are in a shared folder under /media/sf_work. All files are owned by root:vboxsf (VirtualBox default). My user account on the system has been added to the vboxsf group, and I have full access to the shared folder. For comparison, I tried changing the nginx.conf user to my user account. In that scenario, the static files did load, but then the homepage itself gives a 403 Forbidden error. So, I then tried adding the nginx user to the vboxsf group, but then everything gives a 403 Forbidden error. After further investigation it seems that if the nginx.conf user is in any group, it results in a 403 Forbidden. Any idea what could possibly be going on here?

    Read the article

  • Storage of various linux config files

    - by stantona
    I'm using git to track/store all my various config files required for linux. They're organized as if they live in my home directory, eg: .Xresources .config/ Awesome rc.lua .xmodmap .zshrc vim/ <- submodule emacs/ <- submodule etc I use git submodules for other things like vim/emacs configuration (since I also want to keep those separate repos). I'm thinking of creating a shell script to create the various links to these files. The goal is to make it easier to setup another linux painlessly. Is this a reasonable idea? Is there a preferred approach? I'm mostly interested in hearing how others people store their configs.

    Read the article

  • Using rsync to synchronise folders without overwriting files of same name on Mac OS X

    - by Adam
    I would like to synchronise the contents of two directories. Without overwriting but to create a copy if two files have the same name, but different sizes Without duplicating if two files have the same name and size. To work recursively So far I have found the following command which might work $ rsync -varE --progress ~/folder /volumes/server/folder But I'm not entirely sure what the -E flag does. It was suggested by a user on bananica.com but couldn't see a description for it in the manual. Would this do what I require successfully? Thanks

    Read the article

  • Which compiler option I should choose?

    - by Surjya Narayana Padhi
    Hi Geeks, I have to use the third party static library for my qt application to run on windows. The third party provides me a .lib and .h file for use. These libraries are compiled with MSVC compiler. My qt Creator is using MinGW compiler to compile my application. I copied the .h and .lib file to my qt project directory and then added those in .pro file as follows QT += core gui TARGET = MyTest TEMPLATE = app LIBS += C:\Qt\2010.05\qt\MyTest\newApi.lib SOURCES += main.cpp\ mainwindow.cpp HEADERS += mainwindow.h \ newApi.h FORMS += mainwindow.ui Now I am getting some runtime error like this - Starting C:\Qt\2010.05\qt\MyTest-build-desktop\debug\MyTest.exe... C:\Qt\2010.05\qt\MyTest-build-desktop\debug\MyTest.exe exited with code -1073741515 Can any body suggest is this runtime error is due to mismatch of compiler? (because of my .lib file I added is comipled in MSVC compiler and my qt app is compiled using MinGW compiler) If not what may be the reason? Am I missing anything in adding the .h and .lib file to my qt project? If my MinGW compiler will not support the .lib file generated in MSVC compiler what may be the work-arround? Can I create the .lib files in MinGW compiler? or this format is supported only by MSVC compiler only? Please suggest...

    Read the article

  • Oracle application - files missing in the Mount point in UNix server

    - by arun_V
    My oracle application test instance is down, When I browse through the Unix server, I couldn’t find any files in the mount point,U01 U06 or U10, when I put BDF command it shows the following $ bdf Filesystem kbytes used avail %used Mounted on /dev/vg00/lvol3 204800 35571 158662 18% / /dev/vg00/lvol1 299157 38506 230735 14% /stand /dev/vg00/lvol8 1392640 1261068 123620 91% /var /dev/vg00/lvol7 1327104 825170 470631 64% /usr /dev/vg00/lvol4 716800 385891 310746 55% /tmp /dev/vg00/lvol6 872448 814943 53936 94% /opt /dev/vg00/lvolssh 32768 13243 18306 42% /opt/openssh /dev/vg00/lvol5 204800 187397 16334 92% /home /dev/vg00/lvolback 512000 472879 36704 93% /backup dg-ora04:/dgora03_u10 204800 167088 35416 83% /u10 dg-ora04:/dgora03_u06 204800 167088 35416 83% /u06 dg-ora04:/dgora03_u01 204800 167088 35416 83% /u01 Why can't I see any files inside the mount points?

    Read the article

  • Making archive from files with same names in different directories

    - by Tim
    Hi, I have some files with same names but under different directories. For example, path1/filea, path1/fileb, path2/filea, path2/fileb,.... What is the best way to make the files into an archive? Under these directories, there are other files that I don't want to make into the archive. Off the top of my head, I think of using Bash, probably ar, tar and other commands, but am not sure how exactly to do it. Renaming the files seems to make the file names a little complicated. I tend to keep the directory structure inside the archive. Or I might be wrong. Other ideas are welcome! Thanks and regards!

    Read the article

  • best way to record local modifications to an application's configuration files

    - by Menelaos Perdikeas
    I often install applications in Linux which don't come in package form but rather one just downloads a tarball, unpacks it, and runs the app out of the exploded folder. To adjust the application to my environment I need to modify the default configuration files, perhaps add an odd script of my own and I would like to have a way to record all these modifications automatically so I can apply them to another environment. Clearly, the modifications can not be reproduced verbatim as things like IP addresses or username need to change from system to system; still an exhaustive record to what was changed and added would be useful. My solution is to use a pattern involving git. Basically after I explode the tarball I do a git init and an initial commit and then I can save to a file the output of git diff and a cat of all files appearing as new in the git status -s. But I am sure there are more efficient ways. ???

    Read the article

  • How to ignore the .classpath for Eclipse projects using Mercurial?

    - by Feanor
    I'm trying to share a repository between my Mac (laptop) and PC (desktop). There are some external dependencies for the project that are stored on different places on each machine, and noted in the .classpath file in the Eclipse project. When the project changes are shared, the dependencies break. I'm trying to figure out how to keep this from happening. I've tried using .hgignore with the following settings, among others, without success: syntax: glob *.classpath Based on this question, it appears that the .hgignore file will not allow Mercurial to ignore files that are also committed to the repository. Is there another way around this? Other ways to configure the project to make it work?

    Read the article

  • How to copy protected files when an Administrator in Vista (easily)

    - by earlz
    Hello, I have a harddrive I need to backup. In the harddrive is of course things like Documents and Settings which is set to not allow other people to see inside someone's personal folders. I am an administrator though and I can not figure out how to mark these files so that I am permitted to access them and copy them. IWhen I double click on My Documents then it pops up saying You must have permission to access this and gives me an option like ok or cancel. I click ok and then it says you do not have permission to access these files I'm an administrator on the system so I don't understand why Vista is locking me out. How can I setup vista so that it will let me copy every file, even ones I don't have permission to?

    Read the article

  • how to find files in a given branch

    - by Haiyuan Zhang
    I noticed that when doing code view, people here in my company usually just give the branch in which his work is done, and nothing else. So I guess there must be a easy way to find out all the files that has a version in the given branch which is the same thing to find all the files that has been the changed. Yes, I don't know the expected "easy way" to find files in certain branch, so need your help and thanks in advance.

    Read the article

  • Compile multiple C files with make

    - by Mohit Deshpande
    (I am running Linux Ubuntu 9.10, so the extension for an executable is executablefile.out) I am just getting into modular programming (programming with multiple files) in C and I want to know how to compile multiple files in a single makefile. For example, what would be the makefile to compile these files: main.c, dbAdapter.c, dbAdapter.h? (By the way, If you haven't figured it out yet, the main function is in main.c) Also could someone post a link to the documentation of a makefile?

    Read the article

  • Mixing two wav music files of different size

    - by iphoneDev
    Hi, I want to mix audio files of different size into a one single .wav file. There is a sample through which we can mix files of same size [(http://www.modejong.com/iOS/#ex4 )(Example 4)]. I modified the code to get the mixed file as a .wav file. But I am not able to understand that how to modify this code for unequal sized files. If someone can help me out with some code snippet,i'll be really thankful.

    Read the article

  • RealPath returns an empty string

    - by Abs
    Hello all, I have the following which just loops through the files in a directory and echo the file names. However, when I use realpath, it returns nothing. What am I doing wrong: if ($handle = opendir($font_path)) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != ".." && $file != "a.zip") { echo $file.'<br />';//i can see file names fine echo realpath($file);// return empty string?! } } closedir($handle); } Thanks all for any help on this. ~I am on a windows machine, running php 5.3 and apache 2.2.

    Read the article

  • Can't access my files in ASP.NET web site

    - by jumbojs
    I'm having a very difficult time. I am running windows 2008 server, I have an Able Commerce site using ASP.NET with C#. I'm writing an automated task that will ftp some xml files down into a local directory on our web server and then the program parses the xml file and saves information to our database. The problem, once I save the files to our local directory, my program has no access to the files. The NETWORK SERVICE user permissions isn't being inherited by the xml files so my program can't do anything with them. I can manually change the permissions, but this wouldn't be automated and won't work. How can I get this to work? help please, it's very frustrating.

    Read the article

  • Wrong owner and group for files created under a samba shared directory

    - by agmao
    I am trying to make writing to a shared samba directory work. I got a very weird problem. Now the shared directory is writable from a client machine. But the files created under the samba share directory have weird owner and group names. I am writing to the shared directory as user mike under the client machine, but the file created always has user and group name as steve instead... Does anybody know why that would happen...? Another thing I just noticed is that on the samba server, the files have owner and user name as samba, which I created for samba clients. Thanks a lot

    Read the article

< Previous Page | 158 159 160 161 162 163 164 165 166 167 168 169  | Next Page >